Homologs in group_760

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02825 FBDBKF_02825 26.8 Morganella morganii S1 araC AraC-type DNA-binding domain and AraC-containing proteins
EHELCC_03295 EHELCC_03295 26.8 Morganella morganii S2 araC AraC-type DNA-binding domain and AraC-containing proteins
NLDBIP_00165 NLDBIP_00165 26.8 Morganella morganii S4 araC AraC-type DNA-binding domain and AraC-containing proteins
LHKJJB_01870 LHKJJB_01870 26.8 Morganella morganii S3 araC AraC-type DNA-binding domain and AraC-containing proteins
HKOGLL_01910 HKOGLL_01910 26.8 Morganella morganii S5 araC AraC-type DNA-binding domain and AraC-containing proteins
F4V73_RS05265 F4V73_RS05265 26.5 Morganella psychrotolerans - AraC family transcriptional regulator

Distribution of the homologs in the orthogroup group_760

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_760

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O31449 6.83e-18 84 24 6 266 4 ybfI Uncharacterized HTH-type transcriptional regulator YbfI Bacillus subtilis (strain 168)
P40408 6.9e-08 56 30 3 131 1 btr HTH-type transcriptional activator Btr Bacillus subtilis (strain 168)
P43463 3.92e-06 48 31 1 89 4 aarP HTH-type transcriptional activator AarP Providencia stuartii
Q00753 6.09e-06 50 23 7 252 4 msmR Msm operon regulatory protein Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q52620 1.74e-05 46 31 1 85 4 pqrA Probable transcription factor PqrA Proteus vulgaris
Q51872 3.96e-05 47 33 2 112 4 lumQ Probable transcriptional regulator LumQ Photobacterium leiognathi
B1JNC5 9.09e-05 46 24 8 252 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TRS8 9.09e-05 46 24 8 252 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis (strain Pestoides F)
B2K1W5 9.09e-05 46 24 8 252 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FN80 9.09e-05 46 24 8 252 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66FF2 0.000114 46 24 8 252 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype I (strain IP32953)
P26993 0.000144 45 27 1 103 1 exsA HTH-type transcriptional regulator ExsA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A9QYR8 0.000186 45 24 8 252 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis bv. Antiqua (strain Angola)
P28816 0.000204 43 26 1 89 1 tetD Transposon Tn10 TetD protein Escherichia coli
H9L484 0.000236 43 27 1 94 1 ramA Transcriptional regulator RamA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P96660 0.00024 45 20 9 259 4 ydeC Uncharacterized HTH-type transcriptional regulator YdeC Bacillus subtilis (strain 168)
Q46855 0.000343 45 24 3 114 4 yqhC Uncharacterized HTH-type transcriptional regulator YqhC Escherichia coli (strain K12)
O31522 0.000449 45 28 2 95 2 yesS HTH-type transcriptional regulator YesS Bacillus subtilis (strain 168)
Q8ZM00 0.00075 43 28 2 104 1 STM3175 Probable HTH-type transcriptional regulator STM3175 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0ACI2 0.001 43 28 1 89 3 rob Right origin-binding protein Shigella flexneri
P0ACI0 0.001 43 28 1 89 1 rob Right origin-binding protein Escherichia coli (strain K12)
P0ACI1 0.001 43 28 1 89 3 rob Right origin-binding protein Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04870
Feature type CDS
Gene -
Product AraC family transcriptional regulator
Location 1035579 - 1036391 (strand: 1)
Length 813 (nucleotides) / 270 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_760
Orthogroup size 7
N. genomes 6

Actions

Genomic region

Domains

PF02311 AraC-like ligand binding domain
PF12833 Helix-turn-helix domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2207 Transcription (K) K AraC-type DNA-binding domain and AraC-containing proteins

Protein Sequence

MPGNEKAKDWVKLAEHSMQIERIEAFFSGHGYEPHRHDTYAIGRTLAGVQSFNYRSQKRHSLPGGTVILHPDEVHDGKAGTLDGFRYRMLYIKPSLVQNILGGKPLPFIPDGISTDPRLSTAIQPLLKAMDMHFEMIEEEDAIYDLVQILAAIGGQSHQRRSFDYKAAELAREYIHSHFDNNITLDELSSVSGRERWSLSRDFRVLFGTSPYRYITMRRLERFKDLILKRKHLADSAIEAGFADQSHANRQFLSHFGISPGRWLKYIQNN

Flanking regions ( +/- flanking 50bp)

ATTGTATATAATACTGTTAATTACCTGTGGTTTGAGAGGAGAGTATCAGAATGCCGGGAAATGAAAAAGCAAAAGACTGGGTGAAGCTGGCTGAGCACTCAATGCAGATAGAACGTATAGAGGCTTTTTTTTCTGGTCATGGTTATGAACCTCATCGCCACGACACCTATGCCATTGGGCGCACATTAGCTGGTGTACAAAGTTTTAATTATCGTAGTCAAAAACGTCATAGCTTGCCGGGAGGGACTGTAATATTACACCCCGATGAAGTGCATGATGGAAAGGCAGGGACACTGGATGGATTCCGGTATCGTATGTTATATATTAAGCCTTCTTTAGTTCAAAATATTCTTGGCGGTAAGCCGCTCCCCTTTATTCCTGATGGTATTTCTACTGATCCCAGGCTATCAACTGCAATTCAGCCCTTATTAAAAGCAATGGATATGCATTTTGAAATGATTGAAGAAGAAGATGCAATTTACGATCTTGTACAGATCCTCGCTGCTATCGGAGGACAAAGTCATCAACGACGGTCATTTGATTACAAAGCCGCAGAGCTTGCCCGGGAGTATATTCATTCACATTTTGATAATAATATTACACTAGATGAGCTTTCTTCAGTGAGTGGCAGGGAACGGTGGAGTTTGAGTCGGGATTTCCGCGTATTATTTGGAACAAGTCCATATAGATATATAACTATGCGACGATTGGAACGGTTTAAAGACTTGATATTAAAGCGTAAACATTTGGCAGATAGTGCTATCGAAGCTGGGTTTGCAGATCAGAGTCATGCAAACCGTCAATTTTTAAGTCATTTTGGTATTTCTCCCGGTCGATGGTTAAAATACATCCAAAATAACTGAGATATTAAGTTGCACGATCATTCAATAATTATTCAGCATTTCTTACTATG