Homologs in group_1913

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14250 FBDBKF_14250 64.4 Morganella morganii S1 folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
EHELCC_08030 EHELCC_08030 64.4 Morganella morganii S2 folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
NLDBIP_08355 NLDBIP_08355 64.4 Morganella morganii S4 folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
LHKJJB_05910 LHKJJB_05910 64.4 Morganella morganii S3 folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
HKOGLL_05005 HKOGLL_05005 64.4 Morganella morganii S5 folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
F4V73_RS02660 F4V73_RS02660 64.1 Morganella psychrotolerans folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase

Distribution of the homologs in the orthogroup group_1913

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1913

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P08192 2.31e-178 507 61 3 429 1 folC Dihydrofolate synthase/folylpolyglutamate synthase Escherichia coli (strain K12)
P43775 7.08e-131 387 46 5 439 3 folC Dihydrofolate synthase/folylpolyglutamate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8K9X3 3.24e-109 331 40 6 418 3 folC Dihydrofolate synthase/folylpolyglutamate synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57265 2.04e-106 323 42 5 412 3 folC Dihydrofolate synthase/folylpolyglutamate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AT2 1.25e-99 306 39 5 419 3 folC Dihydrofolate synthase/folylpolyglutamate synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9HS44 1.2e-49 183 34 14 409 3 folP Probable bifunctional folylpolyglutamate synthase/dihydropteroate synthase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P15925 3.73e-41 154 28 12 398 1 fpgS Folylpolyglutamate synthase Lacticaseibacillus casei
I6Y0R5 2.1e-37 145 30 8 402 1 folC Dihydrofolate synthase/folylpolyglutamate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
D4GW05 2.28e-37 148 30 12 428 3 folCP Probable bifunctional folylpolyglutamate synthase/dihydropteroate synthase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q05865 8.59e-37 142 26 12 412 3 folC Dihydrofolate synthase/folylpolyglutamate synthase Bacillus subtilis (strain 168)
A6H751 5.35e-36 142 30 12 353 2 FPGS Folylpolyglutamate synthase, mitochondrial Bos taurus
Q05932 3.89e-35 140 29 14 377 1 FPGS Folylpolyglutamate synthase, mitochondrial Homo sapiens
Q8W035 1.38e-34 137 34 11 286 1 FPGS3 Folylpolyglutamate synthase Arabidopsis thaliana
Q924L9 1.55e-34 138 29 13 375 2 FPGS Folylpolyglutamate synthase, mitochondrial Cricetulus griseus
P48760 6.3e-34 137 30 16 375 1 Fpgs Folylpolyglutamate synthase, mitochondrial Mus musculus
Q09509 2.59e-32 131 28 18 471 3 F25B5.6 Putative folylpolyglutamate synthase Caenorhabditis elegans
Q9UTD0 6.46e-32 129 27 11 424 3 fol3 Probable dihydrofolate synthetase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q12676 2.92e-30 124 28 12 365 1 FOL3 Dihydrofolate synthetase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
F4JYE9 6.57e-29 122 27 16 458 1 DHFS Dihydrofolate synthetase Arabidopsis thaliana
F4J2K2 2.23e-28 121 30 8 281 1 FPGS2 Folylpolyglutamate synthase Arabidopsis thaliana
F4K2A1 3.71e-28 120 30 10 301 1 FPGS1 Folylpolyglutamate synthase Arabidopsis thaliana
Q54CY5 2.67e-26 115 36 3 168 3 folC Putative folylpolyglutamate synthase Dictyostelium discoideum
Q9Y893 4.23e-25 110 28 10 304 3 MET7 Folylpolyglutamate synthase Candida albicans
O74742 4e-22 102 37 5 168 2 met7 Probable folylpolyglutamate synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O13492 4.87e-19 92 31 9 216 1 met-6 Folylpolyglutamate synthase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
E7QKX4 1.41e-18 91 30 7 209 3 MET7 Folylpolyglutamate synthase Saccharomyces cerevisiae (strain Zymaflore VL3)
