Homologs in group_250

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03365 FBDBKF_03365 96.2 Morganella morganii S1 accC acetyl-CoA carboxylase biotin carboxylase subunit
EHELCC_07170 EHELCC_07170 96.2 Morganella morganii S2 accC acetyl-CoA carboxylase biotin carboxylase subunit
NLDBIP_07495 NLDBIP_07495 96.2 Morganella morganii S4 accC acetyl-CoA carboxylase biotin carboxylase subunit
LHKJJB_07030 LHKJJB_07030 96.2 Morganella morganii S3 accC acetyl-CoA carboxylase biotin carboxylase subunit
HKOGLL_03900 HKOGLL_03900 96.2 Morganella morganii S5 accC acetyl-CoA carboxylase biotin carboxylase subunit
PMI_RS17705 PMI_RS17705 47.2 Proteus mirabilis HI4320 - biotin carboxylase N-terminal domain-containing protein
PMI_RS18045 PMI_RS18045 88.0 Proteus mirabilis HI4320 accC acetyl-CoA carboxylase biotin carboxylase subunit

Distribution of the homologs in the orthogroup group_250

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_250

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P24182 0.0 779 85 0 448 1 accC Biotin carboxylase Escherichia coli (strain K12)
Q8X9B6 0.0 778 84 0 448 3 accC Biotin carboxylase Escherichia coli O157:H7
P43873 0.0 753 81 0 448 1 accC Biotin carboxylase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O52058 0.0 663 72 0 446 3 accC Biotin carboxylase Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
P37798 0.0 657 68 0 446 1 accC Biotin carboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q06862 2.11e-177 506 56 3 443 3 accC Biotin carboxylase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q58626 1.55e-176 506 56 2 445 1 pycA Pyruvate carboxylase subunit A Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P49787 2.48e-175 501 56 3 444 3 accC1 Biotin carboxylase 1 Bacillus subtilis (strain 168)
O27939 1.21e-173 498 54 2 443 1 pycA Pyruvate carboxylase subunit A Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O04983 8.01e-168 485 54 3 442 1 CAC2 Biotin carboxylase, chloroplastic Arabidopsis thaliana
B9HBA8 4.21e-167 483 54 3 442 2 POPTRDRAFT_831870 Biotin carboxylase 1, chloroplastic Populus trichocarpa
O30019 6.24e-166 479 53 1 443 3 pycA Pyruvate carboxylase subunit A Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
B9N843 1.53e-164 477 53 3 442 2 POPTR_0018s14250g Biotin carboxylase 2, chloroplastic Populus trichocarpa
Q9KDS9 1.03e-149 436 50 3 446 3 accC Biotin carboxylase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O34544 3.84e-145 424 50 2 445 3 accC2 Biotin carboxylase 2 Bacillus subtilis (strain 168)
I3R7G3 5.86e-144 427 48 2 445 1 pccA Propionyl-CoA carboxylase, biotin carboxylase and biotin-carboxyl carrier subunit Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
P9WPQ3 1.57e-141 422 47 7 450 1 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPQ2 1.57e-141 422 47 7 450 3 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A509 1.57e-141 422 47 7 450 3 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
D3DJ42 4.38e-140 412 50 4 444 1 cfiB 2-oxoglutarate carboxylase small subunit Hydrogenobacter thermophilus (strain DSM 6534 / IAM 12695 / TK-6)
P0DTA4 8.59e-139 418 48 6 444 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Sus scrofa
Q2QMG2 1.07e-137 415 46 4 445 2 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Oryza sativa subsp. japonica
Q54KE6 1.54e-137 414 49 4 435 3 mccA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Dictyostelium discoideum
P05165 2.7e-137 414 48 5 443 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Homo sapiens
Q96RQ3 9.15e-137 412 48 4 422 1 MCCC1 Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Homo sapiens
Q5I0C3 1.6e-136 411 46 4 442 1 Mccc1 Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Rattus norvegicus
Q42523 9.6e-136 410 47 6 449 1 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Arabidopsis thaliana
Q42777 1.92e-135 409 47 3 443 1 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Glycine max
Q99MR8 2.35e-135 409 46 4 442 1 Mccc1 Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Mus musculus
