Homologs in group_198

Help

7 homologs were identified in 2 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
F4V73_RS10280 F4V73_RS10280 22.2 Morganella psychrotolerans - fimbrial protein
PMI_RS05775 PMI_RS05775 22.7 Proteus mirabilis HI4320 - fimbrial protein
PMI_RS10890 PMI_RS10890 22.7 Proteus mirabilis HI4320 - fimbrial protein
PMI_RS10895 PMI_RS10895 22.6 Proteus mirabilis HI4320 - fimbrial protein
PMI_RS12555 PMI_RS12555 24.5 Proteus mirabilis HI4320 - fimbrial protein
PMI_RS16670 PMI_RS16670 45.0 Proteus mirabilis HI4320 - fimbrial protein
PMI_RS17140 PMI_RS17140 24.7 Proteus mirabilis HI4320 - fimbrial protein

Distribution of the homologs in the orthogroup group_198

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_198

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P62605 5.8e-25 98 39 7 182 3 pilC Type-1 fimbrial protein, C chain Escherichia coli
P62606 5.8e-25 98 39 7 182 3 pilC Type-1 fimbrial protein, C chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P43660 9.04e-25 97 37 3 168 3 lpfA Long polar fimbria protein A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X5K5 7.08e-22 90 33 4 177 2 lpfA Probable major fimbrial subunit LpfA Escherichia coli O157:H7
P37926 1.03e-19 84 33 2 174 3 fimF Fimbrial-like protein FimF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P08189 1.75e-19 84 34 2 176 1 fimF Protein FimF Escherichia coli (strain K12)
P12730 6.11e-19 82 36 7 182 1 sfaA S-fimbrial protein subunit SfaA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P22595 9.43e-19 82 33 4 174 3 fimA Type-1 fimbrial protein subunit Serratia marcescens
P39264 2.58e-18 80 27 3 179 1 fimI Fimbrin-like protein FimI Escherichia coli (strain K12)
P37921 5.32e-18 80 34 6 187 1 fimA Type-1 fimbrial protein, A chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P75860 6.75e-18 79 34 2 153 2 ycbV Uncharacterized fimbrial-like protein YcbV Escherichia coli (strain K12)
P12903 3.85e-17 77 35 7 184 1 fim Fimbrial subunit type 1 Klebsiella pneumoniae
P37920 4.05e-17 77 35 7 187 3 fimA Type-1 fimbrial protein, A chain Salmonella typhi
P55223 3.56e-16 75 35 4 154 3 None Fimbrial subunit type 1 Salmonella typhimurium
P77789 4.24e-16 75 29 2 173 3 ydeS Uncharacterized fimbrial-like protein YdeS Escherichia coli (strain K12)
Q47223 3.76e-15 72 38 7 156 1 fimA Type-1 fimbrial protein, A chain Escherichia coli
P04128 1.2e-14 71 37 6 154 1 fimA Type-1 fimbrial protein, A chain Escherichia coli (strain K12)
P12266 2.71e-14 70 37 6 154 1 None Fimbrial subunit type 1 Klebsiella pneumoniae
Q8X582 1.76e-13 68 33 6 180 1 elfA Laminin-binding fimbrial subunit ElfA Escherichia coli O157:H7
P39834 6.6e-13 66 30 7 184 3 ygiL Uncharacterized fimbrial-like protein YgiL Escherichia coli (strain K12)
P75855 1.54e-12 65 32 6 180 1 elfA Fimbrial subunit ElfA Escherichia coli (strain K12)
P0ABW5 1.67e-11 62 34 4 154 2 sfmA Uncharacterized fimbrial-like protein SfmA Escherichia coli (strain K12)
P0ABW6 1.67e-11 62 34 4 154 3 sfmA Uncharacterized fimbrial-like protein SfmA Escherichia coli O157:H7
P45992 1.93e-10 60 33 6 185 3 hifD Minor fimbrial subunit HifD Haemophilus influenzae
Q08456 3.62e-10 59 25 5 180 5 fimI Putative fimbrin-like protein FimI Salmonella typhi
P37922 9.14e-10 58 25 5 171 3 fimI Fimbrin-like protein FimI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P75859 1.58e-09 57 26 3 152 2 ycbU Uncharacterized fimbrial-like protein YcbU Escherichia coli (strain K12)
Q03011 1.73e-09 57 29 7 182 1 mrpA Major MR/P fimbria protein Proteus mirabilis (strain HI4320)
P42913 2.36e-09 57 30 7 193 2 yraH Uncharacterized fimbrial-like protein YraH Escherichia coli (strain K12)
P37909 2.67e-09 57 29 7 178 1 ybgD Uncharacterized fimbrial-like protein YbgD Escherichia coli (strain K12)
Q8X5L0 3.52e-09 56 35 7 157 2 lpfE Probable fimbrial subunit LpfE Escherichia coli O157:H7
P38052 3.8e-09 56 29 3 147 2 sfmF Uncharacterized fimbrial-like protein SfmF Escherichia coli (strain K12)
P13421 6.37e-09 55 32 4 150 1 smfA Fimbria A protein Serratia marcescens
P13429 1.24e-08 55 28 4 171 1 sfaG S-fimbrial protein subunit SfaG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P17835 7.13e-08 53 42 3 91 3 fim3 Serotype 3 fimbrial subunit Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P43664 1.66e-07 52 30 6 172 3 lpfE Protein LpfE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P09808 1.73e-07 52 43 1 69 3 fimX Fimbrial protein FimX Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
B2FNJ0 5.69e-07 50 35 3 106 1 smf-1 Major fimbrial subunit SMF-1 Stenotrophomonas maltophilia (strain K279a)
P45993 1.65e-06 49 37 2 104 3 hifD Minor fimbrial subunit HifD Haemophilus influenzae
P45990 2.07e-06 49 33 2 92 3 hifA Major fimbrial subunit Haemophilus influenzae
P21413 5.57e-06 48 27 8 191 3 fasA Fimbrial protein 987P Escherichia coli
Q03846 8.58e-06 47 34 2 91 3 hifA Major fimbrial subunit Haemophilus influenzae
P05788 2.63e-05 46 45 2 62 3 fim2 Serotype 2 fimbrial subunit Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P11312 6.47e-05 44 30 4 160 3 F17a-A F17 fimbrial protein Escherichia coli
P42185 8.79e-05 44 25 5 163 3 prsH PRS fimbrial minor pilin protein Escherichia coli
P07111 0.000156 43 25 5 163 1 papH PAP fimbrial minor pilin protein Escherichia coli
Q04681 0.000601 42 30 5 152 1 pmfA Major fimbrial subunit Proteus mirabilis (strain HI4320)
P33343 0.000876 41 27 11 181 2 yehD Uncharacterized fimbrial-like protein YehD Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS10910
Feature type CDS
Gene -
Product fimbrial protein
Location 2403024 - 2403548 (strand: -1)
Length 525 (nucleotides) / 174 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_198
Orthogroup size 8
N. genomes 2

