Homologs in group_3651

Help

3 homologs were identified in 2 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
F4V73_RS01705 F4V73_RS01705 35.3 Morganella psychrotolerans - AraC family transcriptional regulator
PMI_RS04495 PMI_RS04495 22.2 Proteus mirabilis HI4320 - helix-turn-helix domain-containing protein
PMI_RS14600 PMI_RS14600 32.4 Proteus mirabilis HI4320 chbR transcriptional regulator ChbR

Distribution of the homologs in the orthogroup group_3651

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3651

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q56143 1.05e-22 88 42 0 100 3 soxS Regulatory protein SoxS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A9E2 7.6e-22 85 41 0 100 1 soxS Regulatory protein SoxS Escherichia coli (strain K12)
P0A9E3 7.6e-22 85 41 0 100 3 soxS Regulatory protein SoxS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9E4 7.6e-22 85 41 0 100 3 soxS Regulatory protein SoxS Escherichia coli O157:H7
P0ACH7 1.91e-19 80 37 0 99 3 marA Multiple antibiotic resistance protein MarA Shigella flexneri
P0ACH5 1.91e-19 80 37 0 99 1 marA Multiple antibiotic resistance protein MarA Escherichia coli (strain K12)
P0ACH6 1.91e-19 80 37 0 99 3 marA Multiple antibiotic resistance protein MarA Escherichia coli O157:H7
P0A2S4 2.67e-19 80 37 0 99 2 marA Multiple antibiotic resistance protein MarA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2S5 2.67e-19 80 37 0 99 3 marA Multiple antibiotic resistance protein MarA Salmonella typhi
P0A2S6 2.67e-19 80 37 0 99 3 marA Multiple antibiotic resistance protein MarA Salmonella enteritidis
Q52620 1.88e-18 77 32 1 102 4 pqrA Probable transcription factor PqrA Proteus vulgaris
P28816 7.22e-17 73 33 0 100 1 tetD Transposon Tn10 TetD protein Escherichia coli
P55922 1.17e-16 72 31 0 103 4 ramA Transcriptional activator RamA Enterobacter cloacae
Q48413 2.43e-16 72 31 0 103 1 ramA Transcriptional activator RamA Klebsiella pneumoniae
A0A0H3GPK2 2.43e-16 72 31 0 103 1 ramA Transcriptional regulator RamA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
H9L484 5.25e-16 71 30 0 99 1 ramA Transcriptional regulator RamA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P43463 2.05e-15 70 31 0 108 4 aarP HTH-type transcriptional activator AarP Providencia stuartii
P77601 1.2e-13 67 32 1 107 5 ykgA Putative HTH-type transcriptional regulator YkgA Escherichia coli (strain K12)
Q05587 6.91e-13 66 32 0 95 1 pocR Regulatory protein PocR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B7LVD8 3.15e-12 64 26 1 115 3 rhaS HTH-type transcriptional activator RhaS Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8ZJU7 3.87e-12 64 27 0 104 2 rob Transcriptional regulator Rob Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0ACI2 6.6e-12 63 28 0 102 3 rob Right origin-binding protein Shigella flexneri
P0ACI0 6.6e-12 63 28 0 102 1 rob Right origin-binding protein Escherichia coli (strain K12)
P0ACI1 6.6e-12 63 28 0 102 3 rob Right origin-binding protein Escherichia coli O157:H7
O33813 1.75e-11 62 29 0 106 4 lacR Lactose operon transcription activator Staphylococcus xylosus
Q9HTI4 1.77e-11 62 31 0 99 1 gbdR HTH-type transcriptional regulator GbdR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZIC3 1.77e-11 62 31 0 99 1 gbdR HTH-type transcriptional regulator GbdR Pseudomonas aeruginosa (strain UCBPP-PA14)
A8AL27 4.16e-11 61 25 0 106 3 rhaS HTH-type transcriptional activator RhaS Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P40408 4.98e-11 61 32 0 100 1 btr HTH-type transcriptional activator Btr Bacillus subtilis (strain 168)
B5YZ43 7.38e-11 60 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X897 7.38e-11 60 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7
A4WG91 1.01e-10 60 26 1 108 3 rhaS HTH-type transcriptional activator RhaS Enterobacter sp. (strain 638)
B5FPP5 1.54e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella dublin (strain CT_02021853)
P0A2S9 1.77e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2T0 1.77e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhi
C0Q3L4 1.77e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi C (strain RKS4594)
A9MZC8 1.77e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZZ3 1.77e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella newport (strain SL254)
B5RFC3 1.77e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QWY4 1.77e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella enteritidis PT4 (strain P125109)
Q57HG8 1.84e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella choleraesuis (strain SC-B67)
B5F0M9 1.84e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella agona (strain SL483)
B5BJG8 1.88e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain AKU_12601)
Q5PKG2 1.88e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TBY3 1.9e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella heidelberg (strain SL476)
A9MI64 2.1e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TPQ9 2.34e-10 59 24 0 106 3 rhaS HTH-type transcriptional activator RhaS Salmonella schwarzengrund (strain CVM19633)
Q83PE0 2.39e-10 59 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri
Q0SZ95 2.39e-10 59 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri serotype 5b (strain 8401)
Q1R414 2.61e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain UTI89 / UPEC)
B7NFK3 2.61e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A1AI82 2.61e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O1:K1 / APEC
