Homologs in group_197

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20065 FBDBKF_20065 53.3 Morganella morganii S1 fimA type 1 fimbrial major subunit FimA
EHELCC_03465 EHELCC_03465 53.3 Morganella morganii S2 fimA type 1 fimbrial major subunit FimA
NLDBIP_03465 NLDBIP_03465 53.3 Morganella morganii S4 fimA type 1 fimbrial major subunit FimA
LHKJJB_09295 LHKJJB_09295 53.3 Morganella morganii S3 fimA type 1 fimbrial major subunit FimA
HKOGLL_09680 HKOGLL_09680 53.3 Morganella morganii S5 fimA type 1 fimbrial major subunit FimA
F4V73_RS01035 F4V73_RS01035 35.4 Morganella psychrotolerans - fimbrial protein
F4V73_RS01685 F4V73_RS01685 52.8 Morganella psychrotolerans fimA type 1 fimbrial major subunit FimA

Distribution of the homologs in the orthogroup group_197

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_197

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P12903 6.43e-56 177 53 2 189 1 fim Fimbrial subunit type 1 Klebsiella pneumoniae
Q47223 3.47e-54 173 53 2 189 1 fimA Type-1 fimbrial protein, A chain Escherichia coli
P12730 6.69e-53 170 50 1 188 1 sfaA S-fimbrial protein subunit SfaA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P04128 1.9e-51 166 60 1 155 1 fimA Type-1 fimbrial protein, A chain Escherichia coli (strain K12)
P62605 4.07e-50 162 49 2 188 3 pilC Type-1 fimbrial protein, C chain Escherichia coli
P62606 4.07e-50 162 49 2 188 3 pilC Type-1 fimbrial protein, C chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P12266 9.17e-50 162 58 1 156 1 None Fimbrial subunit type 1 Klebsiella pneumoniae
P37920 1.87e-42 143 49 2 169 3 fimA Type-1 fimbrial protein, A chain Salmonella typhi
P37921 2.94e-41 140 48 3 170 1 fimA Type-1 fimbrial protein, A chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55223 3.61e-41 140 49 3 165 3 None Fimbrial subunit type 1 Salmonella typhimurium
P0ABW5 1.85e-30 112 47 2 156 2 sfmA Uncharacterized fimbrial-like protein SfmA Escherichia coli (strain K12)
P0ABW6 1.85e-30 112 47 2 156 3 sfmA Uncharacterized fimbrial-like protein SfmA Escherichia coli O157:H7
Q8X5K5 2.8e-21 89 35 5 178 2 lpfA Probable major fimbrial subunit LpfA Escherichia coli O157:H7
P39264 4.25e-16 75 28 6 185 1 fimI Fimbrin-like protein FimI Escherichia coli (strain K12)
P43660 6.34e-16 75 34 5 183 3 lpfA Long polar fimbria protein A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45992 3.33e-15 73 35 7 162 3 hifD Minor fimbrial subunit HifD Haemophilus influenzae
Q04681 5.08e-15 72 33 7 196 1 pmfA Major fimbrial subunit Proteus mirabilis (strain HI4320)
Q03011 7.62e-14 69 34 7 191 1 mrpA Major MR/P fimbria protein Proteus mirabilis (strain HI4320)
P37922 1.84e-13 68 28 4 164 3 fimI Fimbrin-like protein FimI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q08456 2.49e-13 68 28 5 168 5 fimI Putative fimbrin-like protein FimI Salmonella typhi
P22595 2.21e-12 65 32 5 159 3 fimA Type-1 fimbrial protein subunit Serratia marcescens
P13421 1.59e-11 63 31 8 194 1 smfA Fimbria A protein Serratia marcescens
P62607 2.5e-10 60 30 4 165 3 F7-2 F7-2 fimbrial protein Escherichia coli
P62608 2.5e-10 60 30 4 165 3 F7-2 F7-2 fimbrial protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8X582 3.13e-10 59 27 5 188 1 elfA Laminin-binding fimbrial subunit ElfA Escherichia coli O157:H7
P77789 3.59e-10 59 28 4 152 3 ydeS Uncharacterized fimbrial-like protein YdeS Escherichia coli (strain K12)
P04740 4.77e-10 59 30 3 137 3 KS71A KS71A fimbrillin Escherichia coli
P37926 5.23e-10 58 30 6 150 3 fimF Fimbrial-like protein FimF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P39834 9.64e-10 58 31 7 161 3 ygiL Uncharacterized fimbrial-like protein YgiL Escherichia coli (strain K12)
P75855 1.31e-09 58 27 5 188 1 elfA Fimbrial subunit ElfA Escherichia coli (strain K12)
P42184 1.41e-09 57 33 4 133 1 prsA PRS fimbrial major pilin protein (Fragment) Escherichia coli
P38052 4.92e-08 53 28 8 167 2 sfmF Uncharacterized fimbrial-like protein SfmF Escherichia coli (strain K12)
P11312 6.07e-07 50 25 3 163 3 F17a-A F17 fimbrial protein Escherichia coli
P04127 4.77e-06 48 28 7 169 1 papA Pap fimbrial major pilin protein Escherichia coli
P45993 4.85e-06 48 30 3 116 3 hifD Minor fimbrial subunit HifD Haemophilus influenzae
P45988 1.73e-05 47 25 6 202 3 hifA Major fimbrial subunit Haemophilus influenzae
P21413 4.28e-05 45 29 3 134 3 fasA Fimbrial protein 987P Escherichia coli
P08189 4.35e-05 45 28 5 152 1 fimF Protein FimF Escherichia coli (strain K12)
P13429 6.37e-05 45 25 5 189 1 sfaG S-fimbrial protein subunit SfaG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P37909 0.000157 43 31 3 104 1 ybgD Uncharacterized fimbrial-like protein YbgD Escherichia coli (strain K12)
Q8X5L0 0.000178 43 30 7 160 2 lpfE Probable fimbrial subunit LpfE Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17120
Feature type CDS
Gene fimA
Product type 1 fimbrial major subunit FimA
Location 3766390 - 3766956 (strand: 1)
Length 567 (nucleotides) / 188 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_197
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00419 Fimbrial protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3539 Cell motility (N) N Pilin (type 1 fimbrial protein)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07345 major type 1 subunit fimbrin (pilin) Shigellosis
Pertussis
-