Q91ZA3 1.04e-134 407 47 6 444 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Mus musculus
Q9KWU4 3.42e-134 417 47 5 449 1 pyc Pyruvate carboxylase Bacillus subtilis (strain 168)
P14882 2.53e-133 404 47 6 444 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Rattus norvegicus
Q19842 1.17e-132 402 46 5 444 1 pcca-1 Propionyl-CoA carboxylase alpha chain, mitochondrial Caenorhabditis elegans
Q612F5 1.93e-130 397 46 4 443 3 pcca-1 Propionyl-CoA carboxylase alpha chain, mitochondrial Caenorhabditis briggsae
Q5LUF3 4.05e-130 394 44 5 463 1 pccA Propionyl-CoA carboxylase alpha chain Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A0A0H3JRU9 1.14e-123 389 43 5 457 1 pycA Pyruvate carboxylase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q05920 4.53e-119 378 44 7 455 1 Pc Pyruvate carboxylase, mitochondrial Mus musculus
Q29RK2 4.3e-118 375 44 7 455 2 PC Pyruvate carboxylase, mitochondrial Bos taurus
P11498 1.31e-117 374 44 7 455 1 PC Pyruvate carboxylase, mitochondrial Homo sapiens
P52873 1.79e-117 374 44 7 455 1 Pc Pyruvate carboxylase, mitochondrial Rattus norvegicus
P46392 1.32e-113 349 45 4 428 3 bccA Biotin-dependent acyl-coenzyme A carboxylase alpha3 subunit Mycobacterium leprae (strain TN)
P96890 7.03e-112 344 45 6 443 1 accA3 Biotin-dependent acyl-coenzyme A carboxylase alpha3 subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5H0J2 1.29e-105 347 42 4 432 3 DUR1,2 Urea amidolyase Lachancea kluyveri
O17732 1.37e-104 339 43 8 451 1 pyc-1 Pyruvate carboxylase 1 Caenorhabditis elegans
P32327 3.55e-104 338 45 6 439 1 PYC2 Pyruvate carboxylase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32528 5.14e-104 342 39 4 443 1 DUR1,2 Urea amidolyase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0CLK1 2.4e-102 333 44 6 449 3 pyc Pyruvate carboxylase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
O93918 2.98e-102 333 44 6 449 2 pyc Pyruvate carboxylase Aspergillus terreus
Q8X1T3 3.43e-102 332 44 6 455 3 PYC Pyruvate carboxylase Pichia angusta
P11154 8.58e-101 328 44 7 455 1 PYC1 Pyruvate carboxylase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9HES8 3.52e-100 327 44 6 449 3 pyc Pyruvate carboxylase Aspergillus niger
Q9UUE1 2.17e-99 325 41 6 457 3 pyr1 Pyruvate carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78992 1.99e-96 317 44 7 445 3 PYC1 Pyruvate carboxylase Komagataella pastoris
P38095 2.51e-91 303 37 9 461 2 lamA Putative urea carboxylase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54J08 1.55e-68 240 31 12 506 3 accA Acetyl-CoA carboxylase Dictyostelium discoideum
P11029 1.26e-67 238 31 11 505 1 ACAC Acetyl-CoA carboxylase Gallus gallus
Q13085 1.07e-66 235 30 10 504 1 ACACA Acetyl-CoA carboxylase 1 Homo sapiens
Q5SWU9 1.14e-66 235 30 10 504 1 Acaca Acetyl-CoA carboxylase 1 Mus musculus
Q28559 3e-66 233 30 10 504 2 ACACA Acetyl-CoA carboxylase 1 Ovis aries
Q9TTS3 4.79e-66 233 30 10 504 2 ACACA Acetyl-CoA carboxylase 1 Bos taurus
O00763 5.19e-65 230 31 12 507 1 ACACB Acetyl-CoA carboxylase 2 Homo sapiens
P11497 1.36e-64 229 30 10 504 1 Acaca Acetyl-CoA carboxylase 1 Rattus norvegicus
Q00955 1.68e-64 228 30 12 516 1 ACC1 Acetyl-CoA carboxylase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B9FK36 2.05e-64 228 29 14 515 3 ACC2 Acetyl-CoA carboxylase 2 Oryza sativa subsp. japonica
Q38970 2.44e-64 228 28 10 512 1 ACC1 Acetyl-CoA carboxylase 1 Arabidopsis thaliana
E9Q4Z2 3.27e-64 228 30 11 505 1 Acacb Acetyl-CoA carboxylase 2 Mus musculus
Q8S6N5 6.4e-64 227 27 10 511 3 ACC1 Acetyl-CoA carboxylase 1 Oryza sativa subsp. japonica
F4I1L3 5.55e-63 224 27 10 512 2 ACC2 Acetyl-CoA carboxylase 2 Arabidopsis thaliana
A0A4P8DJE6 9.33e-63 223 31 15 523 3 dmxL1 Acetyl-CoA carboxylase dmxL1 Cryptosporiopsis sp. (strain 8999)
P78820 1.87e-62 223 30 13 518 1 cut6 Acetyl-CoA carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B3LM95 5.65e-61 218 30 13 513 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain RM11-1a)