B7NUA1 2.61e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MI37 2.61e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O45:K1 (strain S88 / ExPEC)
Q0TAF8 2.66e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UNM6 2.66e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LMU6 2.69e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SMS-3-5 / SECEC)
Q3YV71 2.72e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Shigella sonnei (strain Ss046)
Q31U84 2.77e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 4 (strain Sb227)
P09377 2.77e-10 58 25 0 96 1 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12)
B1IVH3 2.77e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A709 2.77e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O9:H4 (strain HS)
B1XB72 2.77e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / DH10B)
C5A073 2.77e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / MC4100 / BW2952)
B7M6V7 2.77e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O8 (strain IAI1)
B7L9G1 2.77e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain 55989 / EAEC)
Q8CXW5 2.86e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7N2P7 2.86e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O81 (strain ED1a)
Q32A70 3.19e-10 58 25 0 96 3 rhaS HTH-type transcriptional activator RhaS Shigella dysenteriae serotype 1 (strain Sd197)
P19219 4.96e-10 57 31 0 99 1 adaA Bifunctional transcriptional activator/DNA repair enzyme AdaA Bacillus subtilis (strain 168)
P45008 6.22e-10 58 30 0 88 4 HI_1052 Uncharacterized HTH-type transcriptional regulator HI_1052 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B6I4P8 1.78e-09 56 23 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SE11)
B2TVP7 1.96e-09 56 23 0 96 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A7ZUB7 3.29e-09 56 23 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O139:H28 (strain E24377A / ETEC)
B5XZ49 4.3e-09 55 22 0 106 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae (strain 342)
P26950 7e-09 55 39 1 104 4 caf1R F1 operon positive regulatory protein Yersinia pestis
B1JNC5 7.65e-09 55 25 0 95 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TRS8 7.65e-09 55 25 0 95 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis (strain Pestoides F)
B2K1W5 7.65e-09 55 25 0 95 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FN80 7.65e-09 55 25 0 95 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66FF2 7.88e-09 55 25 0 95 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype I (strain IP32953)
A9QYR8 8.04e-09 55 25 0 95 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis bv. Antiqua (strain Angola)
A6TGA9 8.45e-09 55 22 0 106 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q1CEB5 2.04e-08 53 25 0 95 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZJ00 2.04e-08 53 25 0 95 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis
Q1C0W1 2.04e-08 53 25 0 95 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis bv. Antiqua (strain Antiqua)
O31456 6.94e-08 52 30 0 99 3 ybfP Uncharacterized HTH-type transcriptional regulator YbfP Bacillus subtilis (strain 168)
P77396 1.48e-07 51 26 1 115 4 ypdC Uncharacterized HTH-type transcriptional regulator YpdC Escherichia coli (strain K12)
C6DJR5 3.51e-07 50 25 0 99 3 rhaR HTH-type transcriptional activator RhaR Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6GKK1 4.19e-07 50 25 0 98 4 SAR0107 Uncharacterized HTH-type transcriptional regulator SAR0107 Staphylococcus aureus (strain MRSA252)
O31249 4.29e-07 50 24 0 107 4 alkR HTH-type transcriptional regulator AlkR Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6GD21 4.31e-07 50 25 0 98 4 SAS0078 Uncharacterized HTH-type transcriptional regulator SAS0078 Staphylococcus aureus (strain MSSA476)
Q8NYT6 4.31e-07 50 25 0 98 4 MW0077 Uncharacterized HTH-type transcriptional regulator MW0077 Staphylococcus aureus (strain MW2)
P96662 4.42e-07 50 22 0 107 4 ydeE Uncharacterized HTH-type transcriptional regulator YdeE Bacillus subtilis (strain 168)
Q99XB1 4.48e-07 50 25 0 98 4 SAV0101 Uncharacterized HTH-type transcriptional regulator SAV0101 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A882 4.48e-07 50 25 0 98 4 SA0097 Uncharacterized HTH-type transcriptional regulator SA0097 Staphylococcus aureus (strain N315)
P0ACI3 5.45e-07 50 29 0 104 1 xylR Xylose operon regulatory protein Escherichia coli (strain K12)
P0ACI4 5.45e-07 50 29 0 104 3 xylR Xylose operon regulatory protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACI5 5.45e-07 50 29 0 104 3 xylR Xylose operon regulatory protein Escherichia coli O157:H7
Q51872 5.86e-07 49 27 0 101 4 lumQ Probable transcriptional regulator LumQ Photobacterium leiognathi
Q6DA21 5.97e-07 49 24 0 99 3 rhaR HTH-type transcriptional activator RhaR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9WW32 7.35e-07 49 26 0 72 1 mtrA HTH-type transcriptional regulator MtrA Neisseria gonorrhoeae
Q5HJR8 8.25e-07 49 25 0 98 4 SACOL0084 Uncharacterized HTH-type transcriptional regulator SACOL0084 Staphylococcus aureus (strain COL)
G3XCU2 1.33e-06 48 24 0 101 4 argR HTH-type transcriptional regulator ArgR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A6TGB0 1.92e-06 48 28 0 92 3 rhaR HTH-type transcriptional activator RhaR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q936F1 3.2e-06 47 24 0 108 4 None Uncharacterized HTH-type transcriptional regulator Staphylococcus aureus
O34901 3.56e-06 47 28 0 94 4 yobQ Uncharacterized HTH-type transcriptional regulator YobQ Bacillus subtilis (strain 168)
