Homologs in group_250

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03365 FBDBKF_03365 100.0 Morganella morganii S1 accC acetyl-CoA carboxylase biotin carboxylase subunit
NLDBIP_07495 NLDBIP_07495 100.0 Morganella morganii S4 accC acetyl-CoA carboxylase biotin carboxylase subunit
LHKJJB_07030 LHKJJB_07030 100.0 Morganella morganii S3 accC acetyl-CoA carboxylase biotin carboxylase subunit
HKOGLL_03900 HKOGLL_03900 100.0 Morganella morganii S5 accC acetyl-CoA carboxylase biotin carboxylase subunit
F4V73_RS11565 F4V73_RS11565 96.2 Morganella psychrotolerans accC acetyl-CoA carboxylase biotin carboxylase subunit
PMI_RS17705 PMI_RS17705 47.2 Proteus mirabilis HI4320 - biotin carboxylase N-terminal domain-containing protein
PMI_RS18045 PMI_RS18045 89.5 Proteus mirabilis HI4320 accC acetyl-CoA carboxylase biotin carboxylase subunit

Distribution of the homologs in the orthogroup group_250

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_250

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P24182 0.0 785 86 0 448 1 accC Biotin carboxylase Escherichia coli (strain K12)
Q8X9B6 0.0 785 86 0 448 3 accC Biotin carboxylase Escherichia coli O157:H7
P43873 0.0 767 83 0 448 1 accC Biotin carboxylase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37798 0.0 667 70 0 446 1 accC Biotin carboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O52058 0.0 664 73 0 446 3 accC Biotin carboxylase Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
Q58626 2.31e-179 513 57 2 445 1 pycA Pyruvate carboxylase subunit A Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q06862 8.16e-178 507 56 3 443 3 accC Biotin carboxylase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O27939 6.12e-176 504 55 2 443 1 pycA Pyruvate carboxylase subunit A Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P49787 4.87e-175 500 56 3 444 3 accC1 Biotin carboxylase 1 Bacillus subtilis (strain 168)
B9HBA8 5.34e-169 488 54 3 442 2 POPTRDRAFT_831870 Biotin carboxylase 1, chloroplastic Populus trichocarpa
O04983 7.1e-168 486 54 3 442 1 CAC2 Biotin carboxylase, chloroplastic Arabidopsis thaliana
B9N843 8.83e-167 482 54 3 442 2 POPTR_0018s14250g Biotin carboxylase 2, chloroplastic Populus trichocarpa
O30019 9.37e-167 481 53 1 443 3 pycA Pyruvate carboxylase subunit A Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9KDS9 2.05e-151 441 50 3 446 3 accC Biotin carboxylase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
D3DJ42 1.06e-144 424 51 4 444 1 cfiB 2-oxoglutarate carboxylase small subunit Hydrogenobacter thermophilus (strain DSM 6534 / IAM 12695 / TK-6)
I3R7G3 3.11e-143 425 48 2 445 1 pccA Propionyl-CoA carboxylase, biotin carboxylase and biotin-carboxyl carrier subunit Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
O34544 3.92e-143 419 49 2 445 3 accC2 Biotin carboxylase 2 Bacillus subtilis (strain 168)
P9WPQ3 7.36e-141 421 47 7 450 1 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPQ2 7.36e-141 421 47 7 450 3 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A509 7.36e-141 421 47 7 450 3 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q2QMG2 2.37e-140 422 47 4 445 2 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Oryza sativa subsp. japonica
P0DTA4 5.64e-139 418 48 6 444 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Sus scrofa
Q91ZA3 1.53e-138 417 48 6 444 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Mus musculus
Q5I0C3 6.31e-138 415 46 4 442 1 Mccc1 Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Rattus norvegicus
Q42523 1.82e-137 414 47 6 449 1 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Arabidopsis thaliana
Q54KE6 2.04e-137 413 49 4 435 3 mccA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Dictyostelium discoideum
P05165 2.27e-137 414 47 5 443 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Homo sapiens
P14882 3.66e-137 414 47 6 444 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Rattus norvegicus
Q99MR8 7e-137 412 46 4 442 1 Mccc1 Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Mus musculus
Q96RQ3 8.39e-137 412 49 4 422 1 MCCC1 Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Homo sapiens
Q42777 1.91e-136 412 47 3 443 1 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Glycine max
Q19842 1.04e-135 410 46 5 444 1 pcca-1 Propionyl-CoA carboxylase alpha chain, mitochondrial Caenorhabditis elegans
Q9KWU4 4.79e-134 417 47 5 449 1 pyc Pyruvate carboxylase Bacillus subtilis (strain 168)
Q612F5 4.75e-133 403 46 4 443 3 pcca-1 Propionyl-CoA carboxylase alpha chain, mitochondrial Caenorhabditis briggsae
Q5LUF3 3.05e-131 397 44 4 462 1 pccA Propionyl-CoA carboxylase alpha chain Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A0A0H3JRU9 3.82e-126 396 44 5 457 1 pycA Pyruvate carboxylase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q05920 1.68e-123 389 45 7 455 1 Pc Pyruvate carboxylase, mitochondrial Mus musculus
Q29RK2 1.9e-122 387 45 7 455 2 PC Pyruvate carboxylase, mitochondrial Bos taurus
P11498 5.95e-122 385 45 7 455 1 PC Pyruvate carboxylase, mitochondrial Homo sapiens
P52873 9.71e-122 385 45 7 455 1 Pc Pyruvate carboxylase, mitochondrial Rattus norvegicus
P46392 1.92e-115 353 46 4 428 3 bccA Biotin-dependent acyl-coenzyme A carboxylase alpha3 subunit Mycobacterium leprae (strain TN)
P96890 1.12e-112 347 45 6 443 1 accA3 Biotin-dependent acyl-coenzyme A carboxylase alpha3 subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O17732 1.81e-106 344 43 8 451 1 pyc-1 Pyruvate carboxylase 1 Caenorhabditis elegans
A5H0J2 6.34e-105 345 42 4 432 3 DUR1,2 Urea amidolyase Lachancea kluyveri
P32528 2.76e-104 343 39 4 443 1 DUR1,2 Urea amidolyase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32327 4.06e-104 338 45 6 439 1 PYC2 Pyruvate carboxylase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9UUE1 1.15e-103 337 43 6 449 3 pyr1 Pyruvate carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8X1T3 4.92e-102 332 44 6 455 3 PYC Pyruvate carboxylase Pichia angusta
P11154 9.36e-102 331 45 7 439 1 PYC1 Pyruvate carboxylase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0CLK1 7.83e-101 329 44 6 449 3 pyc Pyruvate carboxylase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
