Homologs in group_237

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03365 FBDBKF_03365 89.5 Morganella morganii S1 accC acetyl-CoA carboxylase biotin carboxylase subunit
EHELCC_07170 EHELCC_07170 89.5 Morganella morganii S2 accC acetyl-CoA carboxylase biotin carboxylase subunit
NLDBIP_07495 NLDBIP_07495 89.5 Morganella morganii S4 accC acetyl-CoA carboxylase biotin carboxylase subunit
LHKJJB_07030 LHKJJB_07030 89.5 Morganella morganii S3 accC acetyl-CoA carboxylase biotin carboxylase subunit
HKOGLL_03900 HKOGLL_03900 89.5 Morganella morganii S5 accC acetyl-CoA carboxylase biotin carboxylase subunit
F4V73_RS11565 F4V73_RS11565 88.0 Morganella psychrotolerans accC acetyl-CoA carboxylase biotin carboxylase subunit
PMI_RS17705 PMI_RS17705 46.1 Proteus mirabilis HI4320 - biotin carboxylase N-terminal domain-containing protein

Distribution of the homologs in the orthogroup group_237

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_237

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P24182 0.0 791 87 0 448 1 accC Biotin carboxylase Escherichia coli (strain K12)
Q8X9B6 0.0 790 86 0 448 3 accC Biotin carboxylase Escherichia coli O157:H7
P43873 0.0 776 84 0 448 1 accC Biotin carboxylase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O52058 0.0 677 74 0 446 3 accC Biotin carboxylase Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
P37798 0.0 672 70 0 449 1 accC Biotin carboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q06862 0.0 523 58 3 443 3 accC Biotin carboxylase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O27939 1.23e-178 511 56 2 443 1 pycA Pyruvate carboxylase subunit A Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P49787 7.7e-177 505 56 3 444 3 accC1 Biotin carboxylase 1 Bacillus subtilis (strain 168)
Q58626 2.48e-176 506 56 2 445 1 pycA Pyruvate carboxylase subunit A Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B9HBA8 2.9e-172 496 54 3 442 2 POPTRDRAFT_831870 Biotin carboxylase 1, chloroplastic Populus trichocarpa
B9N843 3.9e-170 491 54 3 442 2 POPTR_0018s14250g Biotin carboxylase 2, chloroplastic Populus trichocarpa
O04983 1.04e-168 488 54 3 442 1 CAC2 Biotin carboxylase, chloroplastic Arabidopsis thaliana
O30019 1.31e-168 486 54 1 443 3 pycA Pyruvate carboxylase subunit A Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
D3DJ42 1.99e-148 434 52 4 444 1 cfiB 2-oxoglutarate carboxylase small subunit Hydrogenobacter thermophilus (strain DSM 6534 / IAM 12695 / TK-6)
Q9KDS9 1.21e-146 428 49 3 446 3 accC Biotin carboxylase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
I3R7G3 1.49e-146 433 49 3 446 1 pccA Propionyl-CoA carboxylase, biotin carboxylase and biotin-carboxyl carrier subunit Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
Q2QMG2 8.92e-144 431 48 5 449 2 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Oryza sativa subsp. japonica
O34544 2.3e-143 420 49 2 445 3 accC2 Biotin carboxylase 2 Bacillus subtilis (strain 168)
Q5I0C3 3.25e-143 429 48 5 444 1 Mccc1 Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Rattus norvegicus
P9WPQ3 4.27e-143 426 46 4 448 1 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPQ2 4.27e-143 426 46 4 448 3 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A509 4.27e-143 426 46 4 448 3 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q99MR8 4.17e-142 426 48 4 442 1 Mccc1 Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Mus musculus
Q42523 1.21e-141 425 48 5 447 1 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Arabidopsis thaliana
Q96RQ3 3.04e-141 424 48 4 442 1 MCCC1 Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Homo sapiens
Q42777 1.66e-139 420 48 3 443 1 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Glycine max
P0DTA4 5.06e-139 418 48 5 443 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Sus scrofa
Q54KE6 6.46e-139 417 49 4 435 3 mccA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Dictyostelium discoideum
P05165 8.83e-137 412 47 5 443 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Homo sapiens
Q19842 3.57e-136 411 46 5 443 1 pcca-1 Propionyl-CoA carboxylase alpha chain, mitochondrial Caenorhabditis elegans
Q91ZA3 7.2e-136 410 47 5 443 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Mus musculus
P14882 1.09e-134 407 46 5 443 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Rattus norvegicus
Q612F5 3.48e-134 406 46 5 443 3 pcca-1 Propionyl-CoA carboxylase alpha chain, mitochondrial Caenorhabditis briggsae
Q9KWU4 2.79e-133 415 47 6 450 1 pyc Pyruvate carboxylase Bacillus subtilis (strain 168)
Q5LUF3 5.12e-128 389 43 4 462 1 pccA Propionyl-CoA carboxylase alpha chain Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A0A0H3JRU9 5.29e-124 390 44 6 451 1 pycA Pyruvate carboxylase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q05920 6.7e-121 382 45 7 448 1 Pc Pyruvate carboxylase, mitochondrial Mus musculus
P52873 2.63e-120 381 45 7 448 1 Pc Pyruvate carboxylase, mitochondrial Rattus norvegicus
Q29RK2 3.24e-120 381 45 7 448 2 PC Pyruvate carboxylase, mitochondrial Bos taurus
P46392 7.08e-120 365 46 4 428 3 bccA Biotin-dependent acyl-coenzyme A carboxylase alpha3 subunit Mycobacterium leprae (strain TN)
P11498 8.55e-120 380 45 7 448 1 PC Pyruvate carboxylase, mitochondrial Homo sapiens
P96890 1.13e-116 357 46 6 442 1 accA3 Biotin-dependent acyl-coenzyme A carboxylase alpha3 subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5H0J2 8.9e-111 362 44 4 433 3 DUR1,2 Urea amidolyase Lachancea kluyveri
P32327 5.35e-108 348 46 6 439 1 PYC2 Pyruvate carboxylase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32528 1.64e-107 352 41 4 443 1 DUR1,2 Urea amidolyase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O17732 6.39e-107 345 42 7 450 1 pyc-1 Pyruvate carboxylase 1 Caenorhabditis elegans
P11154 1.22e-105 342 46 7 439 1 PYC1 Pyruvate carboxylase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8X1T3 4.95e-105 340 46 6 454 3 PYC Pyruvate carboxylase Pichia angusta
Q9UUE1 2.29e-104 338 44 6 449 3 pyr1 Pyruvate carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O93918 5.29e-102 332 44 8 453 2 pyc Pyruvate carboxylase Aspergillus terreus
Q0CLK1 5.35e-102 332 44 8 453 3 pyc Pyruvate carboxylase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9HES8 8.48e-101 329 44 7 450 3 pyc Pyruvate carboxylase Aspergillus niger