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG012278 Type-1 fimbrial protein, A chain precursor VF0221 Adherence

Protein Sequence

MKLNYLKLFVISALSVGSVFAVSAEDPVGNGPVTVNGGEIFFKGELVNAACAVDSSSDGQIVKLGQVRTAKLAKAGDFSENTNFTIQLNDCDSKVASTAKVAFTGVSAAGQDDVLAVSSSSAGGAKNVGIQILDSKSAPMSFDGAGFGNATKLHDGKNIIPFQARYYALGATEPGIANANATFAVQYE

Flanking regions ( +/- flanking 50bp)

AAATCGTAATTAAATGTGTTTATTATTTTCTAGGAATTAAGGTAATTTATATGAAACTTAATTATTTGAAACTTTTTGTGATCTCTGCATTATCTGTAGGTTCTGTTTTTGCTGTTTCAGCTGAAGATCCTGTAGGAAATGGACCTGTAACCGTGAATGGTGGCGAAATATTTTTTAAAGGTGAATTAGTAAATGCAGCATGTGCTGTTGACTCTTCATCTGATGGCCAAATAGTTAAATTAGGTCAAGTGAGAACTGCAAAATTAGCGAAAGCTGGTGATTTTAGCGAAAATACTAATTTTACTATCCAATTAAATGATTGTGACTCTAAAGTAGCTAGTACTGCAAAAGTTGCTTTTACAGGGGTTTCTGCTGCAGGACAAGATGACGTATTAGCAGTATCTTCTTCTTCTGCTGGTGGTGCTAAAAATGTCGGTATTCAAATTTTAGATAGTAAGAGTGCACCAATGTCTTTTGACGGCGCTGGATTCGGTAATGCAACTAAATTACATGATGGAAAAAATATTATTCCATTCCAAGCAAGATATTATGCTTTAGGTGCAACTGAACCTGGTATCGCAAACGCGAACGCAACCTTTGCTGTCCAATACGAATAATATATAGCCTTATACTATTTTTTAGTATAAGGCTTTTTTACTTTTTTGTG