O93918 8.85e-101 329 44 6 449 2 pyc Pyruvate carboxylase Aspergillus terreus
Q9HES8 4.82e-99 324 44 6 449 3 pyc Pyruvate carboxylase Aspergillus niger
P78992 3.99e-96 316 44 7 445 3 PYC1 Pyruvate carboxylase Komagataella pastoris
P38095 4.95e-94 311 38 9 461 2 lamA Putative urea carboxylase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54J08 3.06e-70 245 32 11 506 3 accA Acetyl-CoA carboxylase Dictyostelium discoideum
Q13085 5.4e-69 241 30 9 504 1 ACACA Acetyl-CoA carboxylase 1 Homo sapiens
Q5SWU9 5.83e-69 241 30 9 504 1 Acaca Acetyl-CoA carboxylase 1 Mus musculus
Q28559 1.78e-68 240 30 9 504 2 ACACA Acetyl-CoA carboxylase 1 Ovis aries
Q9TTS3 2.85e-68 239 30 9 504 2 ACACA Acetyl-CoA carboxylase 1 Bos taurus
P11029 4.67e-68 239 30 9 504 1 ACAC Acetyl-CoA carboxylase Gallus gallus
O00763 3.53e-67 236 31 12 505 1 ACACB Acetyl-CoA carboxylase 2 Homo sapiens
P11497 6.45e-67 236 30 9 504 1 Acaca Acetyl-CoA carboxylase 1 Rattus norvegicus
E9Q4Z2 4.14e-66 233 31 11 505 1 Acacb Acetyl-CoA carboxylase 2 Mus musculus
A0A4P8DJE6 1.87e-64 228 33 14 493 3 dmxL1 Acetyl-CoA carboxylase dmxL1 Cryptosporiopsis sp. (strain 8999)
P78820 1.94e-64 228 31 16 519 1 cut6 Acetyl-CoA carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B9FK36 2.03e-64 228 29 15 518 3 ACC2 Acetyl-CoA carboxylase 2 Oryza sativa subsp. japonica
Q38970 3.04e-64 228 27 10 512 1 ACC1 Acetyl-CoA carboxylase 1 Arabidopsis thaliana
Q00955 8.49e-64 226 31 15 520 1 ACC1 Acetyl-CoA carboxylase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B3LM95 1.63e-63 226 31 13 509 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain RM11-1a)
A6ZMR9 2.09e-63 225 31 13 509 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain YJM789)
P32874 2.25e-63 225 31 13 509 1 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8S6N5 2.94e-63 225 27 12 514 3 ACC1 Acetyl-CoA carboxylase 1 Oryza sativa subsp. japonica
C7GRE4 3.27e-63 225 31 13 509 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain JAY291)
C8ZF72 3.8e-63 224 31 13 509 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
F4I1L3 7.9e-63 224 28 12 515 2 ACC2 Acetyl-CoA carboxylase 2 Arabidopsis thaliana
B8D1H3 4.93e-13 75 22 9 301 3 carB Carbamoyl phosphate synthase large chain Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B8D1H3 2.61e-09 63 23 12 348 3 carB Carbamoyl phosphate synthase large chain Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q9PIL7 1.34e-11 70 24 5 239 3 carB Carbamoyl phosphate synthase large chain Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9PIL7 0.000194 47 25 13 327 3 carB Carbamoyl phosphate synthase large chain Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B1I4M8 1.43e-11 70 24 4 233 3 carB Carbamoyl phosphate synthase large chain Desulforudis audaxviator (strain MP104C)
B1I4M8 1.98e-05 50 23 12 330 3 carB Carbamoyl phosphate synthase large chain Desulforudis audaxviator (strain MP104C)
Q1AVY9 4.18e-11 68 26 6 234 3 carB Carbamoyl phosphate synthase large chain Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1AVY9 2.61e-06 53 25 11 327 3 carB Carbamoyl phosphate synthase large chain Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q87SF3 4.63e-11 68 25 3 185 3 carB Carbamoyl phosphate synthase large chain Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87SF3 1.79e-05 51 24 8 239 3 carB Carbamoyl phosphate synthase large chain Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KPH9 6.18e-11 68 23 5 252 3 carB Carbamoyl phosphate synthase large chain Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KPH9 0.000152 48 24 6 235 3 carB Carbamoyl phosphate synthase large chain Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MNU0 9.65e-11 67 25 3 185 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain YJ016)
Q7MNU0 1.86e-05 50 23 7 239 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain YJ016)
Q8DEM2 9.65e-11 67 25 3 185 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain CMCP6)
Q8DEM2 1.86e-05 50 23 7 239 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain CMCP6)
B5XKW2 2e-10 67 23 6 233 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M49 (strain NZ131)
P18185 3.04e-10 66 22 7 245 3 carB Carbamoyl phosphate synthase arginine-specific large chain Bacillus subtilis (strain 168)
P58941 4.67e-10 65 24 5 235 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q9A0C6 4.71e-10 65 24 5 237 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M1
Q5XCR6 4.79e-10 65 24 5 235 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A2RF60 5.18e-10 65 24 5 235 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M5 (strain Manfredo)
B9KXM5 5.59e-10 65 25 6 238 3 carB Carbamoyl phosphate synthase large chain Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q8FLB0 1.08e-09 64 25 3 186 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FLB0 0.000287 47 24 9 279 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63738 1.16e-09 64 25 3 186 3 carB Carbamoyl phosphate synthase large chain Shigella flexneri
P63738 0.000442 46 24 9 279 3 carB Carbamoyl phosphate synthase large chain Shigella flexneri
P63737 1.16e-09 64 25 3 186 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O157:H7
P63737 0.000442 46 24 9 279 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O157:H7
P0DA14 1.17e-09 64 24 5 235 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P00968 1.19e-09 64 25 3 186 1 carB Carbamoyl phosphate synthase large chain Escherichia coli (strain K12)
P00968 0.000454 46 24 9 279 1 carB Carbamoyl phosphate synthase large chain Escherichia coli (strain K12)
Q8Z9L7 1.19e-09 64 25 4 195 3 carB Carbamoyl phosphate synthase large chain Salmonella typhi
Q8Z9L7 0.000246 47 23 9 277 3 carB Carbamoyl phosphate synthase large chain Salmonella typhi
P14846 1.28e-09 64 25 4 195 3 carB Carbamoyl phosphate synthase large chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14846 0.000257 47 23 9 277 3 carB Carbamoyl phosphate synthase large chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q87EB8 1.81e-09 63 22 5 250 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87EB8 2.32e-06 53 25 14 371 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P58939 2.03e-09 63 23 7 245 3 carB Carbamoyl phosphate synthase large chain Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P0DA15 2.07e-09 63 24 5 237 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M3 (strain SSI-1)