P38095 1.35e-98 323 39 8 460 2 lamA Putative urea carboxylase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P78992 2.44e-97 320 46 6 426 3 PYC1 Pyruvate carboxylase Komagataella pastoris
Q13085 5.1e-72 250 32 11 504 1 ACACA Acetyl-CoA carboxylase 1 Homo sapiens
Q5SWU9 1.08e-71 249 32 11 504 1 Acaca Acetyl-CoA carboxylase 1 Mus musculus
Q28559 2.22e-71 248 32 12 504 2 ACACA Acetyl-CoA carboxylase 1 Ovis aries
Q54J08 2.39e-71 248 32 11 506 3 accA Acetyl-CoA carboxylase Dictyostelium discoideum
Q9TTS3 3.23e-71 248 32 12 504 2 ACACA Acetyl-CoA carboxylase 1 Bos taurus
P11029 1.07e-70 246 32 11 504 1 ACAC Acetyl-CoA carboxylase Gallus gallus
P11497 1.16e-69 243 32 11 504 1 Acaca Acetyl-CoA carboxylase 1 Rattus norvegicus
O00763 2.02e-68 240 32 10 504 1 ACACB Acetyl-CoA carboxylase 2 Homo sapiens
E9Q4Z2 4.49e-68 239 31 10 504 1 Acacb Acetyl-CoA carboxylase 2 Mus musculus
P78820 5.46e-67 236 32 15 519 1 cut6 Acetyl-CoA carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A4P8DJE6 1.35e-65 232 33 13 493 3 dmxL1 Acetyl-CoA carboxylase dmxL1 Cryptosporiopsis sp. (strain 8999)
P32874 1.6e-65 231 32 16 510 1 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZMR9 1.72e-65 231 32 16 510 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain YJM789)
B3LM95 1.93e-65 231 32 16 510 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain RM11-1a)
Q00955 2.45e-65 231 31 13 518 1 ACC1 Acetyl-CoA carboxylase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C7GRE4 4.27e-65 230 32 16 510 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain JAY291)
C8ZF72 4.61e-65 230 32 16 510 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
B9FK36 7.3e-63 224 28 9 512 3 ACC2 Acetyl-CoA carboxylase 2 Oryza sativa subsp. japonica
Q38970 8.29e-63 223 28 10 512 1 ACC1 Acetyl-CoA carboxylase 1 Arabidopsis thaliana
Q8S6N5 3.21e-62 222 28 12 514 3 ACC1 Acetyl-CoA carboxylase 1 Oryza sativa subsp. japonica
F4I1L3 4.26e-62 221 28 10 512 2 ACC2 Acetyl-CoA carboxylase 2 Arabidopsis thaliana
B8D1H3 1.21e-12 73 23 9 304 3 carB Carbamoyl phosphate synthase large chain Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B8D1H3 2.03e-07 57 22 11 331 3 carB Carbamoyl phosphate synthase large chain Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q9PIL7 1.89e-12 73 25 7 243 3 carB Carbamoyl phosphate synthase large chain Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9PIL7 0.000116 48 25 12 323 3 carB Carbamoyl phosphate synthase large chain Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9KPH9 6.11e-12 71 23 4 243 3 carB Carbamoyl phosphate synthase large chain Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P14846 1.6e-11 70 26 5 199 3 carB Carbamoyl phosphate synthase large chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z9L7 1.72e-11 70 26 5 199 3 carB Carbamoyl phosphate synthase large chain Salmonella typhi
Q8FLB0 2.96e-11 69 26 4 190 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P00968 3.2e-11 69 26 4 190 1 carB Carbamoyl phosphate synthase large chain Escherichia coli (strain K12)
P63738 3.23e-11 69 26 4 190 3 carB Carbamoyl phosphate synthase large chain Shigella flexneri
P63737 3.23e-11 69 26 4 190 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O157:H7
Q8U085 3.42e-11 69 29 8 232 3 carB Carbamoyl phosphate synthase large chain Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U085 0.000734 45 23 8 230 3 carB Carbamoyl phosphate synthase large chain Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q87SF3 3.85e-11 69 25 3 188 3 carB Carbamoyl phosphate synthase large chain Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87SF3 0.00028 47 24 8 243 3 carB Carbamoyl phosphate synthase large chain Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MNU0 5.47e-11 68 22 6 290 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain YJ016)
Q7MNU0 0.00028 47 24 8 243 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain YJ016)
Q8DEM2 5.47e-11 68 22 6 290 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain CMCP6)
Q8DEM2 0.00028 47 24 8 243 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain CMCP6)
P18185 7.26e-11 68 21 7 251 3 carB Carbamoyl phosphate synthase arginine-specific large chain Bacillus subtilis (strain 168)
P18185 0.000687 45 22 9 312 3 carB Carbamoyl phosphate synthase arginine-specific large chain Bacillus subtilis (strain 168)
B1I4M8 9.58e-11 67 24 5 233 3 carB Carbamoyl phosphate synthase large chain Desulforudis audaxviator (strain MP104C)
B1I4M8 2.76e-06 53 25 15 335 3 carB Carbamoyl phosphate synthase large chain Desulforudis audaxviator (strain MP104C)
A0JX72 2.75e-10 66 27 7 238 3 carB Carbamoyl phosphate synthase large chain Arthrobacter sp. (strain FB24)
B8H8U5 3.71e-10 65 27 7 238 3 carB Carbamoyl phosphate synthase large chain Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q8ZY48 3.85e-10 65 26 10 347 3 carB Carbamoyl phosphate synthase large chain Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
A1R6Z3 7.83e-10 65 27 7 238 3 carB Carbamoyl phosphate synthase large chain Paenarthrobacter aurescens (strain TC1)
Q8REV7 1.01e-09 63 24 6 221 3 purD Phosphoribosylamine--glycine ligase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P58939 1.07e-09 64 23 6 243 3 carB Carbamoyl phosphate synthase large chain Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A6LPD9 1.13e-09 64 23 5 232 3 carB Carbamoyl phosphate synthase large chain Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A6LPD9 2.43e-05 50 22 6 249 3 carB Carbamoyl phosphate synthase large chain Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
C5CCF1 1.37e-09 64 26 7 234 3 carB Carbamoyl phosphate synthase large chain Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
A5IJL8 1.43e-09 64 25 10 328 3 carB Carbamoyl phosphate synthase large chain Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A5IJL8 1.85e-08 60 21 6 257 3 carB Carbamoyl phosphate synthase large chain Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9WZ27 1.44e-09 64 25 10 328 3 carB Carbamoyl phosphate synthase large chain Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WZ27 1.89e-07 57 21 6 257 3 carB Carbamoyl phosphate synthase large chain Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B5XKW2 1.5e-09 63 22 5 233 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M49 (strain NZ131)