P32874 7.37e-61 218 30 13 513 1 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZMR9 7.66e-61 218 30 13 513 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain YJM789)
C8ZF72 1e-60 218 30 13 513 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
C7GRE4 1.19e-60 217 30 13 513 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain JAY291)
B8D1H3 2.35e-14 79 23 9 300 3 carB Carbamoyl phosphate synthase large chain Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B8D1H3 3.76e-07 56 21 11 329 3 carB Carbamoyl phosphate synthase large chain Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
P14846 3e-12 72 24 5 253 3 carB Carbamoyl phosphate synthase large chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z9L7 3.03e-12 72 24 5 253 3 carB Carbamoyl phosphate synthase large chain Salmonella typhi
Q9PIL7 3.89e-12 72 25 5 239 3 carB Carbamoyl phosphate synthase large chain Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9KPH9 4.82e-12 72 24 5 252 3 carB Carbamoyl phosphate synthase large chain Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KPH9 0.000146 48 24 6 235 3 carB Carbamoyl phosphate synthase large chain Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87SF3 4.95e-12 72 23 7 299 3 carB Carbamoyl phosphate synthase large chain Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87SF3 0.00017 47 23 7 239 3 carB Carbamoyl phosphate synthase large chain Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MNU0 1.04e-11 70 25 5 252 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain YJ016)
Q7MNU0 0.000166 48 23 7 239 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain YJ016)
Q8DEM2 1.04e-11 70 25 5 252 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain CMCP6)
Q8DEM2 0.000166 48 23 7 239 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain CMCP6)
Q8FLB0 2.01e-11 70 24 5 244 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P00968 2.76e-11 69 24 5 244 1 carB Carbamoyl phosphate synthase large chain Escherichia coli (strain K12)
P63738 3.34e-11 69 24 5 244 3 carB Carbamoyl phosphate synthase large chain Shigella flexneri
P63737 3.34e-11 69 24 5 244 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O157:H7
P58939 1.66e-10 67 27 5 193 3 carB Carbamoyl phosphate synthase large chain Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B1I4M8 5.45e-10 65 23 4 233 3 carB Carbamoyl phosphate synthase large chain Desulforudis audaxviator (strain MP104C)
B1I4M8 7.6e-06 52 23 13 330 3 carB Carbamoyl phosphate synthase large chain Desulforudis audaxviator (strain MP104C)
Q8ZIL4 7.92e-10 65 23 5 253 3 carB Carbamoyl phosphate synthase large chain Yersinia pestis
Q9CKV0 9.66e-10 64 24 3 189 3 carB Carbamoyl phosphate synthase large chain Pasteurella multocida (strain Pm70)
Q8FT42 1.47e-09 64 27 4 179 3 carB Carbamoyl phosphate synthase large chain Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q87EB8 2.14e-09 63 22 5 250 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87EB8 4.95e-05 49 23 13 357 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P18185 2.47e-09 63 22 7 245 3 carB Carbamoyl phosphate synthase arginine-specific large chain Bacillus subtilis (strain 168)
Q67Q54 4.26e-09 62 22 6 274 3 carB Carbamoyl phosphate synthase large chain Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q67Q54 0.000471 46 23 7 233 3 carB Carbamoyl phosphate synthase large chain Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8K9Z7 7.37e-09 62 24 8 255 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q1IPK2 1.18e-08 61 24 6 253 3 carB Carbamoyl phosphate synthase large chain Koribacter versatilis (strain Ellin345)
P58943 1.48e-08 60 23 5 250 3 carB Carbamoyl phosphate synthase large chain Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q834E2 1.65e-08 60 22 5 253 3 carB Carbamoyl phosphate synthase large chain Enterococcus faecalis (strain ATCC 700802 / V583)
Q9PEC1 1.99e-08 60 22 5 249 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain 9a5c)