Q1IPK2 2.65e-09 63 24 6 253 3 carB Carbamoyl phosphate synthase large chain Koribacter versatilis (strain Ellin345)
Q8U085 3.32e-09 63 24 8 310 3 carB Carbamoyl phosphate synthase large chain Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O28994 8.76e-09 61 22 5 248 3 carB Carbamoyl phosphate synthase large chain Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O28994 9.39e-08 58 26 9 276 3 carB Carbamoyl phosphate synthase large chain Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q0TM79 1.33e-08 61 25 4 171 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TM79 0.000829 45 22 6 235 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8FT42 1.4e-08 60 23 6 248 3 carB Carbamoyl phosphate synthase large chain Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8XHB3 1.42e-08 60 25 4 174 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain 13 / Type A)
Q8XHB3 0.001 45 22 6 235 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain 13 / Type A)
Q0SPY4 1.51e-08 60 25 4 174 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain SM101 / Type A)
Q0SPY4 0.000572 46 22 6 235 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain SM101 / Type A)
C1CR31 1.55e-08 60 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain Taiwan19F-14)
Q97QE4 1.55e-08 60 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04K48 1.55e-08 60 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8CWR0 1.56e-08 60 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B1IC65 1.59e-08 60 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain Hungary19A-6)
B2IQ67 1.62e-08 60 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain CGSP14)
B8ZJT9 1.62e-08 60 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B5E512 1.68e-08 60 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 19F (strain G54)
A0JX72 1.94e-08 60 23 6 238 3 carB Carbamoyl phosphate synthase large chain Arthrobacter sp. (strain FB24)
C1C7Q3 2.03e-08 60 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain 70585)
C1F1S6 2.05e-08 60 22 4 245 3 carB Carbamoyl phosphate synthase large chain Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
C1CEM9 2.08e-08 60 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain JJA)
C1CL09 2.21e-08 60 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain P1031)
A6LPD9 2.64e-08 60 22 9 315 3 carB Carbamoyl phosphate synthase large chain Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q8RSS3 2.93e-08 60 24 11 367 3 carB Carbamoyl phosphate synthase large chain Halomonas eurihalina
Q8RSS3 8.06e-06 52 24 5 177 3 carB Carbamoyl phosphate synthase large chain Halomonas eurihalina
Q8ZIL4 3.07e-08 60 22 5 253 3 carB Carbamoyl phosphate synthase large chain Yersinia pestis
Q9CKV0 3.25e-08 59 22 3 189 3 carB Carbamoyl phosphate synthase large chain Pasteurella multocida (strain Pm70)
Q38X24 3.27e-08 59 22 7 279 3 carB Carbamoyl phosphate synthase large chain Latilactobacillus sakei subsp. sakei (strain 23K)
Q67Q54 3.59e-08 59 21 6 274 3 carB Carbamoyl phosphate synthase large chain Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q67Q54 0.000224 47 24 7 233 3 carB Carbamoyl phosphate synthase large chain Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B2UX86 3.64e-08 59 26 4 175 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Alaska E43 / Type E3)
Q9PEC1 3.65e-08 59 21 5 249 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain 9a5c)
Q8K9Z7 4.01e-08 59 23 6 255 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q7VP67 4.3e-08 59 20 5 253 3 carB Carbamoyl phosphate synthase large chain Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1R6Z3 4.56e-08 59 23 6 238 3 carB Carbamoyl phosphate synthase large chain Paenarthrobacter aurescens (strain TC1)
P27708 4.82e-08 59 23 5 233 1 CAD Multifunctional protein CAD Homo sapiens
C0M756 5.8e-08 58 23 5 240 3 carB Carbamoyl phosphate synthase large chain Streptococcus equi subsp. equi (strain 4047)
A0B8K9 7.89e-08 58 24 11 349 3 carB Carbamoyl phosphate synthase large chain Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
C0MEH1 8.5e-08 58 22 5 240 3 carB Carbamoyl phosphate synthase large chain Streptococcus equi subsp. zooepidemicus (strain H70)
C4ZEK2 1.06e-07 58 20 4 229 3 carB Carbamoyl phosphate synthase large chain Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
B0K4D7 1.46e-07 57 22 10 336 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter sp. (strain X514)
B0K4D7 4.46e-05 49 21 8 270 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter sp. (strain X514)
Q9WZ27 1.84e-07 57 24 7 228 3 carB Carbamoyl phosphate synthase large chain Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WZ27 2.37e-06 53 23 9 337 3 carB Carbamoyl phosphate synthase large chain Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A5IJL8 1.87e-07 57 24 7 228 3 carB Carbamoyl phosphate synthase large chain Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A5IJL8 2.16e-06 53 23 9 337 3 carB Carbamoyl phosphate synthase large chain Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B1L8T8 1.92e-07 57 24 7 228 3 carB Carbamoyl phosphate synthase large chain Thermotoga sp. (strain RQ2)
B1L8T8 1.03e-05 52 22 9 337 3 carB Carbamoyl phosphate synthase large chain Thermotoga sp. (strain RQ2)
Q58776 2.02e-07 57 21 9 324 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
C5CCF1 2.04e-07 57 27 5 177 3 carB Carbamoyl phosphate synthase large chain Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
O67233 2.22e-07 56 23 3 232 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Aquifex aeolicus (strain VF5)
B2RQC6 2.23e-07 57 22 5 233 1 Cad Multifunctional protein CAD Mus musculus
B2RQC6 0.000265 47 22 2 168 1 Cad Multifunctional protein CAD Mus musculus