Q8ZIL4 1.55e-09 63 23 6 248 3 carB Carbamoyl phosphate synthase large chain Yersinia pestis
C1F1S6 3.12e-09 63 22 4 245 3 carB Carbamoyl phosphate synthase large chain Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
C1F1S6 0.000104 48 26 14 345 3 carB Carbamoyl phosphate synthase large chain Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q67Q54 3.14e-09 63 23 4 234 3 carB Carbamoyl phosphate synthase large chain Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q67Q54 0.000211 47 24 7 233 3 carB Carbamoyl phosphate synthase large chain Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q58776 3.2e-09 62 23 4 238 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P0DA14 4.16e-09 62 22 5 233 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q9A0C6 4.2e-09 62 22 5 233 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M1
A2RF60 4.27e-09 62 22 5 233 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M5 (strain Manfredo)
P58941 4.42e-09 62 22 5 233 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XCR6 4.42e-09 62 22 5 233 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8F832 5.71e-09 62 24 11 346 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8F832 5.62e-08 58 23 8 249 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NF1 5.71e-09 62 24 11 346 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q72NF1 5.62e-08 58 23 8 249 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B1L8T8 6.12e-09 62 25 10 328 3 carB Carbamoyl phosphate synthase large chain Thermotoga sp. (strain RQ2)
B1L8T8 1.86e-07 57 21 6 257 3 carB Carbamoyl phosphate synthase large chain Thermotoga sp. (strain RQ2)
Q0SPY4 6.91e-09 62 25 4 177 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain SM101 / Type A)
Q0SPY4 0.000117 48 21 5 234 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain SM101 / Type A)
Q8XHB3 7.22e-09 62 25 4 177 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain 13 / Type A)
Q8XHB3 0.000335 47 21 5 234 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain 13 / Type A)
Q8FT42 7.3e-09 62 24 6 234 3 carB Carbamoyl phosphate synthase large chain Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q0TM79 8.09e-09 61 25 4 174 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TM79 0.000327 47 21 5 234 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A4TBY6 8.39e-09 61 27 9 234 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium gilvum (strain PYR-GCK)
A2BJL3 9.07e-09 61 27 11 322 3 carB Carbamoyl phosphate synthase large chain Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
A2BJL3 0.000118 48 25 4 168 3 carB Carbamoyl phosphate synthase large chain Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
Q9CKV0 1.08e-08 61 22 4 198 3 carB Carbamoyl phosphate synthase large chain Pasteurella multocida (strain Pm70)
Q97FT3 1.24e-08 61 24 5 233 3 carB Carbamoyl phosphate synthase large chain Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P55641 1.25e-08 60 25 8 231 4 NGR_a01790 Uncharacterized protein y4rH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P58942 1.25e-08 61 22 6 254 3 carB Carbamoyl phosphate synthase large chain Xanthomonas axonopodis pv. citri (strain 306)
P58942 8.5e-06 52 23 8 342 3 carB Carbamoyl phosphate synthase large chain Xanthomonas axonopodis pv. citri (strain 306)
O28994 1.27e-08 61 26 9 265 3 carB Carbamoyl phosphate synthase large chain Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O28994 5.68e-08 58 22 5 240 3 carB Carbamoyl phosphate synthase large chain Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q1IWM0 1.47e-08 60 21 4 243 3 carB Carbamoyl phosphate synthase large chain Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q1IWM0 0.00086 45 25 6 248 3 carB Carbamoyl phosphate synthase large chain Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A0B8K9 1.76e-08 60 24 13 350 3 carB Carbamoyl phosphate synthase large chain Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
A0B8K9 3.27e-05 50 21 5 231 3 carB Carbamoyl phosphate synthase large chain Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
P0DA15 1.8e-08 60 22 5 233 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M3 (strain SSI-1)
B9KXM5 2.07e-08 60 24 6 239 3 carB Carbamoyl phosphate synthase large chain Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q9RWK0 2.23e-08 60 24 5 237 3 carB Carbamoyl phosphate synthase large chain Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A7GE89 2.26e-08 60 25 4 181 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A7GE89 1.27e-06 54 22 6 243 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q7VP67 2.38e-08 60 21 6 248 3 carB Carbamoyl phosphate synthase large chain Haemophilus ducreyi (strain 35000HP / ATCC 700724)
C1FNY3 2.42e-08 60 25 4 181 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Kyoto / Type A2)
C1FNY3 3.89e-06 53 22 6 243 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Kyoto / Type A2)
Q1AVY9 2.61e-08 60 25 7 236 3 carB Carbamoyl phosphate synthase large chain Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1AVY9 2.75e-06 53 25 17 376 3 carB Carbamoyl phosphate synthase large chain Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A1T8H1 3.52e-08 59 27 9 234 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q87EB8 3.56e-08 59 21 5 250 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87EB8 3.19e-05 50 22 12 360 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q4J8E8 4.7e-08 59 22 2 218 3 carB Carbamoyl phosphate synthase large chain Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q4J8E8 9.34e-08 58 26 12 329 3 carB Carbamoyl phosphate synthase large chain Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q9HK17 4.74e-08 59 25 4 211 3 carB Carbamoyl phosphate synthase large chain Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q9HK17 8.37e-06 52 26 8 220 3 carB Carbamoyl phosphate synthase large chain Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