Q8RSS3 2.26e-08 60 23 6 247 3 carB Carbamoyl phosphate synthase large chain Halomonas eurihalina
Q8RSS3 4.25e-07 56 23 11 367 3 carB Carbamoyl phosphate synthase large chain Halomonas eurihalina
O28994 2.3e-08 60 22 5 254 3 carB Carbamoyl phosphate synthase large chain Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O28994 7.39e-06 52 25 9 276 3 carB Carbamoyl phosphate synthase large chain Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
C4ZEK2 2.69e-08 60 22 4 229 3 carB Carbamoyl phosphate synthase large chain Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
O27077 5.19e-08 59 24 7 253 3 carB Carbamoyl phosphate synthase large chain Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O27077 0.000216 47 24 12 345 3 carB Carbamoyl phosphate synthase large chain Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9WZ27 5.28e-08 59 25 7 228 3 carB Carbamoyl phosphate synthase large chain Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WZ27 4.52e-05 49 22 9 337 3 carB Carbamoyl phosphate synthase large chain Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B1L8T8 5.33e-08 59 25 7 228 3 carB Carbamoyl phosphate synthase large chain Thermotoga sp. (strain RQ2)
B1L8T8 2.17e-05 50 22 9 337 3 carB Carbamoyl phosphate synthase large chain Thermotoga sp. (strain RQ2)
A5IJL8 5.42e-08 59 23 8 259 3 carB Carbamoyl phosphate synthase large chain Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A5IJL8 4.4e-05 49 22 9 337 3 carB Carbamoyl phosphate synthase large chain Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A6LPD9 7.29e-08 58 22 8 308 3 carB Carbamoyl phosphate synthase large chain Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A6WCC6 8.37e-08 58 25 9 249 3 carB Carbamoyl phosphate synthase large chain Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
B8DTW3 9.6e-08 58 26 6 193 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium animalis subsp. lactis (strain AD011)
B1IC65 1.04e-07 58 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain Hungary19A-6)
Q9JXW8 1.07e-07 58 22 4 243 3 carB Carbamoyl phosphate synthase large chain Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8CWR0 1.07e-07 58 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q1AVY9 1.08e-07 58 23 5 233 3 carB Carbamoyl phosphate synthase large chain Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1AVY9 8.38e-06 52 25 11 327 3 carB Carbamoyl phosphate synthase large chain Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q7VP67 1.09e-07 58 21 5 253 3 carB Carbamoyl phosphate synthase large chain Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B2IQ67 1.1e-07 58 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain CGSP14)
B8ZJT9 1.1e-07 58 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1CR31 1.14e-07 58 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain Taiwan19F-14)
Q97QE4 1.14e-07 58 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B5E512 1.14e-07 58 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 19F (strain G54)
Q04K48 1.14e-07 58 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9A0C6 1.36e-07 57 22 7 240 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M1
Q9ZB63 1.4e-07 57 22 7 265 3 carB Carbamoyl phosphate synthase arginine-specific large chain Geobacillus stearothermophilus
C1CL09 1.41e-07 57 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain P1031)
C1CEM9 1.42e-07 57 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain JJA)
P58941 1.52e-07 57 22 7 240 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M18 (strain MGAS8232)
C1C7Q3 1.53e-07 57 21 5 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain 70585)
A2RF60 1.57e-07 57 22 7 240 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M5 (strain Manfredo)
Q5XCR6 1.57e-07 57 22 7 240 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
B5XKW2 1.67e-07 57 21 6 233 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M49 (strain NZ131)
Q58776 2.11e-07 57 22 8 324 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