Q97FT3 2.31e-07 57 21 6 238 3 carB Carbamoyl phosphate synthase large chain Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q834E2 2.33e-07 57 21 4 237 3 carB Carbamoyl phosphate synthase large chain Enterococcus faecalis (strain ATCC 700802 / V583)
P08955 2.37e-07 57 22 5 233 1 CAD Multifunctional protein CAD Mesocricetus auratus
P08955 0.000105 48 21 2 180 1 CAD Multifunctional protein CAD Mesocricetus auratus
Q8ZY48 2.67e-07 57 27 8 233 3 carB Carbamoyl phosphate synthase large chain Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
B8H8U5 2.73e-07 57 23 6 238 3 carB Carbamoyl phosphate synthase large chain Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
A2SQ53 2.86e-07 57 23 4 195 3 carB Carbamoyl phosphate synthase large chain Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
A2SQ53 0.000122 48 23 11 345 3 carB Carbamoyl phosphate synthase large chain Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
C5C687 2.87e-07 57 25 6 195 3 carB Carbamoyl phosphate synthase large chain Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
Q8REV7 3.38e-07 55 23 7 221 3 purD Phosphoribosylamine--glycine ligase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A4TBY6 3.42e-07 56 24 7 243 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium gilvum (strain PYR-GCK)
P38100 4.07e-07 56 25 8 243 3 carB Carbamoyl phosphate synthase large chain Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P38100 1.75e-05 51 23 3 186 3 carB Carbamoyl phosphate synthase large chain Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P57244 4.52e-07 56 21 5 252 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q1IWM0 5.17e-07 55 21 4 243 3 carB Carbamoyl phosphate synthase large chain Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A1T8H1 6.32e-07 55 25 7 243 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
B8DTW3 6.75e-07 55 25 6 190 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium animalis subsp. lactis (strain AD011)
B8DTW3 0.00037 47 23 7 239 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium animalis subsp. lactis (strain AD011)
O27077 6.76e-07 55 24 6 241 3 carB Carbamoyl phosphate synthase large chain Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O27077 0.000445 46 24 12 345 3 carB Carbamoyl phosphate synthase large chain Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9HK17 6.92e-07 55 25 7 219 3 carB Carbamoyl phosphate synthase large chain Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q9HK17 0.000115 48 21 4 209 3 carB Carbamoyl phosphate synthase large chain Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
B9KB91 7.7e-07 55 23 9 337 3 carB Carbamoyl phosphate synthase large chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B9KB91 1.39e-06 54 22 7 240 3 carB Carbamoyl phosphate synthase large chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A6WCC6 8.33e-07 55 24 8 248 3 carB Carbamoyl phosphate synthase large chain Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q7S8A6 8.39e-07 55 20 9 317 1 pyr-3 Multifunctional protein pyr-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q55756 9.86e-07 55 24 11 360 3 carB Carbamoyl phosphate synthase large chain Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55756 3.76e-05 50 22 3 197 3 carB Carbamoyl phosphate synthase large chain Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9JXW8 9.92e-07 55 20 4 243 3 carB Carbamoyl phosphate synthase large chain Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A7GE89 1.14e-06 55 22 6 248 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A7GE89 1.52e-06 54 23 4 178 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B2GI87 1.22e-06 54 23 6 241 3 carB Carbamoyl phosphate synthase large chain Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
B2THH3 1.23e-06 54 25 4 175 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Eklund 17B / Type B)
Q9KXR6 1.24e-06 54 25 7 235 3 carB Carbamoyl phosphate synthase large chain Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
C1FNY3 1.24e-06 54 22 6 248 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Kyoto / Type A2)
C1FNY3 1.83e-06 54 23 4 178 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Kyoto / Type A2)
Q4J8E8 1.3e-06 54 20 2 218 3 carB Carbamoyl phosphate synthase large chain Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q4J8E8 2.76e-05 50 24 11 313 3 carB Carbamoyl phosphate synthase large chain Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P07259 1.33e-06 54 20 5 266 1 URA2 Multifunctional protein URA2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B9DPN2 1.45e-06 54 23 13 338 3 carB Carbamoyl phosphate synthase large chain Staphylococcus carnosus (strain TM300)
Q2FLD9 1.94e-06 54 22 3 185 3 carB Carbamoyl phosphate synthase large chain Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q8YQL2 1.95e-06 54 25 4 192 3 carB Carbamoyl phosphate synthase large chain Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8YQL2 3.66e-06 53 25 7 243 3 carB Carbamoyl phosphate synthase large chain Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A2BJL3 2.34e-06 53 26 9 314 3 carB Carbamoyl phosphate synthase large chain Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
A2BJL3 0.000544 46 21 7 238 3 carB Carbamoyl phosphate synthase large chain Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
Q9JW02 2.38e-06 53 20 4 243 3 carB Carbamoyl phosphate synthase large chain Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P59448 2.46e-06 53 23 4 192 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A6Q6K6 2.71e-06 53 24 12 325 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurovum sp. (strain NBC37-1)
Q42601 2.86e-06 53 26 7 250 1 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Arabidopsis thaliana
Q88DU6 3.22e-06 53 24 13 346 3 carB Carbamoyl phosphate synthase large chain Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9RWK0 3.24e-06 53 23 5 237 3 carB Carbamoyl phosphate synthase large chain Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q5FJC0 3.79e-06 53 20 12 319 3 carB Carbamoyl phosphate synthase large chain Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
