Homologs in group_5

Help

21 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05895 FBDBKF_05895 52.1 Morganella morganii S1 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
FBDBKF_19935 FBDBKF_19935 42.9 Morganella morganii S1 nlpA lipoprotein NlpA
EHELCC_07680 EHELCC_07680 42.9 Morganella morganii S2 nlpA lipoprotein NlpA
EHELCC_08940 EHELCC_08940 52.1 Morganella morganii S2 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
EHELCC_10145 EHELCC_10145 100.0 Morganella morganii S2 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
NLDBIP_08005 NLDBIP_08005 42.9 Morganella morganii S4 nlpA lipoprotein NlpA
NLDBIP_09320 NLDBIP_09320 52.1 Morganella morganii S4 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
NLDBIP_10490 NLDBIP_10490 100.0 Morganella morganii S4 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
LHKJJB_06260 LHKJJB_06260 42.9 Morganella morganii S3 nlpA lipoprotein NlpA
LHKJJB_08435 LHKJJB_08435 52.1 Morganella morganii S3 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
LHKJJB_10865 LHKJJB_10865 100.0 Morganella morganii S3 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
HKOGLL_07985 HKOGLL_07985 52.1 Morganella morganii S5 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
HKOGLL_13925 HKOGLL_13925 100.0 Morganella morganii S5 metQ ABC-type metal ion transport system, periplasmic component/surface antigen
HKOGLL_19115 HKOGLL_19115 42.9 Morganella morganii S5 nlpA lipoprotein NlpA
F4V73_RS02430 F4V73_RS02430 42.1 Morganella psychrotolerans nlpA lipoprotein NlpA
F4V73_RS10700 F4V73_RS10700 93.3 Morganella psychrotolerans - MetQ/NlpA family lipoprotein
F4V73_RS16000 F4V73_RS16000 51.7 Morganella psychrotolerans - MetQ/NlpA family lipoprotein
PMI_RS06020 PMI_RS06020 54.9 Proteus mirabilis HI4320 - MetQ/NlpA family lipoprotein
PMI_RS06360 PMI_RS06360 41.2 Proteus mirabilis HI4320 - MetQ/NlpA family lipoprotein
PMI_RS11165 PMI_RS11165 48.3 Proteus mirabilis HI4320 - MetQ/NlpA family lipoprotein
PMI_RS14940 PMI_RS14940 83.5 Proteus mirabilis HI4320 - MetQ/NlpA family ABC transporter substrate-binding protein

Distribution of the homologs in the orthogroup group_5

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_5

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZRN1 9.85e-101 298 55 2 263 3 metQ D-methionine-binding lipoprotein MetQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z992 1.23e-99 295 55 2 263 3 metQ D-methionine-binding lipoprotein MetQ Salmonella typhi
P28635 4.91e-99 293 54 2 263 1 metQ D-methionine-binding lipoprotein MetQ Escherichia coli (strain K12)
Q8X8V9 5.36e-99 293 54 2 263 3 metQ D-methionine-binding lipoprotein MetQ Escherichia coli O157:H7
Q8ZH40 6.4e-96 285 53 1 262 3 metQ D-methionine-binding lipoprotein MetQ Yersinia pestis
Q08870 2.98e-81 248 46 2 267 3 plpC Outer membrane lipoprotein 3 Mannheimia haemolytica
Q9CK95 9.27e-81 247 49 1 241 3 metQ Probable D-methionine-binding lipoprotein MetQ Pasteurella multocida (strain Pm70)
Q08869 1.92e-78 241 49 2 263 3 plpB Outer membrane lipoprotein 2 Mannheimia haemolytica
Q8XC50 7.04e-78 239 46 1 249 3 nlpA Lipoprotein 28 Escherichia coli O157:H7
P04846 1.48e-76 236 45 1 249 1 nlpA Lipoprotein 28 Escherichia coli (strain K12)
P31728 2.4e-75 233 44 4 265 1 metQ Probable D-methionine-binding lipoprotein MetQ Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q08868 4.17e-73 228 43 2 240 3 plpA Outer membrane lipoprotein 1 Mannheimia haemolytica
Q9KTJ7 1.93e-67 213 46 1 267 3 metQ Probable D-methionine-binding lipoprotein MetQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O07950 1.23e-37 136 30 5 263 1 tpn32 Membrane lipoprotein TpN32 Treponema pallidum (strain Nichols)
O32167 1.16e-35 131 33 7 269 1 metQ Methionine-binding lipoprotein MetQ Bacillus subtilis (strain 168)
P54594 2.76e-35 130 30 5 268 3 yhcJ Uncharacterized lipoprotein YhcJ Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_09265
Feature type CDS
Gene metQ
Product ABC-type metal ion transport system, periplasmic component/surface antigen
Location 84704 - 85507 (strand: -1)
Length 804 (nucleotides) / 267 (amino acids)