P59448 4.81e-08 59 25 4 193 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P58943 6.31e-08 58 21 5 250 3 carB Carbamoyl phosphate synthase large chain Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P58943 6.7e-05 49 23 9 334 3 carB Carbamoyl phosphate synthase large chain Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B9KB91 6.91e-08 58 24 10 328 3 carB Carbamoyl phosphate synthase large chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B9KB91 4.86e-06 52 19 6 269 3 carB Carbamoyl phosphate synthase large chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q9PEC1 7.44e-08 58 22 6 253 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain 9a5c)
B2UX86 7.82e-08 58 25 4 178 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Alaska E43 / Type E3)
B2UX86 1.31e-05 51 23 6 241 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Alaska E43 / Type E3)
Q8G815 9.75e-08 58 27 9 242 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum (strain NCC 2705)
B3DQ32 9.75e-08 58 27 9 242 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum (strain DJO10A)
A9WSA8 9.79e-08 58 23 7 238 3 carB Carbamoyl phosphate synthase large chain Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q9JXW8 1.09e-07 58 22 4 243 3 carB Carbamoyl phosphate synthase large chain Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9K9V9 1.12e-07 58 22 11 331 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P25994 1.27e-07 57 23 5 237 1 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Bacillus subtilis (strain 168)
A8AX83 1.29e-07 57 21 5 253 3 carB Carbamoyl phosphate synthase large chain Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B1KT07 1.3e-07 57 24 3 178 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Loch Maree / Type A3)
B1KT07 0.000333 47 21 5 248 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Loch Maree / Type A3)
B2GI87 1.63e-07 57 24 7 245 3 carB Carbamoyl phosphate synthase large chain Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q8K9Z7 1.85e-07 57 23 7 251 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8KBV8 1.85e-07 56 26 8 229 3 purD Phosphoribosylamine--glycine ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
C3NH23 1.95e-07 57 24 10 326 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
Q834E2 1.96e-07 57 25 6 224 3 carB Carbamoyl phosphate synthase large chain Enterococcus faecalis (strain ATCC 700802 / V583)
Q834E2 0.000722 45 24 8 231 3 carB Carbamoyl phosphate synthase large chain Enterococcus faecalis (strain ATCC 700802 / V583)
Q38X24 2.17e-07 57 25 4 192 3 carB Carbamoyl phosphate synthase large chain Latilactobacillus sakei subsp. sakei (strain 23K)
B9DRV7 2.29e-07 57 23 5 190 3 carB Carbamoyl phosphate synthase large chain Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A8F453 2.37e-07 57 23 10 349 3 carB Carbamoyl phosphate synthase large chain Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A8F453 3.24e-06 53 21 8 270 3 carB Carbamoyl phosphate synthase large chain Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q1IPK2 2.41e-07 57 23 6 247 3 carB Carbamoyl phosphate synthase large chain Koribacter versatilis (strain Ellin345)
Q1IPK2 6.11e-05 49 24 15 346 3 carB Carbamoyl phosphate synthase large chain Koribacter versatilis (strain Ellin345)
Q9JW02 2.73e-07 57 21 4 243 3 carB Carbamoyl phosphate synthase large chain Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q03LT8 2.77e-07 57 22 5 220 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5F6 2.77e-07 57 22 5 220 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M0W9 2.77e-07 57 22 5 220 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain CNRZ 1066)
C3MW21 2.84e-07 57 24 10 326 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MW21 0.000871 45 20 9 241 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C4KHM7 2.84e-07 57 24 10 326 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C4KHM7 0.000878 45 20 9 241 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3N664 2.84e-07 57 24 10 326 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.27)
C3N664 0.000871 45 20 9 241 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.27)
Q9ZB63 2.98e-07 56 22 5 228 3 carB Carbamoyl phosphate synthase arginine-specific large chain Geobacillus stearothermophilus
C3NEM0 3.34e-07 56 24 10 326 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3MQE3 3.34e-07 56 24 10 326 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
Q1B9F9 3.73e-07 56 26 9 234 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain MCS)
A1UFK4 3.73e-07 56 26 9 234 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain KMS)
A3PZ65 3.73e-07 56 26 9 234 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain JLS)
A5D508 3.74e-07 56 23 5 198 3 carB Carbamoyl phosphate synthase large chain Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q7S8A6 3.79e-07 56 22 10 318 1 pyr-3 Multifunctional protein pyr-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7S8A6 1.08e-05 52 21 5 256 1 pyr-3 Multifunctional protein pyr-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
O93937 4.09e-07 56 24 2 177 3 pyrABCN Multifunctional protein pyrABCN Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B7GPW2 4.11e-07 56 26 9 242 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
C1CR31 4.31e-07 56 22 6 238 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain Taiwan19F-14)
Q97QE4 4.31e-07 56 22 6 238 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04K48 4.31e-07 56 22 6 238 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q469Z7 4.39e-07 56 22 4 221 3 carB Carbamoyl phosphate synthase large chain Methanosarcina barkeri (strain Fusaro / DSM 804)
Q8CWR0 4.46e-07 56 22 6 238 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IQ67 4.61e-07 56 22 6 238 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain CGSP14)
B8ZJT9 4.61e-07 56 22 6 238 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B5E512 4.65e-07 56 22 6 238 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 19F (strain G54)
O66949 4.67e-07 55 24 12 302 1 purD Phosphoribosylamine--glycine ligase Aquifex aeolicus (strain VF5)
B1IC65 4.74e-07 56 22 6 238 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain Hungary19A-6)
A3CNI5 4.82e-07 56 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus sanguinis (strain SK36)
C1C7Q3 5.39e-07 55 22 6 238 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain 70585)
B9EXM2 5.42e-07 55 25 14 364 2 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Oryza sativa subsp. japonica