P55641 3.91e-06 52 23 7 221 4 NGR_a01790 Uncharacterized protein y4rH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B9DRV7 4.09e-06 53 22 4 176 3 carB Carbamoyl phosphate synthase large chain Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q03LT8 4.24e-06 53 20 8 279 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5F6 4.24e-06 53 20 8 279 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M0W9 4.24e-06 53 20 8 279 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain CNRZ 1066)
Q8RG86 4.5e-06 53 24 9 227 3 carB Carbamoyl phosphate synthase large chain Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q827Q7 4.5e-06 53 25 7 235 3 carB Carbamoyl phosphate synthase large chain Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9ZKT2 4.98e-06 52 26 4 175 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain J99 / ATCC 700824)
Q9ZKT2 7.83e-05 48 24 12 358 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain J99 / ATCC 700824)
O25577 5.29e-06 52 26 4 175 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain ATCC 700392 / 26695)
O25577 0.000637 46 23 12 358 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain ATCC 700392 / 26695)
Q02YG5 5.54e-06 52 22 7 220 3 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. cremoris (strain SK11)
A3CU73 5.93e-06 52 22 3 187 3 carB Carbamoyl phosphate synthase large chain Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
O32771 6.15e-06 52 22 7 220 2 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. cremoris (strain MG1363)
Q8G815 6.39e-06 52 27 6 188 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum (strain NCC 2705)
B3DQ32 6.39e-06 52 27 6 188 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum (strain DJO10A)
C3NH23 6.86e-06 52 23 10 327 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
A8F453 6.88e-06 52 22 11 349 3 carB Carbamoyl phosphate synthase large chain Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A8F453 9.15e-06 52 22 10 318 3 carB Carbamoyl phosphate synthase large chain Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
B7GPW2 7.27e-06 52 27 6 188 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q8DZQ7 7.43e-06 52 20 10 305 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
C3MW21 7.61e-06 52 23 10 327 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3N664 7.61e-06 52 23 10 327 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.27)
B1KT07 7.64e-06 52 23 4 175 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Loch Maree / Type A3)
B1KT07 0.000124 48 20 5 248 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Loch Maree / Type A3)
C4KHM7 7.95e-06 52 23 10 327 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
A3CNI5 9.23e-06 52 19 4 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus sanguinis (strain SK36)
Q970U7 9.29e-06 52 26 7 211 3 carB Carbamoyl phosphate synthase large chain Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q1B9F9 9.32e-06 52 23 6 243 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain MCS)
A1UFK4 9.32e-06 52 23 6 243 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain KMS)
A3PZ65 9.32e-06 52 23 6 243 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain JLS)
Q8F832 9.55e-06 52 22 9 324 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8F832 1.01e-05 52 21 8 247 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NF1 9.55e-06 52 22 9 324 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q72NF1 1.01e-05 52 21 8 247 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A8AX83 9.89e-06 52 19 4 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
C3NEM0 9.96e-06 52 23 10 327 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3MQE3 9.96e-06 52 23 10 327 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
P58942 1.01e-05 52 20 5 250 3 carB Carbamoyl phosphate synthase large chain Xanthomonas axonopodis pv. citri (strain 306)
P58942 0.001 45 23 9 345 3 carB Carbamoyl phosphate synthase large chain Xanthomonas axonopodis pv. citri (strain 306)
Q3K150 1.02e-05 52 20 10 305 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
O67869 1.04e-05 51 25 6 242 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Aquifex aeolicus (strain VF5)
Q9K9V9 1.07e-05 51 21 10 312 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K9V9 1.94e-05 50 22 13 349 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P25994 1.07e-05 51 22 6 236 1 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Bacillus subtilis (strain 168)
P25994 0.000319 47 22 8 261 1 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Bacillus subtilis (strain 168)
Q8E5F5 1.1e-05 51 20 10 305 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype III (strain NEM316)
A5UK38 1.17e-05 50 24 9 242 1 Msm_0361 Carbamoyl-phosphate synthase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q03WW7 1.19e-05 51 22 6 239 3 carB Carbamoyl phosphate synthase large chain Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q8KBV8 1.22e-05 51 24 7 233 3 purD Phosphoribosylamine--glycine ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q9CCR2 1.33e-05 51 23 6 238 3 carB Carbamoyl phosphate synthase large chain Mycobacterium leprae (strain TN)
Q72IA9 1.39e-05 50 25 6 220 3 ddl D-alanine--D-alanine ligase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B1HQC1 1.47e-05 51 21 6 221 3 carB Carbamoyl phosphate synthase large chain Lysinibacillus sphaericus (strain C3-41)
B1HQC1 0.000129 48 23 7 233 3 carB Carbamoyl phosphate synthase large chain Lysinibacillus sphaericus (strain C3-41)
A4VIT1 1.54e-05 50 24 7 235 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Stutzerimonas stutzeri (strain A1501)
Q8RBK0 1.57e-05 51 23 10 314 3 carB Carbamoyl phosphate synthase large chain Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RBK0 0.000127 48 20 8 312 3 carB Carbamoyl phosphate synthase large chain Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P58943 1.6e-05 51 24 2 133 3 carB Carbamoyl phosphate synthase large chain Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A9WSA8 1.6e-05 51 24 5 181 3 carB Carbamoyl phosphate synthase large chain Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
