Homologs in group_34

Help

14 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13325 FBDBKF_13325 28.3 Morganella morganii S1 araC AraC-type DNA-binding domain and AraC-containing proteins
EHELCC_08770 EHELCC_08770 28.3 Morganella morganii S2 araC AraC-type DNA-binding domain and AraC-containing proteins
NLDBIP_09095 NLDBIP_09095 28.3 Morganella morganii S4 araC AraC-type DNA-binding domain and AraC-containing proteins
LHKJJB_05170 LHKJJB_05170 28.3 Morganella morganii S3 araC AraC-type DNA-binding domain and AraC-containing proteins
HKOGLL_05745 HKOGLL_05745 28.3 Morganella morganii S5 araC AraC-type DNA-binding domain and AraC-containing proteins
F4V73_RS01705 F4V73_RS01705 21.9 Morganella psychrotolerans - AraC family transcriptional regulator
F4V73_RS03430 F4V73_RS03430 28.3 Morganella psychrotolerans - helix-turn-helix domain-containing protein
F4V73_RS04165 F4V73_RS04165 21.5 Morganella psychrotolerans - AraC family transcriptional regulator
F4V73_RS04870 F4V73_RS04870 20.8 Morganella psychrotolerans - AraC family transcriptional regulator
F4V73_RS12525 F4V73_RS12525 17.5 Morganella psychrotolerans - AraC family transcriptional regulator
F4V73_RS17025 F4V73_RS17025 25.4 Morganella psychrotolerans - helix-turn-helix domain-containing protein
PMI_RS05115 PMI_RS05115 29.2 Proteus mirabilis HI4320 - helix-turn-helix domain-containing protein
PMI_RS14600 PMI_RS14600 26.5 Proteus mirabilis HI4320 chbR transcriptional regulator ChbR
PMI_RS18315 PMI_RS18315 24.7 Proteus mirabilis HI4320 - AraC family transcriptional regulator