C1CL09 5.49e-07 55 22 6 238 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain P1031)
C0M756 5.63e-07 55 23 5 233 3 carB Carbamoyl phosphate synthase large chain Streptococcus equi subsp. equi (strain 4047)
C1CEM9 5.73e-07 55 22 6 238 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain JJA)
Q8DUP3 5.78e-07 55 23 6 233 3 carB Carbamoyl phosphate synthase large chain Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P08955 6.51e-07 55 22 6 240 1 CAD Multifunctional protein CAD Mesocricetus auratus
P08955 1.51e-05 51 22 2 180 1 CAD Multifunctional protein CAD Mesocricetus auratus
B2RQC6 6.56e-07 55 22 6 240 1 Cad Multifunctional protein CAD Mus musculus
B2RQC6 3.55e-05 50 22 2 180 1 Cad Multifunctional protein CAD Mus musculus
B2THH3 6.6e-07 55 25 4 178 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Eklund 17B / Type B)
B2THH3 1.45e-05 51 22 6 249 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Eklund 17B / Type B)
A2SQ53 6.63e-07 55 25 3 179 3 carB Carbamoyl phosphate synthase large chain Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
O67233 7.06e-07 55 22 3 232 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Aquifex aeolicus (strain VF5)
Q5FJC0 7.19e-07 55 23 3 177 3 carB Carbamoyl phosphate synthase large chain Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A9KI94 7.38e-07 55 22 10 330 3 carB Carbamoyl phosphate synthase large chain Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A9KI94 4.15e-05 50 21 4 220 3 carB Carbamoyl phosphate synthase large chain Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q59969 8.23e-07 55 24 10 326 3 carB Carbamoyl phosphate synthase large chain Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q59969 5.8e-05 49 21 8 241 3 carB Carbamoyl phosphate synthase large chain Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P27708 9.59e-07 55 21 5 240 1 CAD Multifunctional protein CAD Homo sapiens
P27708 0.000585 46 21 2 180 1 CAD Multifunctional protein CAD Homo sapiens
B0K4D7 9.75e-07 55 23 12 340 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter sp. (strain X514)
B0K4D7 3.54e-06 53 23 7 240 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter sp. (strain X514)
B2A170 9.82e-07 55 24 9 246 3 carB Carbamoyl phosphate synthase large chain Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B2A170 3.74e-05 50 25 5 182 3 carB Carbamoyl phosphate synthase large chain Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
P13258 1.02e-06 54 22 3 191 3 carB Carbamoyl phosphate synthase large chain (Fragment) Methanosarcina barkeri
C4ZEK2 1.04e-06 55 21 4 229 3 carB Carbamoyl phosphate synthase large chain Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
C4ZEK2 3.57e-06 53 21 12 377 3 carB Carbamoyl phosphate synthase large chain Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q8RSS3 1.06e-06 55 24 10 334 3 carB Carbamoyl phosphate synthase large chain Halomonas eurihalina
Q8RSS3 7.33e-06 52 25 5 178 3 carB Carbamoyl phosphate synthase large chain Halomonas eurihalina
P07259 1.08e-06 55 24 3 180 1 URA2 Multifunctional protein URA2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P07259 0.000374 47 20 5 256 1 URA2 Multifunctional protein URA2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5SKN1 1.13e-06 55 23 5 219 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q5SKN1 7.81e-05 48 24 7 242 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B9EB69 1.23e-06 54 23 13 339 3 carB Carbamoyl phosphate synthase large chain Macrococcus caseolyticus (strain JCSC5402)
Q9KXR6 1.28e-06 54 24 6 235 3 carB Carbamoyl phosphate synthase large chain Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8YQL2 1.33e-06 54 25 5 205 3 carB Carbamoyl phosphate synthase large chain Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8YQL2 6.84e-05 49 25 8 238 3 carB Carbamoyl phosphate synthase large chain Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P96495 1.38e-06 54 23 5 219 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
P96495 0.00045 46 24 8 244 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
C0MEH1 1.41e-06 54 24 5 220 3 carB Carbamoyl phosphate synthase large chain Streptococcus equi subsp. zooepidemicus (strain H70)
Q970U7 1.67e-06 54 27 7 211 3 carB Carbamoyl phosphate synthase large chain Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q970U7 0.000519 46 20 3 220 3 carB Carbamoyl phosphate synthase large chain Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
A1A0T4 1.81e-06 54 24 8 249 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A1A0T4 0.000598 46 24 9 227 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q9CFV2 2e-06 54 24 9 255 3 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. lactis (strain IL1403)
Q9CCR2 2e-06 54 25 9 240 3 carB Carbamoyl phosphate synthase large chain Mycobacterium leprae (strain TN)
A9VTC6 2.13e-06 53 23 11 304 3 carB Carbamoyl phosphate synthase large chain Bacillus mycoides (strain KBAB4)
A9VTC6 9.53e-05 48 23 7 230 3 carB Carbamoyl phosphate synthase large chain Bacillus mycoides (strain KBAB4)
O27077 2.23e-06 53 24 7 245 3 carB Carbamoyl phosphate synthase large chain Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O27077 5.47e-05 49 24 11 345 3 carB Carbamoyl phosphate synthase large chain Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q55756 2.3e-06 53 23 12 376 3 carB Carbamoyl phosphate synthase large chain Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55756 0.000379 47 21 4 210 3 carB Carbamoyl phosphate synthase large chain Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8TWX0 2.86e-06 53 26 6 240 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
C1CXR4 3.06e-06 53 20 4 240 3 carB Carbamoyl phosphate synthase large chain Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q2FLD9 3.1e-06 53 21 3 182 3 carB Carbamoyl phosphate synthase large chain Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q8TUT7 3.97e-06 52 23 6 222 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q827Q7 4.31e-06 53 24 6 234 3 carB Carbamoyl phosphate synthase large chain Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q02YG5 4.31e-06 53 23 8 253 3 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. cremoris (strain SK11)