C0M756 2.33e-07 57 23 5 240 3 carB Carbamoyl phosphate synthase large chain Streptococcus equi subsp. equi (strain 4047)
B9KXM5 2.34e-07 57 23 8 260 3 carB Carbamoyl phosphate synthase large chain Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q9JW02 2.44e-07 57 21 4 243 3 carB Carbamoyl phosphate synthase large chain Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P57244 2.76e-07 57 21 6 252 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
C1F1S6 3.07e-07 56 21 4 245 3 carB Carbamoyl phosphate synthase large chain Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
A2SQ53 3.43e-07 56 23 4 195 3 carB Carbamoyl phosphate synthase large chain Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
P0DA14 3.47e-07 56 22 7 240 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q0SPY4 3.92e-07 56 23 5 181 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain SM101 / Type A)
P07259 4.01e-07 56 21 5 266 1 URA2 Multifunctional protein URA2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8XHB3 4.03e-07 56 23 5 181 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain 13 / Type A)
P58942 5.15e-07 55 23 6 247 3 carB Carbamoyl phosphate synthase large chain Xanthomonas axonopodis pv. citri (strain 306)
P27708 5.24e-07 56 22 5 233 1 CAD Multifunctional protein CAD Homo sapiens
P27708 5.8e-05 49 21 2 180 1 CAD Multifunctional protein CAD Homo sapiens
Q0TM79 5.55e-07 55 23 4 171 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q9K8V7 5.67e-07 55 22 5 231 3 carB Carbamoyl phosphate synthase arginine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2FLD9 5.78e-07 55 24 4 204 3 carB Carbamoyl phosphate synthase large chain Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q38X24 5.94e-07 55 22 7 279 3 carB Carbamoyl phosphate synthase large chain Latilactobacillus sakei subsp. sakei (strain 23K)
C0MEH1 6.64e-07 55 23 5 240 3 carB Carbamoyl phosphate synthase large chain Streptococcus equi subsp. zooepidemicus (strain H70)
A3CNI5 7.12e-07 55 21 4 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus sanguinis (strain SK36)
A1A0T4 7.8e-07 55 24 7 199 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A8AX83 7.83e-07 55 21 4 234 3 carB Carbamoyl phosphate synthase large chain Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
P0DA15 8.1e-07 55 22 6 257 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M3 (strain SSI-1)
Q9K9V9 8.33e-07 55 23 12 345 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K9V9 0.000391 46 20 9 311 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5FJC0 8.69e-07 55 26 6 179 3 carB Carbamoyl phosphate synthase large chain Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
P55641 9.37e-07 54 23 7 221 4 NGR_a01790 Uncharacterized protein y4rH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B2GI87 9.82e-07 55 22 5 239 3 carB Carbamoyl phosphate synthase large chain Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q8G815 1.27e-06 54 25 6 193 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum (strain NCC 2705)
B3DQ32 1.27e-06 54 25 6 193 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum (strain DJO10A)
Q7S8A6 1.29e-06 54 19 9 317 1 pyr-3 Multifunctional protein pyr-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7S8A6 0.00057 46 22 6 249 1 pyr-3 Multifunctional protein pyr-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
B7GPW2 1.34e-06 54 25 6 193 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q8U085 1.34e-06 54 24 6 207 3 carB Carbamoyl phosphate synthase large chain Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
C1CXR4 1.49e-06 54 21 4 240 3 carB Carbamoyl phosphate synthase large chain Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q9CFV2 1.55e-06 54 21 9 317 3 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. lactis (strain IL1403)
A1R6Z3 1.64e-06 54 23 5 242 3 carB Carbamoyl phosphate synthase large chain Paenarthrobacter aurescens (strain TC1)