B1MZ74 1.65e-05 51 22 7 235 3 carB Carbamoyl phosphate synthase large chain Leuconostoc citreum (strain KM20)
C1CXR4 1.68e-05 51 20 4 240 3 carB Carbamoyl phosphate synthase large chain Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
B0KBW4 1.78e-05 51 22 9 314 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0KBW4 0.000324 47 21 8 270 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A5UKG5 1.79e-05 51 25 5 182 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A5UKG5 8.87e-05 48 24 7 211 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q74J34 1.84e-05 51 24 4 175 3 carB Carbamoyl phosphate synthase large chain Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q469Z7 1.91e-05 50 22 4 220 3 carB Carbamoyl phosphate synthase large chain Methanosarcina barkeri (strain Fusaro / DSM 804)
A1A0T4 1.98e-05 50 25 6 184 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
B1YIR9 2.03e-05 50 20 5 239 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q5HPY8 2.11e-05 50 21 6 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HPY8 6.06e-05 49 20 6 235 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P96495 2.12e-05 50 22 5 222 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q59969 2.15e-05 50 23 10 327 3 carB Carbamoyl phosphate synthase large chain Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q8CPJ4 2.17e-05 50 21 6 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CPJ4 5.76e-05 49 20 6 235 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8DUP3 2.37e-05 50 19 7 280 3 carB Carbamoyl phosphate synthase large chain Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q87WP4 2.54e-05 50 23 12 333 3 carB Carbamoyl phosphate synthase large chain Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87WP4 3.92e-05 50 22 2 174 3 carB Carbamoyl phosphate synthase large chain Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B1I3W6 2.61e-05 49 23 7 219 3 ddl D-alanine--D-alanine ligase Desulforudis audaxviator (strain MP104C)
Q9CFV2 2.7e-05 50 21 10 295 3 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. lactis (strain IL1403)
Q5SKN1 2.87e-05 50 22 5 222 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A5D508 2.93e-05 50 22 5 198 3 carB Carbamoyl phosphate synthase large chain Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B2A170 3.46e-05 50 25 4 164 3 carB Carbamoyl phosphate synthase large chain Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B2A170 0.000827 45 21 12 316 3 carB Carbamoyl phosphate synthase large chain Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q03HB0 3.71e-05 50 20 10 313 3 carB Carbamoyl phosphate synthase large chain Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q9ZB63 4.07e-05 50 20 7 292 3 carB Carbamoyl phosphate synthase arginine-specific large chain Geobacillus stearothermophilus
C1A4I5 4.07e-05 50 24 2 177 3 carB Carbamoyl phosphate synthase large chain Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
C1A4I5 0.000855 45 25 7 241 3 carB Carbamoyl phosphate synthase large chain Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
A1VT89 4.24e-05 49 23 11 327 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Polaromonas naphthalenivorans (strain CJ2)
Q2SZW6 4.7e-05 49 23 13 384 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
C4L8J2 5.06e-05 48 26 8 225 3 ddl D-alanine--D-alanine ligase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A5IKG2 5.13e-05 48 25 6 149 3 ddl D-alanine--D-alanine ligase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q8FMB3 5.48e-05 48 22 9 335 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P13258 5.54e-05 48 21 3 183 3 carB Carbamoyl phosphate synthase large chain (Fragment) Methanosarcina barkeri
Q1D6Y8 5.69e-05 49 24 2 165 3 carB Carbamoyl phosphate synthase large chain Myxococcus xanthus (strain DK1622)
Q1D6Y8 0.00013 48 24 13 319 3 carB Carbamoyl phosphate synthase large chain Myxococcus xanthus (strain DK1622)
B9EXM2 5.72e-05 49 24 13 372 2 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Oryza sativa subsp. japonica
Q46KI4 5.91e-05 48 21 12 338 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL2A)
A7GRL1 6.13e-05 49 22 11 308 3 carB Carbamoyl phosphate synthase large chain Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A7GRL1 0.000416 46 21 6 238 3 carB Carbamoyl phosphate synthase large chain Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q4L5Q5 6.5e-05 49 21 6 235 3 carB Carbamoyl phosphate synthase large chain Staphylococcus haemolyticus (strain JCSC1435)
Q7M8I0 6.63e-05 48 24 8 237 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q97AJ3 6.65e-05 49 20 13 340 3 carB Carbamoyl phosphate synthase large chain Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q6GHN2 6.96e-05 49 20 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MRSA252)
Q8CPP2 7.24e-05 48 24 9 224 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQA5 7.43e-05 48 24 9 224 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q49WY4 7.53e-05 48 20 6 237 3 carB Carbamoyl phosphate synthase large chain Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6GI19 7.82e-05 48 24 7 190 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus aureus (strain MRSA252)
A9VTC6 7.95e-05 48 22 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus mycoides (strain KBAB4)
A9VTC6 0.000153 48 21 7 238 3 carB Carbamoyl phosphate synthase large chain Bacillus mycoides (strain KBAB4)
P58940 7.99e-05 48 20 7 230 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MW2)
A8Z3P0 8.27e-05 48 20 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain USA300 / TCH1516)
Q6GA10 8.27e-05 48 20 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MSSA476)
A6QGA4 8.27e-05 48 20 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Newman)
Q5HGM9 8.27e-05 48 20 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain COL)
Q2FZ72 8.27e-05 48 20 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHN5 8.27e-05 48 20 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain USA300)
P63740 8.35e-05 48 20 8 250 1 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain N315)
P63740 0.001 45 21 6 234 1 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain N315)
