Homologs in group_5

Help

21 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05895 FBDBKF_05895 50.9 Morganella morganii S1 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
FBDBKF_09265 FBDBKF_09265 83.5 Morganella morganii S1 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
FBDBKF_19935 FBDBKF_19935 39.8 Morganella morganii S1 nlpA lipoprotein NlpA
EHELCC_07680 EHELCC_07680 39.8 Morganella morganii S2 nlpA lipoprotein NlpA
EHELCC_08940 EHELCC_08940 50.9 Morganella morganii S2 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
EHELCC_10145 EHELCC_10145 83.5 Morganella morganii S2 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
NLDBIP_08005 NLDBIP_08005 39.8 Morganella morganii S4 nlpA lipoprotein NlpA
NLDBIP_09320 NLDBIP_09320 50.9 Morganella morganii S4 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
NLDBIP_10490 NLDBIP_10490 83.5 Morganella morganii S4 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
LHKJJB_06260 LHKJJB_06260 39.8 Morganella morganii S3 nlpA lipoprotein NlpA
LHKJJB_08435 LHKJJB_08435 50.9 Morganella morganii S3 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
LHKJJB_10865 LHKJJB_10865 83.5 Morganella morganii S3 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
HKOGLL_07985 HKOGLL_07985 50.9 Morganella morganii S5 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
HKOGLL_13925 HKOGLL_13925 83.5 Morganella morganii S5 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
HKOGLL_19115 HKOGLL_19115 39.8 Morganella morganii S5 nlpA lipoprotein NlpA
F4V73_RS02430 F4V73_RS02430 39.5 Morganella psychrotolerans nlpA lipoprotein NlpA
F4V73_RS10700 F4V73_RS10700 80.9 Morganella psychrotolerans - MetQ/NlpA family lipoprotein
F4V73_RS16000 F4V73_RS16000 51.3 Morganella psychrotolerans - MetQ/NlpA family lipoprotein
PMI_RS06020 PMI_RS06020 54.1 Proteus mirabilis HI4320 - MetQ/NlpA family lipoprotein
PMI_RS06360 PMI_RS06360 37.8 Proteus mirabilis HI4320 - MetQ/NlpA family lipoprotein
PMI_RS11165 PMI_RS11165 47.9 Proteus mirabilis HI4320 - MetQ/NlpA family lipoprotein

Distribution of the homologs in the orthogroup group_5

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_5

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZRN1 2.29e-99 294 55 1 255 3 metQ D-methionine-binding lipoprotein MetQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z992 2.45e-98 291 54 1 255 3 metQ D-methionine-binding lipoprotein MetQ Salmonella typhi
P28635 6.26e-97 288 53 1 255 1 metQ D-methionine-binding lipoprotein MetQ Escherichia coli (strain K12)
Q8X8V9 7.54e-97 288 53 1 255 3 metQ D-methionine-binding lipoprotein MetQ Escherichia coli O157:H7
Q8ZH40 2.37e-95 284 53 1 255 3 metQ D-methionine-binding lipoprotein MetQ Yersinia pestis
Q9CK95 9.53e-80 244 44 2 266 3 metQ Probable D-methionine-binding lipoprotein MetQ Pasteurella multocida (strain Pm70)
Q08870 3.67e-79 243 46 3 267 3 plpC Outer membrane lipoprotein 3 Mannheimia haemolytica
Q08869 1.23e-78 241 48 3 278 3 plpB Outer membrane lipoprotein 2 Mannheimia haemolytica
P31728 4.08e-78 240 44 4 272 1 metQ Probable D-methionine-binding lipoprotein MetQ Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q08868 1.79e-72 226 39 4 279 3 plpA Outer membrane lipoprotein 1 Mannheimia haemolytica
Q8XC50 1.05e-70 221 43 1 248 3 nlpA Lipoprotein 28 Escherichia coli O157:H7
P04846 2.12e-70 220 42 1 249 1 nlpA Lipoprotein 28 Escherichia coli (strain K12)
Q9KTJ7 5.6e-67 212 45 2 266 3 metQ Probable D-methionine-binding lipoprotein MetQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O32167 1.61e-37 136 34 7 269 1 metQ Methionine-binding lipoprotein MetQ Bacillus subtilis (strain 168)
P54594 7.18e-36 132 30 6 272 3 yhcJ Uncharacterized lipoprotein YhcJ Bacillus subtilis (strain 168)
O07950 2.12e-34 128 28 3 259 1 tpn32 Membrane lipoprotein TpN32 Treponema pallidum (strain Nichols)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14940
Feature type CDS
Gene -
Product MetQ/NlpA family ABC transporter substrate-binding protein
Location 3315888 - 3316691 (strand: -1)
Length 804 (nucleotides) / 267 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_5
Orthogroup size 22
N. genomes 7

Actions

Genomic region

Domains

PF03180 NlpA lipoprotein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1464 Inorganic ion transport and metabolism (P) P ABC-type metal ion transport system, periplasmic component/surface antigen

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02073 D-methionine transport system substrate-binding protein ABC transporters -

Protein Sequence

MRKLLLVVLLACTSLVLTACSPDEGDKPLKVAINTGPDQQIWDEVVKLAKEKQGLDIKVITFNDYVLPNEALRNNDVDVNAFQTVPYYEAQSKERGYQFEIIGKTFIFPIAAYSNKIKTIEALPDGATVAISNEATTLGRSLLLLQAQGLIKLKDGVGYLPTTLDIIENPKKLKFAEIDTPQLTRTLSDPNIYLSIINNNFSSQVGLLAKRDGLFMENTDSPYVNLIVARAIDKDNERLKKLVAVFQSDEILQKAQEVYKGDAVKAW

Flanking regions ( +/- flanking 50bp)

ACAATAAGTTATAAATAATAAGAGTGACATGGTCGATTATTGGAGAGAAGATGAGAAAATTATTATTAGTGGTGCTTTTGGCCTGTACTTCATTGGTTTTAACCGCTTGCTCACCAGATGAAGGTGATAAACCGTTAAAAGTGGCAATAAATACAGGGCCAGATCAGCAAATTTGGGATGAAGTTGTTAAGCTGGCAAAAGAAAAGCAGGGATTAGATATCAAGGTGATCACCTTTAATGACTACGTGTTACCTAATGAAGCTTTGCGTAATAATGATGTTGATGTGAATGCGTTCCAAACCGTACCTTACTACGAAGCTCAAAGCAAAGAGCGTGGTTATCAATTTGAAATCATAGGTAAAACCTTTATTTTTCCTATTGCAGCTTATTCAAATAAAATCAAAACCATAGAGGCGCTTCCTGATGGTGCTACTGTCGCTATTTCTAATGAAGCAACCACCCTAGGTCGTAGTTTATTATTACTGCAGGCTCAAGGATTGATTAAATTAAAAGATGGGGTGGGGTATTTACCAACGACACTTGATATTATTGAAAACCCTAAGAAACTTAAATTTGCAGAAATTGATACACCACAACTAACTCGTACGTTAAGTGATCCTAATATTTACCTTTCCATCATCAATAATAACTTCTCTTCACAAGTGGGATTATTAGCCAAACGAGATGGTTTATTTATGGAAAATACCGATTCTCCTTATGTTAATTTGATTGTTGCCAGAGCCATAGACAAAGATAACGAACGATTAAAAAAACTCGTCGCGGTTTTCCAAAGTGATGAAATTTTGCAAAAAGCGCAAGAAGTTTATAAAGGTGATGCGGTGAAAGCGTGGTAACGCGCTATTTTCTAATAAAAAGAGATGATAGATATCAAGGCCTCCCTATT