Actions

Genomic region

Domains

PF00419 Fimbrial protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3539 Cell motility (N) N Pilin (type 1 fimbrial protein)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07345 major type 1 subunit fimbrin (pilin) Shigellosis
Pertussis
-

Protein Sequence

MRKSFIAMLIATTSIFVANNALAADGTIDFTGEIIDNACELAAGSDALKVNLGKVSKTALPSAGVTAAATKFTIKLINCPATVSTASVKFDAESYSGDDTVIALKQESGVATGVGIQITDDANTVVPLFTASKTYPLKEGVENNLDFRARYIAKTDSVTAGLANANATFTINYN

Flanking regions ( +/- flanking 50bp)

TCTTATTTCTATTATCTCAATGTGTTTAAAATAATTATTTGGAGAAATAAATGAGAAAAAGCTTTATTGCAATGTTGATTGCTACAACGTCTATTTTTGTCGCGAATAATGCATTAGCTGCAGATGGAACAATCGATTTTACAGGAGAAATTATCGATAACGCATGTGAATTAGCAGCTGGATCTGATGCTCTAAAAGTTAATTTAGGTAAGGTATCTAAAACAGCATTACCTAGTGCCGGAGTTACTGCTGCGGCAACTAAATTTACGATTAAATTAATTAATTGCCCTGCAACAGTAAGTACTGCATCTGTTAAATTTGATGCAGAGTCTTATTCTGGAGACGATACTGTTATTGCGCTAAAACAAGAGTCGGGAGTGGCAACAGGTGTCGGTATTCAAATTACGGATGATGCAAATACTGTTGTCCCTTTATTTACCGCATCTAAAACTTATCCATTAAAAGAAGGTGTTGAAAATAATTTAGACTTTAGAGCTCGTTATATTGCTAAAACAGATTCTGTCACTGCGGGTTTAGCAAATGCGAATGCAACATTTACTATTAATTATAATTAAAAATAACTAGGTAAGTCATAAGGTTTAAAGGGATTTAAACCTTATTATAC