P9WPK3 4.32e-06 53 26 11 262 1 carB Carbamoyl phosphate synthase large chain Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPK2 4.32e-06 53 26 11 262 3 carB Carbamoyl phosphate synthase large chain Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q732I3 4.32e-06 53 23 8 242 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ATCC 10987 / NRS 248)
Q732I3 0.000583 46 21 7 233 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ATCC 10987 / NRS 248)
B3WEF5 4.58e-06 53 26 8 231 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus casei (strain BL23)
B3WEF5 0.000112 48 21 7 238 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus casei (strain BL23)
Q038Z2 4.91e-06 52 26 8 231 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q038Z2 0.000324 47 21 7 238 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
O32771 4.91e-06 52 23 8 253 2 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. cremoris (strain MG1363)
B7H6M2 5.18e-06 52 23 8 242 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain B4264)
B7JJX3 5.27e-06 52 23 8 242 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain AH820)
Q81WF2 5.36e-06 52 23 8 242 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis
C3L740 5.36e-06 52 23 8 242 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P656 5.36e-06 52 23 8 242 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis (strain A0248)
Q819S3 5.41e-06 52 23 8 242 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6HES8 5.6e-06 52 23 8 242 3 carB Carbamoyl phosphate synthase large chain Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HES8 0.000246 47 22 7 233 3 carB Carbamoyl phosphate synthase large chain Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1EPQ0 5.6e-06 52 23 8 242 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain 03BB102)
A0RHQ8 5.6e-06 52 23 8 242 3 carB Carbamoyl phosphate synthase large chain Bacillus thuringiensis (strain Al Hakam)
B1W463 5.63e-06 52 23 5 234 3 carB Carbamoyl phosphate synthase large chain Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q42601 5.72e-06 52 25 8 262 1 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Arabidopsis thaliana
Q636E0 5.9e-06 52 23 8 242 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ZK / E33L)
A6WCC6 6.47e-06 52 24 7 234 3 carB Carbamoyl phosphate synthase large chain Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q74J34 6.7e-06 52 22 3 178 3 carB Carbamoyl phosphate synthase large chain Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
C5C687 6.77e-06 52 24 10 254 3 carB Carbamoyl phosphate synthase large chain Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
P57244 6.84e-06 52 21 3 185 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B0KBW4 7.07e-06 52 22 7 240 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0KBW4 0.00022 47 25 8 238 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B9IVW3 7.07e-06 52 24 8 229 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain Q1)
B7HLM0 7.07e-06 52 24 8 229 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain AH187)
Q1D6Y8 8.28e-06 52 21 3 218 3 carB Carbamoyl phosphate synthase large chain Myxococcus xanthus (strain DK1622)
Q1D6Y8 4.31e-05 49 24 14 342 3 carB Carbamoyl phosphate synthase large chain Myxococcus xanthus (strain DK1622)
B1YIR9 9.01e-06 52 22 6 223 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q7U054 9.25e-06 52 26 11 262 3 carB Carbamoyl phosphate synthase large chain Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8E5F5 1.11e-05 51 20 9 330 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype III (strain NEM316)
Q04H29 1.34e-05 51 21 12 315 3 carB Carbamoyl phosphate synthase large chain Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q8DZQ7 1.5e-05 51 20 9 328 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8NX94 1.5e-05 50 30 4 117 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus aureus (strain MW2)
Q6GAE8 1.5e-05 50 30 4 117 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus aureus (strain MSSA476)
Q03HB0 1.55e-05 51 20 7 308 3 carB Carbamoyl phosphate synthase large chain Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q7A695 1.61e-05 50 30 4 117 1 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus aureus (strain N315)
Q99V32 1.61e-05 50 30 4 117 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HH19 1.64e-05 50 30 4 117 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus aureus (strain COL)
B8DTW3 1.79e-05 51 26 6 183 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium animalis subsp. lactis (strain AD011)
Q8DNV5 1.94e-05 50 24 5 199 3 ddl D-alanine--D-alanine ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04J98 1.94e-05 50 24 5 199 3 ddl D-alanine--D-alanine ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1CFP2 1.98e-05 50 24 5 199 3 ddl D-alanine--D-alanine ligase Streptococcus pneumoniae (strain JJA)
B8ZM66 1.98e-05 50 24 5 199 3 ddl D-alanine--D-alanine ligase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q3K150 2.19e-05 50 20 9 328 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B9DPN2 2.27e-05 50 22 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus carnosus (strain TM300)
B9DPN2 0.000628 46 22 4 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus carnosus (strain TM300)
A7GRL1 2.41e-05 50 22 12 302 3 carB Carbamoyl phosphate synthase large chain Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A7GRL1 5.34e-05 49 22 7 233 3 carB Carbamoyl phosphate synthase large chain Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B7IUP6 2.5e-05 50 22 11 315 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain G9842)
B7IUP6 0.00013 48 23 7 230 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain G9842)
Q5SH23 2.5e-05 49 28 4 120 1 lysX Alpha-aminoadipate--LysW ligase LysX Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
C1KWD4 2.52e-05 50 21 5 231 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4b (strain CLIP80459)
Q9K8V7 2.83e-05 50 21 4 225 3 carB Carbamoyl phosphate synthase arginine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8FZJ3 3.02e-05 50 20 7 269 3 carB Carbamoyl phosphate synthase large chain Brucella suis biovar 1 (strain 1330)
P0CB57 3.06e-05 49 24 5 199 3 ddl D-alanine--D-alanine ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B5E721 3.11e-05 49 24 5 199 3 ddl D-alanine--D-alanine ligase Streptococcus pneumoniae serotype 19F (strain G54)