P63739 8.35e-05 48 20 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu50 / ATCC 700699)
P63739 0.001 45 21 6 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IS88 8.35e-05 48 20 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH9)
A5IS88 0.001 45 21 6 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH9)
A6U122 8.35e-05 48 20 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH1)
A6U122 0.001 45 21 6 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH1)
A7X1F4 8.35e-05 48 20 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7X1F4 0.001 45 21 6 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu3 / ATCC 700698)
B1W463 8.64e-05 48 25 8 236 3 carB Carbamoyl phosphate synthase large chain Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A7I6J1 9.66e-05 48 22 3 179 3 carB Carbamoyl phosphate synthase large chain Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
A7I6J1 0.000231 47 25 10 310 3 carB Carbamoyl phosphate synthase large chain Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q12FU8 0.000101 48 23 10 334 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q7UJ58 0.000101 48 22 10 322 3 carB Carbamoyl phosphate synthase large chain Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
P20054 0.000114 48 23 5 190 1 pyr1-3 Multifunctional protein pyr1-3 Dictyostelium discoideum
B8GEA3 0.000122 48 23 10 317 3 carB Carbamoyl phosphate synthase large chain Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
B8GEA3 0.001 45 21 5 206 3 carB Carbamoyl phosphate synthase large chain Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
O66949 0.000135 47 22 10 297 1 purD Phosphoribosylamine--glycine ligase Aquifex aeolicus (strain VF5)
B1L9P4 0.000136 47 24 6 149 3 ddl D-alanine--D-alanine ligase Thermotoga sp. (strain RQ2)
P46805 0.000136 47 24 6 149 3 ddl D-alanine--D-alanine ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q09794 0.000151 48 22 3 172 1 ura1 Multifunctional protein ura1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q142Q7 0.000159 47 22 11 303 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Paraburkholderia xenovorans (strain LB400)
P0C017 0.000167 47 25 8 213 2 ADE2 Phosphoribosylaminoimidazole carboxylase Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q732I3 0.000171 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ATCC 10987 / NRS 248)
A8YVZ3 0.000175 47 19 10 313 3 carB Carbamoyl phosphate synthase large chain Lactobacillus helveticus (strain DPC 4571)
B7H6M2 0.000187 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain B4264)
Q047M8 0.00019 47 19 10 313 3 carB Carbamoyl phosphate synthase large chain Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
B3WEF5 0.000191 47 24 8 233 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus casei (strain BL23)
P0CQ37 0.000193 47 25 10 215 3 ADE2 Phosphoribosylaminoimidazole carboxylase Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q038Z2 0.000195 47 24 8 233 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8XZ83 0.000199 47 21 6 247 3 carB Carbamoyl phosphate synthase large chain Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A9KI94 0.000202 47 20 10 330 3 carB Carbamoyl phosphate synthase large chain Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A4SN40 0.000202 47 24 7 223 3 ddl D-alanine--D-alanine ligase Aeromonas salmonicida (strain A449)
Q819S3 0.000204 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
C1EPQ0 0.000205 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain 03BB102)
B7IUP6 0.000205 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain G9842)
B7IUP6 0.000224 47 21 7 238 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain G9842)
Q81WF2 0.000205 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis
A0RHQ8 0.000205 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus thuringiensis (strain Al Hakam)
C3L740 0.000205 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P656 0.000205 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis (strain A0248)
Q1WVA9 0.000212 47 22 3 192 3 carB Carbamoyl phosphate synthase large chain Ligilactobacillus salivarius (strain UCC118)
P46537 0.000212 47 22 6 235 3 carB Carbamoyl phosphate synthase large chain Bacillus caldolyticus
Q636E0 0.000214 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ZK / E33L)
B7JJX3 0.000226 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain AH820)
A0KKW8 0.000231 46 24 5 222 1 ddl D-alanine--D-alanine ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A1WYU0 0.000231 46 25 7 182 3 ddl D-alanine--D-alanine ligase Halorhodospira halophila (strain DSM 244 / SL1)
A5GX22 0.000232 47 26 7 188 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain RCC307)
Q71YI1 0.000238 47 21 8 232 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4b (strain F2365)
Q2YXG5 0.000241 47 20 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YXG5 0.001 45 21 6 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q92AH3 0.000242 47 21 8 232 3 carB Carbamoyl phosphate synthase large chain Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q6HES8 0.000242 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HES8 0.000395 46 21 6 238 3 carB Carbamoyl phosphate synthase large chain Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1KWD4 0.000246 47 21 8 232 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4b (strain CLIP80459)
B9IVW3 0.000246 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain Q1)
B7HLM0 0.000246 47 21 11 311 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain AH187)
Q9RLS9 0.000248 47 21 6 237 3 carB1 Carbamoyl phosphate synthase arginine-specific large chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9LCT6 0.000249 46 24 7 213 1 ddlB D-alanine--D-alanine ligase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B8DDR7 0.00025 47 21 8 232 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4a (strain HCC23)
Q0SEI4 0.000256 47 22 10 331 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Rhodococcus jostii (strain RHA1)