Distribution of the homologs in the orthogroup group_34

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_34

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P45008 1.15e-38 141 28 4 303 4 HI_1052 Uncharacterized HTH-type transcriptional regulator HI_1052 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9WW32 3.07e-33 127 28 9 308 1 mtrA HTH-type transcriptional regulator MtrA Neisseria gonorrhoeae
P77379 2.96e-29 115 27 4 308 1 rclR RCS-specific HTH-type transcriptional activator RclR Escherichia coli (strain K12)
P35319 1.12e-27 112 29 9 318 4 None Putative AraC-like transcription regulator Streptomyces lividans
Q03320 8.88e-27 109 28 8 312 4 None Putative AraC-like transcription regulator Streptomyces antibioticus
O31249 3.41e-21 94 32 1 181 4 alkR HTH-type transcriptional regulator AlkR Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
T2KMF4 2.43e-10 65 40 0 77 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q46855 2.6e-09 60 33 0 96 4 yqhC Uncharacterized HTH-type transcriptional regulator YqhC Escherichia coli (strain K12)
P32326 4.64e-09 60 27 2 161 4 ureR Urease operon transcriptional activator Escherichia coli
Q02458 6.13e-09 59 27 1 131 1 ureR Urease operon transcriptional activator Proteus mirabilis (strain HI4320)
Q52620 2.64e-08 54 32 0 86 4 pqrA Probable transcription factor PqrA Proteus vulgaris
P77634 4.95e-08 56 28 1 112 4 ybcM Uncharacterized HTH-type transcriptional regulator YbcM Escherichia coli (strain K12)
P28808 2.02e-07 54 29 2 124 4 lcrF Thermoregulatory protein LcrF Yersinia pestis
Q1R414 3.26e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain UTI89 / UPEC)
B7NFK3 3.26e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A1AI82 3.26e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O1:K1 / APEC
B7NUA1 3.26e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MI37 3.26e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O45:K1 (strain S88 / ExPEC)
Q3YV71 3.29e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Shigella sonnei (strain Ss046)
Q31U84 3.29e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 4 (strain Sb227)
P09377 3.29e-07 54 35 0 76 1 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12)
B1IVH3 3.29e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A709 3.29e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O9:H4 (strain HS)
B1XB72 3.29e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / DH10B)
C5A073 3.29e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / MC4100 / BW2952)
B7M6V7 3.29e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O8 (strain IAI1)
B7L9G1 3.29e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain 55989 / EAEC)
Q83PE0 3.32e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri
Q0SZ95 3.32e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri serotype 5b (strain 8401)
Q0TAF8 3.38e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N2P7 3.38e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O81 (strain ED1a)
B7UNM6 3.38e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LMU6 3.58e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SMS-3-5 / SECEC)
Q8CXW5 3.64e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32A70 3.68e-07 54 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Shigella dysenteriae serotype 1 (strain Sd197)
A7ZUB7 3.82e-07 53 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O139:H28 (strain E24377A / ETEC)
A1JU91 4.48e-07 53 29 2 124 3 virF Virulence regulon transcriptional activator VirF Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q00753 6.05e-07 53 28 0 83 4 msmR Msm operon regulatory protein Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B6I4P8 6.16e-07 53 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SE11)
B2TVP7 6.88e-07 53 35 0 76 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P96660 7.87e-07 53 26 0 108 4 ydeC Uncharacterized HTH-type transcriptional regulator YdeC Bacillus subtilis (strain 168)
P0C2V5 1.09e-06 52 29 2 123 2 virF Virulence regulon transcriptional activator VirF Yersinia enterocolitica
O33813 1.46e-06 52 25 1 133 4 lacR Lactose operon transcription activator Staphylococcus xylosus
B5YZ43 1.73e-06 52 34 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X897 1.73e-06 52 34 0 76 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7
A4WG91 1.98e-06 52 32 0 81 3 rhaS HTH-type transcriptional activator RhaS Enterobacter sp. (strain 638)
P43465 2.74e-06 51 32 0 85 4 rafR Raffinose operon transcriptional regulatory protein RafR Pediococcus pentosaceus
Q5HKE0 3.03e-06 51 25 4 157 3 SERP2406 Uncharacterized response regulatory protein SERP2406 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q65Q30 3.19e-06 51 24 0 101 3 rhaR HTH-type transcriptional activator RhaR Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A8AL27 3.47e-06 51 34 0 76 3 rhaS HTH-type transcriptional activator RhaS Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q32A71 3.99e-06 51 23 0 136 3 rhaR HTH-type transcriptional activator RhaR Shigella dysenteriae serotype 1 (strain Sd197)
P09378 5.16e-06 50 23 0 136 1 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain K12)
A8A710 5.16e-06 50 23 0 136 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O9:H4 (strain HS)
C5A074 5.16e-06 50 23 0 136 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain K12 / MC4100 / BW2952)
Q1R413 5.4e-06 50 23 0 136 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain UTI89 / UPEC)
A1AI83 5.4e-06 50 23 0 136 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O1:K1 / APEC
Q8X7B3 5.4e-06 50 23 0 136 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O157:H7
Q83PD9 5.6e-06 50 23 0 136 3 rhaR HTH-type transcriptional activator RhaR Shigella flexneri
Q0SZ96 5.6e-06 50 23 0 136 3 rhaR HTH-type transcriptional activator RhaR Shigella flexneri serotype 5b (strain 8401)
Q31U83 5.86e-06 50 23 0 136 3 rhaR HTH-type transcriptional activator RhaR Shigella boydii serotype 4 (strain Sb227)