O67869 3.15e-05 50 23 5 239 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Aquifex aeolicus (strain VF5)
A3CU73 3.43e-05 50 21 3 188 3 carB Carbamoyl phosphate synthase large chain Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A3CU73 0.000287 47 22 10 345 3 carB Carbamoyl phosphate synthase large chain Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A5UKG5 3.52e-05 50 25 8 215 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A5UKG5 0.000138 48 25 6 183 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
C1CM10 4.06e-05 49 24 5 199 3 ddl D-alanine--D-alanine ligase Streptococcus pneumoniae (strain P1031)
P77886 4.44e-05 49 22 3 186 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q09794 4.52e-05 50 22 2 171 1 ura1 Multifunctional protein ura1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q09794 0.000144 48 19 5 247 1 ura1 Multifunctional protein ura1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8RBK0 4.57e-05 49 24 5 183 3 carB Carbamoyl phosphate synthase large chain Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B2IRS6 4.98e-05 48 23 5 199 3 ddl D-alanine--D-alanine ligase Streptococcus pneumoniae (strain CGSP14)
P38100 5.07e-05 49 24 4 194 3 carB Carbamoyl phosphate synthase large chain Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P38100 0.000742 45 23 8 247 3 carB Carbamoyl phosphate synthase large chain Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A8YVZ3 5.38e-05 49 19 9 310 3 carB Carbamoyl phosphate synthase large chain Lactobacillus helveticus (strain DPC 4571)
Q047M8 5.43e-05 49 19 9 310 3 carB Carbamoyl phosphate synthase large chain Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q87WP4 5.78e-05 49 23 3 182 3 carB Carbamoyl phosphate synthase large chain Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5HPY8 6.01e-05 49 22 6 236 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HPY8 0.00031 47 20 4 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CPJ4 6.33e-05 49 22 6 236 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CPJ4 0.000378 47 20 5 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q91437 6.66e-05 49 20 6 234 2 CAD Multifunctional protein CAD Squalus acanthias
Q91437 0.000415 47 22 5 186 2 CAD Multifunctional protein CAD Squalus acanthias
B1MZ74 7.21e-05 49 23 8 235 3 carB Carbamoyl phosphate synthase large chain Leuconostoc citreum (strain KM20)
B1I733 7.23e-05 48 24 5 199 3 ddl D-alanine--D-alanine ligase Streptococcus pneumoniae (strain Hungary19A-6)
Q46KI4 7.43e-05 48 23 6 186 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL2A)
B8GEA3 7.46e-05 48 23 10 341 3 carB Carbamoyl phosphate synthase large chain Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
P58944 8.37e-05 48 20 4 221 3 carB Carbamoyl phosphate synthase large chain Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q03WW7 8.87e-05 48 23 8 239 3 carB Carbamoyl phosphate synthase large chain Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
C1A4I5 9.48e-05 48 24 4 190 3 carB Carbamoyl phosphate synthase large chain Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
C1A4I5 0.000654 46 26 10 249 3 carB Carbamoyl phosphate synthase large chain Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
Q9HP43 9.98e-05 48 22 3 192 3 carB Carbamoyl phosphate synthase large chain Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q8RG86 0.00011 48 23 9 231 3 carB Carbamoyl phosphate synthase large chain Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A7I6J1 0.000135 48 23 3 181 3 carB Carbamoyl phosphate synthase large chain Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
A7I6J1 0.000591 46 23 10 318 3 carB Carbamoyl phosphate synthase large chain Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q59599 0.00014 48 20 4 243 3 carB Carbamoyl phosphate synthase large chain Neisseria gonorrhoeae
A6Q6K6 0.000152 47 23 12 327 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurovum sp. (strain NBC37-1)
Q5HQA5 0.000161 47 25 11 223 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CPP2 0.000167 47 25 11 223 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9ZKT2 0.000169 48 24 11 331 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain J99 / ATCC 700824)
Q9ZKT2 0.000574 46 23 5 185 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain J99 / ATCC 700824)
B1I3W6 0.00018 47 21 6 219 3 ddl D-alanine--D-alanine ligase Desulforudis audaxviator (strain MP104C)
A5UK38 0.000184 47 24 17 332 1 Msm_0361 Carbamoyl-phosphate synthase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
P46537 0.000188 47 23 6 224 3 carB Carbamoyl phosphate synthase large chain Bacillus caldolyticus
P46537 0.000246 47 23 8 237 3 carB Carbamoyl phosphate synthase large chain Bacillus caldolyticus
Q8YIC2 0.000189 47 20 7 269 3 carB Carbamoyl phosphate synthase large chain Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q6GHN2 0.000191 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MRSA252)
P05990 0.000193 47 22 6 203 1 r Multifunctional protein r Drosophila melanogaster
P63740 0.000194 47 21 8 251 1 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain N315)
P63739 0.000194 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IS88 0.000194 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH9)
A6U122 0.000194 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH1)
A7X1F4 0.000194 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu3 / ATCC 700698)
P58940 0.000196 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MW2)
A8Z3P0 0.000196 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain USA300 / TCH1516)
Q6GA10 0.000196 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MSSA476)
A6QGA4 0.000196 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Newman)
Q5HGM9 0.000196 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain COL)
Q2FZ72 0.000196 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHN5 0.000196 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain USA300)
B8DDR7 0.000218 47 21 5 231 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4a (strain HCC23)
A1WYU0 0.000225 46 26 5 145 3 ddl D-alanine--D-alanine ligase Halorhodospira halophila (strain DSM 244 / SL1)
Q71YI1 0.000232 47 21 5 231 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4b (strain F2365)