Q08645 1.41e-18 91 30 7 209 1 MET7 Folylpolyglutamate synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
E7KUJ4 1.41e-18 91 30 7 209 3 MET7 Folylpolyglutamate synthase Saccharomyces cerevisiae (strain Lalvin QA23)
E7Q9C7 1.41e-18 91 30 7 209 3 MET7 Folylpolyglutamate synthase Saccharomyces cerevisiae (strain FostersB)
E7KIA3 1.41e-18 91 30 7 209 3 MET7 Folylpolyglutamate synthase Saccharomyces cerevisiae (strain AWRI796)
C8ZGZ3 1.41e-18 91 30 7 209 3 MET7 Folylpolyglutamate synthase Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
A6ZP80 1.41e-18 91 30 7 209 3 MET7 Folylpolyglutamate synthase Saccharomyces cerevisiae (strain YJM789)
B3LJR0 1.41e-18 91 30 7 209 3 MET7 Folylpolyglutamate synthase Saccharomyces cerevisiae (strain RM11-1a)
B5VSC3 1.54e-18 91 30 7 209 3 MET7 Folylpolyglutamate synthase Saccharomyces cerevisiae (strain AWRI1631)
E7NMM0 1.58e-18 91 30 7 209 3 MET7 Folylpolyglutamate synthase Saccharomyces cerevisiae (strain FostersO)
Q81WC7 1.87e-12 72 22 16 389 3 murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase Bacillus anthracis
Q819Q0 7.52e-11 67 22 17 395 1 murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8R9G2 8.98e-09 60 23 18 404 3 murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q894B7 9.69e-09 60 23 18 413 3 murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase Clostridium tetani (strain Massachusetts / E88)
A5I1T6 1.7e-08 60 23 18 401 3 murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FTY1 1.7e-08 60 23 18 401 3 murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase Clostridium botulinum (strain ATCC 19397 / Type A)
Q65JY4 1.87e-08 60 25 21 408 3 murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q047T2 2.03e-07 56 28 6 149 3 murE UDP-N-acetylmuramyl-tripeptide synthetase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G8B5 2.03e-07 56 28 6 149 3 murE UDP-N-acetylmuramyl-tripeptide synthetase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q9K9S4 8.52e-07 54 22 18 395 3 murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8CZE6 2.94e-06 53 23 20 410 3 murE1 UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5NPA7 0.000109 48 27 11 267 3 murD UDP-N-acetylmuramoylalanine--D-glutamate ligase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A4IM04 0.00033 46 23 12 289 3 murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase Geobacillus thermodenitrificans (strain NG80-2)
O26027 0.000368 46 20 11 319 3 murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase Helicobacter pylori (strain ATCC 700392 / 26695)
A8MH31 0.000663 45 22 22 404 3 murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase Alkaliphilus oremlandii (strain OhILAs)
Q2KVF5 0.000677 45 26 6 165 3 murD UDP-N-acetylmuramoylalanine--D-glutamate ligase Bordetella avium (strain 197N)
Q47QX1 0.000887 45 47 3 63 3 murD UDP-N-acetylmuramoylalanine--D-glutamate ligase Thermobifida fusca (strain YX)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08760
Feature type CDS
Gene folC
Product bifunctional tetrahydrofolate synthase/dihydrofolate synthase
Location 1915680 - 1916978 (strand: -1)
Length 1299 (nucleotides) / 432 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1913
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02875 Mur ligase, glutamate ligase domain
PF08245 Mur ligase middle domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0285 Coenzyme transport and metabolism (H) H Folylpolyglutamate synthase/Dihydropteroate synthase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11754 dihydrofolate synthase / folylpolyglutamate synthase [EC:6.3.2.12 6.3.2.17] Folate biosynthesis
Metabolic pathways
Biosynthesis of cofactors		 Tetrahydrofolate biosynthesis, GTP => THF
Tetrahydrofolate biosynthesis, mediated by PTPS, GTP => THF