Q8FBD7 5.86e-06 50 23 0 136 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAF7 5.86e-06 50 23 0 136 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7ZUB8 5.86e-06 50 23 0 136 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O139:H28 (strain E24377A / ETEC)
B5BJG8 5.96e-06 50 29 0 86 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain AKU_12601)
Q5PKG2 5.96e-06 50 29 0 86 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5F0M9 6.3e-06 50 29 0 86 3 rhaS HTH-type transcriptional activator RhaS Salmonella agona (strain SL483)
B4TBY3 6.35e-06 50 32 0 76 3 rhaS HTH-type transcriptional activator RhaS Salmonella heidelberg (strain SL476)
P0A2S9 6.41e-06 50 29 0 86 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2T0 6.41e-06 50 29 0 86 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhi
C0Q3L4 6.41e-06 50 29 0 86 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi C (strain RKS4594)
A9MZC8 6.41e-06 50 29 0 86 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZZ3 6.41e-06 50 29 0 86 3 rhaS HTH-type transcriptional activator RhaS Salmonella newport (strain SL254)
B5RFC3 6.41e-06 50 29 0 86 3 rhaS HTH-type transcriptional activator RhaS Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QWY4 6.41e-06 50 29 0 86 3 rhaS HTH-type transcriptional activator RhaS Salmonella enteritidis PT4 (strain P125109)
Q57HG8 6.53e-06 50 32 0 76 3 rhaS HTH-type transcriptional activator RhaS Salmonella choleraesuis (strain SC-B67)
P0ACI3 6.68e-06 50 23 0 109 1 xylR Xylose operon regulatory protein Escherichia coli (strain K12)
P0ACI4 6.68e-06 50 23 0 109 3 xylR Xylose operon regulatory protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACI5 6.68e-06 50 23 0 109 3 xylR Xylose operon regulatory protein Escherichia coli O157:H7
B5FPP5 6.71e-06 50 29 0 86 3 rhaS HTH-type transcriptional activator RhaS Salmonella dublin (strain CT_02021853)
B4TPQ9 6.77e-06 50 32 0 76 3 rhaS HTH-type transcriptional activator RhaS Salmonella schwarzengrund (strain CVM19633)
A9MI64 6.84e-06 50 32 0 76 3 rhaS HTH-type transcriptional activator RhaS Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P0CL08 8.03e-06 50 29 1 97 4 hilD Transcriptional regulator HilD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WAC0 8.03e-06 50 29 1 97 4 hilD Transcriptional regulator HilD Salmonella typhimurium (strain SL1344)
P40408 9.06e-06 50 31 0 87 1 btr HTH-type transcriptional activator Btr Bacillus subtilis (strain 168)
B4TPR0 9.87e-06 49 20 3 243 3 rhaR HTH-type transcriptional activator RhaR Salmonella schwarzengrund (strain CVM19633)
P25393 1.08e-05 49 29 1 95 1 cfaD CFA/I fimbrial subunit D Escherichia coli
B1Q2A8 1.18e-05 50 28 2 105 1 nphR Transcriptional activator NphR Rhodococcus sp.
B5FPP6 1.37e-05 49 20 3 243 3 rhaR HTH-type transcriptional activator RhaR Salmonella dublin (strain CT_02021853)
A4WG90 2.14e-05 48 23 3 158 3 rhaR HTH-type transcriptional activator RhaR Enterobacter sp. (strain 638)
A9MI63 2.67e-05 48 20 3 243 3 rhaR HTH-type transcriptional activator RhaR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F0N0 3.01e-05 48 20 3 243 3 rhaR HTH-type transcriptional activator RhaR Salmonella agona (strain SL483)
A6TGA9 3.57e-05 48 30 0 79 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P40865 3.71e-05 48 22 0 137 3 rhaR HTH-type transcriptional activator RhaR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BJG9 3.71e-05 48 22 0 137 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi A (strain AKU_12601)
A9MZC9 3.71e-05 48 22 0 137 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKG1 3.71e-05 48 22 0 137 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SZZ4 3.71e-05 48 22 0 137 3 rhaR HTH-type transcriptional activator RhaR Salmonella newport (strain SL254)
B5QWY5 3.71e-05 48 22 0 137 3 rhaR HTH-type transcriptional activator RhaR Salmonella enteritidis PT4 (strain P125109)
Q8CQE3 4.12e-05 47 28 1 99 3 SE_0165 Uncharacterized response regulatory protein SE_0165 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q56143 4.45e-05 45 27 0 83 3 soxS Regulatory protein SoxS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57HG7 4.61e-05 47 22 0 137 3 rhaR HTH-type transcriptional activator RhaR Salmonella choleraesuis (strain SC-B67)
Q8Z2V5 4.87e-05 47 22 0 137 3 rhaR HTH-type transcriptional activator RhaR Salmonella typhi
B4TBY4 4.87e-05 47 22 0 137 3 rhaR HTH-type transcriptional activator RhaR Salmonella heidelberg (strain SL476)
O87389 5.16e-05 47 29 0 103 4 glxA HTH-type transcriptional regulator GlxA Rhizobium meliloti (strain 1021)
P16114 5.44e-05 47 29 1 95 1 rns Regulatory protein Rns Escherichia coli
B5XZ49 5.54e-05 47 29 0 86 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae (strain 342)
P0A9E2 0.000159 43 26 0 83 1 soxS Regulatory protein SoxS Escherichia coli (strain K12)
P0A9E3 0.000159 43 26 0 83 3 soxS Regulatory protein SoxS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9E4 0.000159 43 26 0 83 3 soxS Regulatory protein SoxS Escherichia coli O157:H7
P43464 0.000239 45 30 1 95 4 aggR Transcriptional activator AggR Escherichia coli
O31449 0.000289 45 24 4 183 4 ybfI Uncharacterized HTH-type transcriptional regulator YbfI Bacillus subtilis (strain 168)
P05052 0.000295 45 25 1 85 1 appY HTH-type transcriptional regulator AppY Escherichia coli (strain K12)
P26993 0.000537 44 25 1 96 1 exsA HTH-type transcriptional regulator ExsA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45043 0.000592 44 30 1 84 3 xylR Xylose operon regulatory protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P31449 0.000774 44 31 0 82 4 yidL Uncharacterized HTH-type transcriptional regulator YidL Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS04495
Feature type CDS
Gene -
Product helix-turn-helix domain-containing protein
Location 1000488 - 1001414 (strand: 1)
Length 927 (nucleotides) / 308 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_34
Orthogroup size 15
N. genomes 7