Q55756 1.85e-06 54 23 11 360 3 carB Carbamoyl phosphate synthase large chain Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55756 3.79e-05 50 22 3 197 3 carB Carbamoyl phosphate synthase large chain Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B2UX86 2.02e-06 54 24 4 175 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Alaska E43 / Type E3)
P08955 3.02e-06 53 21 5 233 1 CAD Multifunctional protein CAD Mesocricetus auratus
P08955 0.000207 47 20 2 180 1 CAD Multifunctional protein CAD Mesocricetus auratus
B2RQC6 3.05e-06 53 21 5 233 1 Cad Multifunctional protein CAD Mus musculus
B2RQC6 4.48e-05 50 21 2 180 1 Cad Multifunctional protein CAD Mus musculus
A7I6J1 3.15e-06 53 25 3 179 3 carB Carbamoyl phosphate synthase large chain Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q1IWM0 3.54e-06 53 21 5 247 3 carB Carbamoyl phosphate synthase large chain Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
C5C687 3.76e-06 53 24 6 195 3 carB Carbamoyl phosphate synthase large chain Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
O67233 4.24e-06 52 21 3 232 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Aquifex aeolicus (strain VF5)
A4TBY6 4.39e-06 53 25 7 233 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium gilvum (strain PYR-GCK)
Q97FT3 4.51e-06 53 20 4 233 3 carB Carbamoyl phosphate synthase large chain Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q047M8 4.54e-06 53 20 10 314 3 carB Carbamoyl phosphate synthase large chain Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
A8YVZ3 4.83e-06 52 20 10 314 3 carB Carbamoyl phosphate synthase large chain Lactobacillus helveticus (strain DPC 4571)
A0JX72 5.26e-06 52 23 7 240 3 carB Carbamoyl phosphate synthase large chain Arthrobacter sp. (strain FB24)
Q8F832 5.64e-06 52 21 7 247 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8F832 1.86e-05 51 22 10 324 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NF1 5.64e-06 52 21 7 247 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q72NF1 1.86e-05 51 22 10 324 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8DUP3 5.78e-06 52 21 9 299 3 carB Carbamoyl phosphate synthase large chain Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q03LT8 5.94e-06 52 21 7 279 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5F6 5.94e-06 52 21 7 279 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M0W9 5.94e-06 52 21 7 279 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain CNRZ 1066)
B9KB91 6.19e-06 52 22 6 238 3 carB Carbamoyl phosphate synthase large chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B9KB91 4e-05 50 23 9 337 3 carB Carbamoyl phosphate synthase large chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
P59448 6.44e-06 52 23 5 200 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A9KI94 6.54e-06 52 22 11 330 3 carB Carbamoyl phosphate synthase large chain Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q74J34 7.18e-06 52 24 4 175 3 carB Carbamoyl phosphate synthase large chain Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
C5CCF1 7.43e-06 52 24 4 177 3 carB Carbamoyl phosphate synthase large chain Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
B1MZ74 7.43e-06 52 25 9 243 3 carB Carbamoyl phosphate synthase large chain Leuconostoc citreum (strain KM20)
C1FNY3 8.26e-06 52 20 6 248 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Kyoto / Type A2)
C1FNY3 1.42e-05 51 20 9 312 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Kyoto / Type A2)
P96495 8.78e-06 52 23 6 220 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B9DRV7 8.99e-06 52 23 4 182 3 carB Carbamoyl phosphate synthase large chain Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A7GE89 9.4e-06 52 20 6 248 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A7GE89 1.59e-05 51 22 4 178 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q02YG5 9.56e-06 52 21 6 242 3 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. cremoris (strain SK11)