Protein Sequence

MSNIITAPQATSPLSVWLSYLEHLHSSAIDMGLERVGKVGQLLNVLRPAPKVITVSGTNGKGTTCHMLESILMASGLKVGVYSSPHLVRYTERVRIQGKELSPAEFCQVFAEIEQTRGDISLTFFEYGTLAALKLFQQAQLDVVILEVGLGGRLDATNIVDADIAAITSIALDHTDWLGADREHIGHEKAGIFRKNHYAVVGEPDMPLSIAQVAQQKQAKLFRRGVDWSFSIDGDHWHWRSADKQFEKLPIPNIPLANAGTAMAVIRCLLKSDDKVSQGITHQSIVEGMSKAQLPGRFQIISQHPLVIFDVAHNPHAAGYLAEKLAQLPRYSDTKVRIVVGMLGDKDIAGTLACLSPQADQWYVAPLNEFRGASAQVLAQHLDYPAVFDSVEQAWQQAISEAQKNDIVVVCGSFHTVAHVMELLEKESASGK

Flanking regions ( +/- flanking 50bp)

ATCTTCTGACAATGAGCCAGAAATTAACATCGAAACGAATAAAAAAGAAGATGTCTAATATCATAACTGCTCCTCAAGCCACATCGCCTTTGTCGGTGTGGCTTTCTTATCTTGAACACTTACACTCAAGTGCTATTGATATGGGACTTGAGCGCGTGGGCAAGGTAGGTCAATTACTGAATGTATTACGTCCTGCCCCTAAAGTTATCACTGTATCGGGTACTAATGGTAAAGGAACCACTTGCCATATGCTCGAGTCAATTTTGATGGCTTCAGGATTGAAAGTGGGGGTTTATAGTTCACCTCATCTTGTCCGTTATACCGAGCGTGTTCGCATTCAAGGTAAAGAGCTTTCACCAGCTGAGTTTTGTCAAGTATTTGCTGAAATAGAGCAAACCAGAGGCGATATTTCGCTGACTTTTTTTGAATACGGCACACTCGCCGCATTGAAACTATTTCAACAAGCTCAGCTTGATGTGGTTATTCTTGAAGTTGGGTTAGGGGGGCGTTTAGACGCGACCAATATTGTTGATGCCGATATTGCAGCTATCACCAGTATTGCCCTTGATCATACCGATTGGTTAGGGGCTGATAGAGAGCATATTGGTCATGAAAAAGCCGGTATCTTCCGTAAAAATCACTATGCTGTTGTAGGCGAGCCAGATATGCCACTGTCTATTGCACAAGTCGCGCAACAGAAACAGGCTAAATTATTTCGTCGTGGTGTTGATTGGTCATTTTCTATTGATGGTGATCACTGGCATTGGCGTAGTGCAGATAAGCAGTTTGAAAAACTTCCCATCCCTAATATTCCCTTAGCCAACGCAGGTACGGCAATGGCAGTAATACGCTGCTTATTGAAAAGCGACGATAAAGTGAGCCAAGGGATCACCCATCAAAGTATTGTTGAGGGAATGAGTAAAGCTCAGTTGCCGGGACGTTTTCAGATAATTTCGCAGCATCCATTAGTTATTTTTGATGTTGCTCATAATCCGCATGCTGCTGGATATTTAGCCGAAAAACTGGCGCAATTACCGCGTTATTCTGATACCAAAGTGCGCATTGTTGTTGGTATGCTGGGTGATAAAGATATTGCGGGTACATTAGCGTGTTTATCCCCTCAAGCCGATCAGTGGTATGTTGCACCATTGAATGAGTTTCGTGGCGCATCAGCTCAGGTATTAGCTCAGCACCTCGACTATCCGGCAGTATTTGATAGTGTCGAGCAAGCATGGCAACAAGCAATATCTGAGGCGCAAAAAAATGATATTGTGGTTGTATGTGGATCATTCCATACCGTTGCTCATGTAATGGAACTATTGGAAAAGGAGAGTGCGAGTGGCAAGTAAATTTCAAAATCGCTTAGTCGGAGCCGTTGTTCTTGTGGCGGTAGGGGTTA