Actions

Genomic region

Domains

PF12833 Helix-turn-helix domain
PF12852 Cupin

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2207 Transcription (K) K AraC-type DNA-binding domain and AraC-containing proteins

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K18991 AraC family transcriptional regulator, activator of mtrCDE - -

Protein Sequence

MDTLSQLLYLSQGQLQLDVFCQMKGHFSLPHVSSVEHETIFHLVLSGQCYVQIEKSAPIVLSEGTFLMLNRRQSHTLWSGERDIEPPPFLHKNNGFLPVKYTKSEDQTQHVDLLCGRMAYAKGSGLLLLNGFPDMVVANLVEMPGLTVLNLFSQLLREEAINANQGAAAILNGLAQTLFAFALRVYGQKPDINSSWLALLAEPRLSRVFNSMLNEPQKGWTLDSLANVASMSRATFVRQFKATANTTPGEVLQSIRMLKALSLLQQNKYTLSDIAERVGYQSEAAFSKAFKSVFNCRPGQWKKQQSKV

Flanking regions ( +/- flanking 50bp)

AAAAAGATGATGACATCATCAAACGAATCAATTTTTAGTGAATTAGTCTCATGGATACGTTGAGCCAACTCTTATACCTTTCTCAAGGGCAATTGCAATTAGATGTGTTTTGTCAAATGAAAGGACATTTTTCCTTACCGCATGTTTCATCTGTTGAACATGAAACTATTTTTCACTTAGTTCTATCAGGGCAGTGTTATGTTCAGATTGAAAAATCAGCCCCTATAGTTTTATCCGAAGGCACTTTTTTAATGTTAAACAGAAGGCAATCACATACCCTTTGGAGTGGAGAACGAGATATAGAACCTCCCCCTTTTTTGCATAAAAATAATGGCTTCTTACCTGTTAAGTACACAAAATCTGAAGATCAGACTCAACATGTTGATTTGCTTTGCGGGCGAATGGCTTATGCTAAAGGAAGCGGGTTACTATTATTAAATGGGTTTCCTGATATGGTAGTGGCAAATTTGGTGGAAATGCCAGGGCTAACAGTATTGAATTTATTTAGCCAGTTGCTTCGAGAGGAAGCCATTAATGCAAATCAAGGGGCGGCTGCGATACTAAATGGGCTTGCTCAGACTTTATTCGCTTTTGCATTACGTGTTTATGGGCAAAAACCAGATATAAACTCAAGTTGGTTAGCATTATTAGCTGAACCTCGGTTAAGTCGTGTATTTAATTCTATGTTAAATGAACCACAAAAAGGGTGGACACTTGATTCTTTAGCTAATGTCGCTTCAATGTCACGAGCGACTTTTGTGCGTCAATTTAAAGCAACGGCGAATACGACACCTGGCGAAGTTCTACAATCCATTCGTATGCTAAAAGCACTTTCATTATTACAACAAAATAAATATACATTATCAGATATCGCAGAAAGAGTCGGATACCAATCTGAAGCTGCATTTAGTAAAGCATTTAAAAGTGTATTTAATTGCAGACCAGGGCAGTGGAAGAAGCAACAGAGTAAAGTGTAAAAATTTGCACAGAGTAAAGAAGAATTATTACTTTCTTTTGAAGTCACTTC