Q6DA22 3.79e-06 47 26 0 107 3 rhaS HTH-type transcriptional activator RhaS Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DJR4 4.93e-06 47 26 0 101 3 rhaS HTH-type transcriptional activator RhaS Pectobacterium carotovorum subsp. carotovorum (strain PC1)
O31449 5.04e-06 47 27 1 97 4 ybfI Uncharacterized HTH-type transcriptional regulator YbfI Bacillus subtilis (strain 168)
P0ACH8 1.05e-05 46 24 0 102 1 melR Melibiose operon regulatory protein Escherichia coli (strain K12)
P0ACH9 1.05e-05 46 24 0 102 3 melR Melibiose operon regulatory protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P77402 1.06e-05 46 26 0 108 4 ydiP Uncharacterized HTH-type transcriptional regulator YdiP Escherichia coli (strain K12)
P77379 1.62e-05 45 24 0 85 1 rclR RCS-specific HTH-type transcriptional activator RclR Escherichia coli (strain K12)
P28809 2e-05 45 23 0 103 4 mmsR MmsAB operon regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P07642 2.85e-05 45 26 0 99 3 araC Arabinose operon regulatory protein Dickeya chrysanthemi
P95283 2.85e-05 45 28 0 82 2 Rv1931c HTH-type transcriptional regulator Rv1931c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q31U83 2.89e-05 45 25 1 103 3 rhaR HTH-type transcriptional activator RhaR Shigella boydii serotype 4 (strain Sb227)
Q8FBD7 2.89e-05 45 25 1 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAF7 2.89e-05 45 25 1 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7ZUB8 2.89e-05 45 25 1 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O139:H28 (strain E24377A / ETEC)
Q65Q30 2.95e-05 45 26 0 100 3 rhaR HTH-type transcriptional activator RhaR Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1R413 2.98e-05 45 25 1 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain UTI89 / UPEC)
A1AI83 2.98e-05 45 25 1 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O1:K1 / APEC
Q83PD9 3.04e-05 45 25 1 103 3 rhaR HTH-type transcriptional activator RhaR Shigella flexneri
Q0SZ96 3.04e-05 45 25 1 103 3 rhaR HTH-type transcriptional activator RhaR Shigella flexneri serotype 5b (strain 8401)
Q32A71 3.07e-05 45 25 1 103 3 rhaR HTH-type transcriptional activator RhaR Shigella dysenteriae serotype 1 (strain Sd197)
Q8X7B3 3.07e-05 45 25 1 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O157:H7
P09378 3.1e-05 44 25 1 103 1 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain K12)
A8A710 3.1e-05 44 25 1 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O9:H4 (strain HS)
C5A074 3.1e-05 44 25 1 103 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain K12 / MC4100 / BW2952)
A4WG90 4.23e-05 44 23 0 104 3 rhaR HTH-type transcriptional activator RhaR Enterobacter sp. (strain 638)
O32071 4.88e-05 44 25 0 103 4 ytdP Uncharacterized HTH-type transcriptional regulator YtdP Bacillus subtilis (strain 168)
B4TPR0 5.13e-05 44 25 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella schwarzengrund (strain CVM19633)
Q65Q31 5.27e-05 44 26 0 97 3 rhaS HTH-type transcriptional activator RhaS Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P40865 7.21e-05 43 25 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BJG9 7.21e-05 43 25 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi A (strain AKU_12601)
A9MZC9 7.21e-05 43 25 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKG1 7.21e-05 43 25 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SZZ4 7.21e-05 43 25 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella newport (strain SL254)
B5QWY5 7.21e-05 43 25 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella enteritidis PT4 (strain P125109)
A9MI63 7.21e-05 43 25 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F0N0 7.21e-05 43 25 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella agona (strain SL483)
Q46855 8.5e-05 43 21 0 96 4 yqhC Uncharacterized HTH-type transcriptional regulator YqhC Escherichia coli (strain K12)
Q57HG7 0.000105 43 24 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella choleraesuis (strain SC-B67)
Q8Z2V5 0.000108 43 24 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella typhi
B4TBY4 0.000108 43 24 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella heidelberg (strain SL476)
O31522 0.000163 43 25 1 101 2 yesS HTH-type transcriptional regulator YesS Bacillus subtilis (strain 168)
P43459 0.000265 42 29 1 101 4 perA Transcriptional activator PerA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P06134 0.000328 42 26 1 90 1 ada Bifunctional transcriptional activator/DNA repair enzyme Ada Escherichia coli (strain K12)
P40331 0.00037 42 30 0 82 4 yisR Uncharacterized HTH-type transcriptional regulator YisR Bacillus subtilis (strain 168)
Q04710 0.000386 41 25 2 112 4 xylS1 XylDLEGF operon transcriptional activator 1 Pseudomonas putida
P43465 0.000399 41 26 0 95 4 rafR Raffinose operon transcriptional regulatory protein RafR Pediococcus pentosaceus
P07859 0.000401 41 25 1 100 4 xylS XylDLEGF operon transcriptional activator Pseudomonas putida
Q05335 0.000583 41 23 1 100 4 xylS3 XylDLEGF operon transcriptional activator 3 Pseudomonas putida
Q05092 0.000608 40 24 1 98 4 xylS2 XylDLEGF operon transcriptional activator 2 Pseudomonas putida
B5FPP6 0.000691 40 24 0 99 3 rhaR HTH-type transcriptional activator RhaR Salmonella dublin (strain CT_02021853)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS12525
Feature type CDS
Gene -
Product AraC family transcriptional regulator
Location 96763 - 97122 (strand: 1)
Length 360 (nucleotides) / 119 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000003
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3651
Orthogroup size 4
N. genomes 2