Q8ZY48 9.73e-06 52 26 8 233 3 carB Carbamoyl phosphate synthase large chain Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q5SKN1 9.74e-06 52 23 6 220 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q8DZQ7 1.1e-05 51 19 8 305 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
O32771 1.21e-05 51 21 6 242 2 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. cremoris (strain MG1363)
P38100 1.27e-05 51 24 7 243 3 carB Carbamoyl phosphate synthase large chain Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P38100 5.07e-05 49 22 5 240 3 carB Carbamoyl phosphate synthase large chain Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q469Z7 1.38e-05 51 23 4 221 3 carB Carbamoyl phosphate synthase large chain Methanosarcina barkeri (strain Fusaro / DSM 804)
Q4J8E8 1.52e-05 51 24 2 158 3 carB Carbamoyl phosphate synthase large chain Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q4J8E8 0.000231 47 24 10 313 3 carB Carbamoyl phosphate synthase large chain Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q8E5F5 1.54e-05 51 19 8 305 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype III (strain NEM316)
Q3K150 1.66e-05 51 19 8 305 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B0K4D7 1.69e-05 51 22 11 336 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter sp. (strain X514)
B2THH3 1.72e-05 51 23 4 175 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Eklund 17B / Type B)
A6Q6K6 1.81e-05 50 24 12 325 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurovum sp. (strain NBC37-1)
A1T8H1 1.81e-05 51 25 7 233 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q1D6Y8 1.82e-05 51 24 2 165 3 carB Carbamoyl phosphate synthase large chain Myxococcus xanthus (strain DK1622)
Q1D6Y8 0.000363 47 23 13 319 3 carB Carbamoyl phosphate synthase large chain Myxococcus xanthus (strain DK1622)
P25994 1.89e-05 50 22 6 236 1 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Bacillus subtilis (strain 168)
P25994 0.000482 46 22 8 243 1 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Bacillus subtilis (strain 168)
Q7N149 1.92e-05 50 28 8 160 3 ddl D-alanine--D-alanine ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9RWK0 2.03e-05 50 20 5 247 3 carB Carbamoyl phosphate synthase large chain Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q46KI4 2.03e-05 50 21 12 338 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL2A)
A8F453 2.12e-05 50 22 11 349 3 carB Carbamoyl phosphate synthase large chain Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A8F453 3.74e-05 50 22 6 265 3 carB Carbamoyl phosphate synthase large chain Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q827Q7 2.19e-05 50 28 6 178 3 carB Carbamoyl phosphate synthase large chain Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A5D508 2.22e-05 50 21 5 224 3 carB Carbamoyl phosphate synthase large chain Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B8H8U5 2.33e-05 50 25 4 185 3 carB Carbamoyl phosphate synthase large chain Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q8REV7 2.34e-05 50 23 10 227 3 purD Phosphoribosylamine--glycine ligase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B9DPN2 2.56e-05 50 22 14 338 3 carB Carbamoyl phosphate synthase large chain Staphylococcus carnosus (strain TM300)
B9DPN2 0.000148 48 23 4 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus carnosus (strain TM300)
Q9HK17 2.62e-05 50 23 7 219 3 carB Carbamoyl phosphate synthase large chain Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q88DU6 2.72e-05 50 23 12 344 3 carB Carbamoyl phosphate synthase large chain Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9KXR6 2.89e-05 50 25 7 227 3 carB Carbamoyl phosphate synthase large chain Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A2BJL3 3.02e-05 50 25 9 314 3 carB Carbamoyl phosphate synthase large chain Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
Q87WP4 3.21e-05 50 22 5 243 3 carB Carbamoyl phosphate synthase large chain Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B1HQC1 3.29e-05 50 25 7 231 3 carB Carbamoyl phosphate synthase large chain Lysinibacillus sphaericus (strain C3-41)