A0AJU0 0.000234 47 21 5 231 3 carB Carbamoyl phosphate synthase large chain Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B1HQC1 0.000259 47 20 4 220 3 carB Carbamoyl phosphate synthase large chain Lysinibacillus sphaericus (strain C3-41)
B1HQC1 0.0003 47 24 9 249 3 carB Carbamoyl phosphate synthase large chain Lysinibacillus sphaericus (strain C3-41)
C4L5W3 0.000259 47 22 6 220 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
C4L5W3 0.001 45 23 4 195 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q1WVA9 0.00027 47 24 4 183 3 carB Carbamoyl phosphate synthase large chain Ligilactobacillus salivarius (strain UCC118)
Q4L5Q5 0.000287 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus haemolyticus (strain JCSC1435)
Q2YXG5 0.000289 47 21 8 251 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain bovine RF122 / ET3-1)
P0C017 0.000293 47 27 11 218 2 ADE2 Phosphoribosylaminoimidazole carboxylase Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q4L574 0.000301 46 25 8 190 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus haemolyticus (strain JCSC1435)
A2C2S8 0.00032 46 23 6 186 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL1A)
Q92AH3 0.000333 47 21 5 231 3 carB Carbamoyl phosphate synthase large chain Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
O50302 0.00035 47 22 6 224 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Geobacillus stearothermophilus
O50302 0.000465 46 23 8 237 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Geobacillus stearothermophilus
C1CST6 0.000399 46 23 5 199 3 ddl D-alanine--D-alanine ligase Streptococcus pneumoniae (strain Taiwan19F-14)
P0CQ36 0.000415 46 26 13 252 3 ADE2 Phosphoribosylaminoimidazole carboxylase Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q897P8 0.000447 45 25 6 152 3 ddlA D-alanine--D-alanine ligase A Clostridium tetani (strain Massachusetts / E88)
Q7UJ58 0.000447 46 22 8 260 3 carB Carbamoyl phosphate synthase large chain Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A5IKG2 0.000466 45 24 5 149 3 ddl D-alanine--D-alanine ligase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q72V31 0.000503 45 23 10 254 3 purD Phosphoribosylamine--glycine ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q49WY4 0.000506 46 21 6 237 3 carB Carbamoyl phosphate synthase large chain Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B1L9P4 0.000519 45 24 5 149 3 ddl D-alanine--D-alanine ligase Thermotoga sp. (strain RQ2)
P46805 0.000519 45 24 5 149 3 ddl D-alanine--D-alanine ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8EZT7 0.000574 45 23 10 254 3 purD Phosphoribosylamine--glycine ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
O25577 0.000574 46 23 5 185 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain ATCC 700392 / 26695)
O25577 0.001 45 23 11 331 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain ATCC 700392 / 26695)
Q58773 0.000654 45 23 7 219 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8FMB3 0.000701 45 25 5 183 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q7VBB3 0.000801 45 21 4 184 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B2G564 0.000835 45 23 5 184 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHN6 0.000835 45 23 5 184 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus reuteri (strain DSM 20016)
P0CQ37 0.000839 45 25 11 222 3 ADE2 Phosphoribosylaminoimidazole carboxylase Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q99148 0.001 45 23 10 288 3 ADE1 Bifunctional purine biosynthetic protein ADE1 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q748D8 0.001 44 22 10 279 3 ddl D-alanine--D-alanine ligase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS18045
Feature type CDS
Gene accC
Product acetyl-CoA carboxylase biotin carboxylase subunit
Location 3964066 - 3965415 (strand: -1)
Length 1350 (nucleotides) / 449 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_237
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00289 Biotin carboxylase, N-terminal domain
PF02785 Biotin carboxylase C-terminal domain
PF02786 Carbamoyl-phosphate synthase L chain, ATP binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4770 Lipid transport and metabolism (I) I Acetyl/propionyl-CoA carboxylase, alpha subunit

Kegg Ortholog Annotation(s)

Protein Sequence

MLEKILIANRGEIALRILRACKELGIKAVAVHSTADRDLKHVLLADETICIGPAASAKSYLNIPAIIAAAEISGAQAIHPGYGFLSENADFAEQVERSGFIFIGPKAETIRLMGDKVSAIEAMKKAGVPCVPGSDGPLGNDTAKNIEIAKRIGYPVIIKASGGGGGRGMRVVRSEKDLAQAISMTRAEAKAAFSNDMVYMEKYLENPRHVEIQVMADGQGNAIYLAERDCSMQRRHQKVVEEAPAPGITPEIRKNIGERCANACIEIGYRGAGTFEFLYENGEFYFIEMNTRIQVEHPVTEMITGVDLIKEQLRIASGLPLSVTQDQIHVHGHAIECRINAEDPKTFLPSPGTITRFHSPGGFGVRWESHIYAGYTVPPHYDSMIGKLITYGETREIAISRMKNALAELIIDGIKTNIELHQFIMNDEQFQKGGTNIHYLEKRLGLTEN

Flanking regions ( +/- flanking 50bp)

CTATTGAGTTTGACGATCCACTCTTTGTCATCGAATAACGAGGCAGGCCCATGCTAGAAAAAATCCTCATTGCCAACCGTGGTGAAATTGCACTGCGTATCCTAAGAGCTTGTAAGGAACTTGGGATCAAAGCAGTCGCCGTTCACTCCACGGCAGACCGTGATTTAAAACACGTTCTGCTGGCAGACGAGACTATCTGTATTGGTCCCGCTGCTTCAGCAAAAAGTTACTTAAATATTCCGGCAATTATTGCCGCGGCAGAGATAAGTGGCGCGCAAGCCATTCACCCAGGATATGGCTTCCTGTCTGAAAATGCCGATTTTGCCGAACAAGTTGAACGCTCAGGCTTTATTTTTATTGGCCCTAAAGCGGAAACCATTCGCCTAATGGGTGATAAAGTTTCGGCTATTGAAGCGATGAAAAAAGCCGGTGTTCCTTGTGTACCAGGCTCAGATGGCCCATTAGGTAACGATACCGCCAAAAATATCGAAATCGCCAAACGCATTGGTTACCCTGTTATCATCAAAGCATCAGGTGGTGGCGGTGGTCGCGGTATGCGTGTTGTTCGCTCAGAAAAAGACTTAGCGCAAGCAATCTCCATGACCCGTGCGGAAGCCAAAGCGGCATTTAGCAACGATATGGTCTATATGGAAAAATACCTTGAAAATCCACGCCACGTCGAAATTCAGGTGATGGCCGATGGACAAGGTAATGCTATCTATTTAGCTGAACGTGACTGCTCAATGCAACGTCGCCACCAAAAAGTGGTTGAAGAAGCACCAGCACCGGGTATTACCCCTGAGATCCGTAAAAATATCGGTGAACGCTGTGCAAATGCCTGTATTGAAATTGGCTACCGCGGTGCGGGTACGTTTGAATTCCTCTATGAAAATGGCGAATTCTACTTTATCGAAATGAATACCCGTATTCAGGTTGAGCACCCTGTTACTGAGATGATCACCGGTGTTGACCTTATCAAAGAGCAACTGCGTATTGCATCAGGCTTACCATTATCGGTCACGCAAGATCAAATTCACGTTCATGGACATGCTATTGAGTGCCGTATCAACGCAGAAGATCCAAAAACCTTCTTGCCAAGCCCGGGAACCATCACTCGTTTCCACTCACCAGGCGGATTTGGTGTACGTTGGGAATCACATATTTACGCAGGTTACACCGTTCCACCACACTATGATTCAATGATTGGTAAATTGATCACTTACGGTGAAACACGTGAAATTGCGATTTCTCGTATGAAAAATGCGTTGGCAGAACTTATTATTGACGGCATTAAAACCAATATTGAGCTACACCAATTCATTATGAATGATGAGCAATTCCAAAAAGGTGGTACTAATATTCACTACCTAGAAAAACGCCTAGGTTTAACTGAAAATTAATCTTTTTAGCTTATCAGTAAAAGGCATAGTTTATCGACTATGCCTTTTTT