Homologs in group_5

Help

21 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05895 FBDBKF_05895 41.7 Morganella morganii S1 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
FBDBKF_09265 FBDBKF_09265 54.9 Morganella morganii S1 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
FBDBKF_19935 FBDBKF_19935 37.0 Morganella morganii S1 nlpA lipoprotein NlpA
EHELCC_07680 EHELCC_07680 37.0 Morganella morganii S2 nlpA lipoprotein NlpA
EHELCC_08940 EHELCC_08940 41.7 Morganella morganii S2 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
EHELCC_10145 EHELCC_10145 54.9 Morganella morganii S2 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
NLDBIP_08005 NLDBIP_08005 37.0 Morganella morganii S4 nlpA lipoprotein NlpA
NLDBIP_09320 NLDBIP_09320 41.7 Morganella morganii S4 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
NLDBIP_10490 NLDBIP_10490 54.9 Morganella morganii S4 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
LHKJJB_06260 LHKJJB_06260 37.0 Morganella morganii S3 nlpA lipoprotein NlpA
LHKJJB_08435 LHKJJB_08435 41.7 Morganella morganii S3 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
LHKJJB_10865 LHKJJB_10865 54.9 Morganella morganii S3 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
HKOGLL_07985 HKOGLL_07985 41.7 Morganella morganii S5 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
HKOGLL_13925 HKOGLL_13925 54.9 Morganella morganii S5 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
HKOGLL_19115 HKOGLL_19115 37.0 Morganella morganii S5 nlpA lipoprotein NlpA
F4V73_RS02430 F4V73_RS02430 37.4 Morganella psychrotolerans nlpA lipoprotein NlpA
F4V73_RS10700 F4V73_RS10700 54.1 Morganella psychrotolerans - MetQ/NlpA family lipoprotein
F4V73_RS16000 F4V73_RS16000 41.4 Morganella psychrotolerans - MetQ/NlpA family lipoprotein
PMI_RS06360 PMI_RS06360 36.5 Proteus mirabilis HI4320 - MetQ/NlpA family lipoprotein
PMI_RS11165 PMI_RS11165 40.6 Proteus mirabilis HI4320 - MetQ/NlpA family lipoprotein
PMI_RS14940 PMI_RS14940 54.1 Proteus mirabilis HI4320 - MetQ/NlpA family ABC transporter substrate-binding protein

Distribution of the homologs in the orthogroup group_5

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_5

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZRN1 2.44e-72 225 41 0 260 3 metQ D-methionine-binding lipoprotein MetQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P28635 2.87e-72 225 41 0 260 1 metQ D-methionine-binding lipoprotein MetQ Escherichia coli (strain K12)
Q8X8V9 2.44e-71 223 40 0 260 3 metQ D-methionine-binding lipoprotein MetQ Escherichia coli O157:H7
Q8Z992 3.28e-71 223 41 0 260 3 metQ D-methionine-binding lipoprotein MetQ Salmonella typhi
Q8ZH40 4.9e-69 217 39 0 258 3 metQ D-methionine-binding lipoprotein MetQ Yersinia pestis
Q08870 1.1e-61 198 37 2 257 3 plpC Outer membrane lipoprotein 3 Mannheimia haemolytica
P04846 2.7e-61 197 39 1 249 1 nlpA Lipoprotein 28 Escherichia coli (strain K12)
Q8XC50 8.43e-61 196 39 1 249 3 nlpA Lipoprotein 28 Escherichia coli O157:H7
Q08869 2.81e-58 189 39 1 250 3 plpB Outer membrane lipoprotein 2 Mannheimia haemolytica
Q9CK95 4.15e-58 189 40 1 237 3 metQ Probable D-methionine-binding lipoprotein MetQ Pasteurella multocida (strain Pm70)
P31728 6.18e-57 186 38 2 240 1 metQ Probable D-methionine-binding lipoprotein MetQ Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q08868 1.53e-53 177 37 2 240 3 plpA Outer membrane lipoprotein 1 Mannheimia haemolytica
Q9KTJ7 7.32e-49 165 35 3 268 3 metQ Probable D-methionine-binding lipoprotein MetQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O07950 3.37e-37 135 31 2 254 1 tpn32 Membrane lipoprotein TpN32 Treponema pallidum (strain Nichols)
O32167 1.33e-30 118 30 5 268 1 metQ Methionine-binding lipoprotein MetQ Bacillus subtilis (strain 168)
P54594 8.7e-28 110 28 5 270 3 yhcJ Uncharacterized lipoprotein YhcJ Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06020
Feature type CDS
Gene -
Product MetQ/NlpA family lipoprotein
Location 1319484 - 1320284 (strand: 1)
Length 801 (nucleotides) / 266 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_5
Orthogroup size 22
N. genomes 7

Actions

Genomic region

Domains

PF03180 NlpA lipoprotein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1464 Inorganic ion transport and metabolism (P) P ABC-type metal ion transport system, periplasmic component/surface antigen

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02073 D-methionine transport system substrate-binding protein ABC transporters -

Protein Sequence

MKEIITGLLLASISLFSVSCSQEDTDVVKVAINTGPDQVIWDEVIRLAKLTEGLNVEVIAFNDYERPNKALENREVDVNVFQSIPYLQSEIKAHNYKFHIASKTYIFPLAAYSKKISDISELEYGDVVAIPNEASMKGRALLLLAENHLISLKEGVGFLPSVEDIIDNPNALIFHEVETPMLVEALDDPEVTMAVINNNFSSQIGLLATRDGLIMENKHSPYANVVVTRIDNMNDEKIKKLITVLHSRQVELKVQEMYKGDAVKAW

Flanking regions ( +/- flanking 50bp)

AATATGCTGATAATTTTGTGTTTGTCATGTTCCGTTTTTAAGAGGGAGTTATGAAGGAAATTATTACAGGTTTGCTTCTAGCCTCAATAAGCTTATTTTCTGTCTCTTGTTCGCAAGAAGATACAGATGTCGTCAAAGTAGCAATCAATACTGGACCAGACCAAGTCATTTGGGATGAAGTGATCCGTTTAGCTAAACTTACCGAAGGATTAAATGTTGAAGTTATTGCATTTAACGACTATGAACGTCCTAATAAAGCCCTAGAAAATAGAGAAGTAGACGTAAATGTATTTCAATCTATTCCTTATTTACAATCAGAGATAAAAGCCCACAATTACAAATTTCATATTGCCAGCAAAACGTACATCTTCCCGTTAGCAGCGTATTCTAAGAAAATAAGCGATATTAGCGAACTCGAATATGGTGATGTGGTTGCCATCCCTAATGAAGCAAGTATGAAAGGGCGAGCTTTATTATTACTTGCAGAAAATCACCTCATTTCTTTAAAAGAGGGGGTTGGTTTTTTACCTTCCGTTGAAGACATTATTGATAATCCTAATGCCTTGATATTTCATGAAGTTGAAACTCCCATGTTAGTTGAAGCCCTTGATGATCCTGAGGTTACGATGGCGGTTATCAACAATAATTTTTCCTCTCAAATTGGCTTACTTGCTACCCGCGACGGTTTAATTATGGAGAATAAACATTCGCCTTATGCCAATGTTGTTGTTACTCGTATAGATAATATGAATGATGAAAAAATAAAGAAATTAATTACTGTTTTACATTCAAGACAAGTCGAATTAAAGGTGCAAGAAATGTATAAAGGGGACGCGGTTAAGGCGTGGTAGAACATATTTCAGGTTAAAAAACAAACAGTTCAATATAACTATGAGTTTCT