Actions

Genomic region

Domains

PF12833 Helix-turn-helix domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2207 Transcription (K) K AraC-type DNA-binding domain and AraC-containing proteins

Protein Sequence

MKKNNSLIRATIQSIIEWIESNISNPMPIKVLSDKSGYSAGHFQKSFKKITGMTPKVYITYRKMIIAKELLAETHSSITEITMYLGYAQQPTFSKVFREYYRITPTQYRQNTQTVCAQE

Flanking regions ( +/- flanking 50bp)

GCGATAACAGGCCGACCTTATCCTTAATAGTACAAGACCAGGACATTAAGATGAAAAAAAATAATTCGCTGATAAGAGCAACTATCCAATCTATTATCGAATGGATCGAGTCTAATATATCAAACCCGATGCCAATTAAAGTGTTATCAGATAAATCAGGTTATTCTGCCGGGCATTTCCAGAAAAGTTTTAAAAAAATTACCGGAATGACGCCGAAAGTGTATATAACGTACCGGAAAATGATTATCGCCAAAGAATTACTGGCAGAAACACACAGCTCTATCACTGAAATTACAATGTATCTTGGTTATGCGCAGCAGCCAACATTCAGCAAAGTATTCCGTGAGTATTACCGTATAACACCGACACAATATCGCCAGAACACTCAGACTGTCTGCGCACAGGAATAATTTACCTTCCGGGCTGCCGGGAGCACCGTACCGGCAGCCAATCTGCTGTG