Contig

Accession contig_10
Length 146103 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_5
Orthogroup size 22
N. genomes 7

Actions

Genomic region

Domains

PF03180 NlpA lipoprotein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1464 Inorganic ion transport and metabolism (P) P ABC-type metal ion transport system, periplasmic component/surface antigen

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02073 D-methionine transport system substrate-binding protein ABC transporters -

Protein Sequence

MRKIIVSALLACTTLLAVSCSQNDDEKPLKVAINTGPDQAIWEEVVNVAKEKQGLDVDVIAFNDYVLPNEALRNNDVDANAFQTVPYYEAQSKERGYQFEVIGKTFIFPIAAYSKKIKSAAELPDGATVAISNEATTLGRSLLLLQAQGLIKLKDGVGYLPTTLDIIENPKKLKFAEIDTPQLTRTLDDPDVYLSIINNNFSSQVGLSAARDGLFMEGADSPYVNLIVVRAADKDNEKLKKLVAAFQSDEVLKKADEVYKGDAVRAW

Flanking regions ( +/- flanking 50bp)

ATATTAAAAATCAATAAAATATAACCATAACAATATGTTCCGGAGATAGTATGAGAAAAATTATTGTATCGGCACTGCTCGCCTGCACCACATTACTGGCCGTGTCGTGCTCGCAGAATGACGATGAAAAACCACTGAAAGTGGCGATTAACACCGGGCCGGATCAGGCTATCTGGGAAGAAGTGGTCAACGTCGCTAAGGAGAAGCAGGGGCTGGATGTTGATGTTATCGCCTTTAATGACTATGTCCTGCCGAATGAAGCGCTGCGCAACAATGATGTGGATGCCAATGCATTCCAGACCGTGCCGTACTATGAGGCGCAAAGCAAAGAACGCGGTTATCAGTTTGAAGTTATTGGTAAAACTTTTATCTTCCCGATAGCGGCATACTCAAAGAAAATCAAATCCGCAGCCGAACTGCCGGACGGCGCAACAGTGGCTATCTCCAACGAAGCCACCACACTCGGCCGCAGCCTGCTGCTGTTACAGGCTCAGGGGCTGATTAAACTGAAAGACGGCGTCGGTTATCTGCCGACCACCCTGGATATCATTGAAAATCCGAAGAAACTGAAGTTTGCGGAGATCGATACCCCGCAACTGACCCGCACACTCGATGACCCGGATGTGTATCTCTCCATTATCAACAATAACTTCTCATCTCAGGTCGGATTATCCGCCGCCCGTGACGGTCTGTTTATGGAAGGGGCTGATTCCCCGTATGTGAACCTGATTGTGGTCAGAGCGGCAGATAAAGACAATGAGAAGCTGAAAAAACTGGTCGCGGCATTCCAGAGTGATGAGGTGCTGAAAAAGGCCGATGAGGTGTATAAAGGCGATGCTGTCCGGGCCTGGTAAATACGTGTCATCCTTCCGTCCATAGCTGCGTTGGCTTCGTTCGTCCATCC