Q5SHZ3 0.00026 46 25 6 226 1 ddl D-alanine--D-alanine ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q7U054 0.000332 47 23 6 234 3 carB Carbamoyl phosphate synthase large chain Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q04H29 0.000353 47 20 10 314 3 carB Carbamoyl phosphate synthase large chain Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q58881 0.000367 46 23 11 326 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O50302 0.000369 47 22 6 235 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Geobacillus stearothermophilus
O50302 0.00043 46 22 6 224 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Geobacillus stearothermophilus
Q63VY4 0.000377 46 23 13 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain K96243)
Q3JUJ4 0.000377 46 23 13 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 1710b)
A3NT04 0.000377 46 23 13 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 1106a)
Q91437 0.000405 47 19 6 242 2 CAD Multifunctional protein CAD Squalus acanthias
Q91437 0.000683 46 21 10 317 2 CAD Multifunctional protein CAD Squalus acanthias
P05990 0.000429 46 23 7 199 1 r Multifunctional protein r Drosophila melanogaster
P0CQ36 0.000469 46 34 0 73 3 ADE2 Phosphoribosylaminoimidazole carboxylase Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q9HWI0 0.000479 45 22 8 236 1 ddlA D-alanine--D-alanine ligase A Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8D2R3 0.000493 45 22 7 214 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wigglesworthia glossinidia brevipalpis
C5CP83 0.000546 45 22 11 327 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Variovorax paradoxus (strain S110)
C4L5W3 0.000558 46 25 7 184 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
P9WPK3 0.000597 46 23 7 234 1 carB Carbamoyl phosphate synthase large chain Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPK2 0.000597 46 23 7 234 3 carB Carbamoyl phosphate synthase large chain Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O93937 0.000639 46 21 3 175 3 pyrABCN Multifunctional protein pyrABCN Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q3BW63 0.00064 45 22 11 353 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A0AJU0 0.00068 45 21 8 232 3 carB Carbamoyl phosphate synthase large chain Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A2C2S8 0.000682 45 23 7 186 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL1A)
B9EB69 0.000715 45 22 6 235 3 carB Carbamoyl phosphate synthase large chain Macrococcus caseolyticus (strain JCSC5402)
Q6F705 0.000771 45 25 8 202 3 ddl D-alanine--D-alanine ligase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B2GD06 0.000835 45 20 3 192 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
P77886 0.000864 45 19 8 301 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A6UUH1 0.000887 45 21 8 323 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
A1V2C2 0.001 45 23 13 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain SAVP1)
Q62IF4 0.001 45 23 13 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain ATCC 23344)
A2S4F3 0.001 45 23 13 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain NCTC 10229)
A3MI07 0.001 45 23 13 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain NCTC 10247)
A3N7B6 0.001 45 23 13 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 668)
Q7VBB3 0.001 45 22 5 187 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P81185 0.001 40 60 0 28 1 None Propionyl-CoA carboxylase alpha chain (Fragment) Myxococcus xanthus
Q72V31 0.001 45 23 10 254 3 purD Phosphoribosylamine--glycine ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_07170
Feature type CDS
Gene accC
Product acetyl-CoA carboxylase biotin carboxylase subunit
Location 171444 - 172793 (strand: -1)
Length 1350 (nucleotides) / 449 (amino acids)

Contig

Accession ZDB_216
Length 269970 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_250
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00289 Biotin carboxylase, N-terminal domain
PF02785 Biotin carboxylase C-terminal domain
PF02786 Carbamoyl-phosphate synthase L chain, ATP binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4770 Lipid transport and metabolism (I) I Acetyl/propionyl-CoA carboxylase, alpha subunit

Kegg Ortholog Annotation(s)

Protein Sequence

MLEKILIANRGEIALRILRACKELGIKAVAVHSSADRDLKHVLLADETICIGPAASAKSYLNIPAIISAAEISGAQAIHPGYGFLSENADFAEQVERSGFTFIGPKAETIRLMGDKVSAIRAMKETGVPCVPGSDGPLSDDMPLNHTIAKRIGFPVIIKASGGGGGRGMRVVRNDEDLEEAIAMTKAEAKAAFNNDMVYMEKFLENPRHVEIQVMADGQGHAVYLAERDCSMQRRHQKVVEEAPAPGITPALRKSIGERCAKACIDIGYRGAGTFEFLFENGEFYFIEMNTRIQVEHPVTEMITGVDLIKEQLRVASGLPLSVKQEDIKVKGHAIECRINAEDPHTFLPSPGKITRFHSPGGFGVRWESHIYAGYTVPPYYDSMIGKLITYGETREIAIARMKNALAELIIDGIKTNIELHQLIMNDENFCKGGTNIHYLEKKLGLHEV

Flanking regions ( +/- flanking 50bp)

GCTGTCGAATTTGACGAGCCACTGGTCGTCATCGAATAACGGGGCGAATCATGCTGGAAAAAATCCTTATTGCCAACCGGGGTGAAATTGCACTGCGGATCCTGCGGGCCTGTAAAGAGCTCGGGATCAAAGCGGTTGCTGTTCACTCTTCTGCGGATCGTGATTTAAAACACGTTCTGCTGGCTGACGAGACCATCTGTATCGGTCCGGCAGCCTCTGCGAAAAGTTATCTGAATATCCCGGCCATTATCTCTGCTGCTGAAATTTCCGGCGCACAGGCCATCCACCCGGGGTACGGATTCTTATCTGAAAACGCTGATTTTGCCGAGCAGGTTGAACGCTCCGGCTTCACGTTTATCGGCCCGAAAGCTGAAACCATCCGCCTGATGGGCGACAAAGTTTCTGCTATCCGTGCGATGAAAGAAACCGGCGTTCCGTGTGTGCCGGGCTCTGACGGCCCGCTCAGCGACGATATGCCGCTGAACCACACCATTGCCAAACGTATCGGTTTCCCGGTCATCATCAAAGCCTCCGGCGGCGGCGGCGGACGCGGTATGCGCGTTGTCCGCAATGATGAAGATCTGGAAGAAGCGATTGCAATGACCAAAGCCGAAGCCAAAGCGGCTTTCAACAACGACATGGTTTACATGGAAAAATTCCTTGAGAACCCGCGTCACGTTGAAATCCAGGTTATGGCGGATGGTCAGGGCCATGCTGTTTATCTGGCGGAACGCGACTGCTCCATGCAGCGCCGTCACCAGAAAGTGGTGGAAGAAGCCCCTGCACCGGGTATCACTCCGGCGCTGCGCAAAAGCATCGGCGAACGCTGTGCCAAAGCCTGTATCGATATCGGCTACCGTGGTGCCGGTACCTTTGAGTTCCTGTTTGAAAACGGTGAGTTCTATTTCATCGAAATGAACACCCGTATTCAGGTAGAGCACCCGGTCACTGAAATGATCACCGGTGTTGACCTGATCAAAGAGCAGCTGCGTGTCGCATCCGGCCTGCCGCTCTCTGTGAAACAGGAAGATATCAAAGTAAAAGGTCACGCGATCGAATGCCGTATAAACGCCGAAGATCCGCACACCTTCTTACCGAGCCCGGGCAAAATTACCCGCTTCCACTCTCCGGGTGGTTTCGGTGTCCGCTGGGAGTCTCATATTTACGCCGGTTATACTGTACCGCCGTATTATGATTCAATGATCGGTAAGCTCATCACCTATGGTGAAACCCGCGAAATTGCTATCGCCCGTATGAAGAATGCGCTGGCGGAACTGATTATCGACGGTATCAAAACCAATATCGAGCTGCACCAGCTGATTATGAATGATGAGAACTTCTGTAAAGGCGGCACCAACATCCATTATCTGGAGAAGAAACTCGGCCTGCACGAGGTCTGATTTTCTGTCGCTTTTCTTTCTCAGGCCCCTGTCAAACAGGGGCTTTTTTA