Q42601 3.3e-05 50 24 9 277 1 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Arabidopsis thaliana
B8GEA3 4.04e-05 50 21 6 242 3 carB Carbamoyl phosphate synthase large chain Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
Q7M8I0 4.15e-05 49 24 9 261 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8CPJ4 4.22e-05 50 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CPJ4 0.000157 48 20 4 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P77886 4.33e-05 49 23 3 186 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q5HPY8 4.6e-05 49 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HPY8 0.000137 48 20 4 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B1KT07 5.25e-05 49 21 3 175 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Loch Maree / Type A3)
B1KT07 0.000232 47 20 6 248 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Loch Maree / Type A3)
Q1B9F9 5.29e-05 49 21 4 240 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain MCS)
A1UFK4 5.29e-05 49 21 4 240 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain KMS)
A3PZ65 5.29e-05 49 21 4 240 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain JLS)
A0B8K9 5.53e-05 49 21 7 241 3 carB Carbamoyl phosphate synthase large chain Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
C1A4I5 5.55e-05 49 22 5 240 3 carB Carbamoyl phosphate synthase large chain Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
Q8RG86 5.76e-05 49 21 6 219 3 carB Carbamoyl phosphate synthase large chain Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q12FU8 6.54e-05 48 24 11 339 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q8XZ83 6.87e-05 49 22 7 255 3 carB Carbamoyl phosphate synthase large chain Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A3CU73 7.86e-05 48 24 4 187 3 carB Carbamoyl phosphate synthase large chain Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q8YQL2 8.27e-05 48 35 1 76 3 carB Carbamoyl phosphate synthase large chain Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8YQL2 0.000178 47 24 7 243 3 carB Carbamoyl phosphate synthase large chain Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q49WY4 8.64e-05 48 21 8 234 3 carB Carbamoyl phosphate synthase large chain Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B9EXM2 9.04e-05 48 24 12 372 2 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Oryza sativa subsp. japonica
Q7UJ58 0.000101 48 22 5 205 3 carB Carbamoyl phosphate synthase large chain Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q4L574 0.000101 48 22 11 252 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus haemolyticus (strain JCSC1435)
A5UKG5 0.000115 48 24 6 191 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A5UKG5 0.000161 48 24 6 207 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
B1YIR9 0.000115 48 23 5 239 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q09794 0.00012 48 23 4 178 1 ura1 Multifunctional protein ura1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q970U7 0.000133 48 25 6 211 3 carB Carbamoyl phosphate synthase large chain Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q970U7 0.000561 46 23 2 159 3 carB Carbamoyl phosphate synthase large chain Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
C3NH23 0.000135 48 22 8 310 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
B2GD06 0.000135 48 23 4 192 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q4L5Q5 0.000146 48 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus haemolyticus (strain JCSC1435)
C4KHM7 0.00015 48 22 8 310 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3MW21 0.000154 48 22 8 310 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3N664 0.000154 48 22 8 310 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.27)
C5CP83 0.000156 47 23 12 334 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Variovorax paradoxus (strain S110)
O93937 0.000178 48 21 3 175 3 pyrABCN Multifunctional protein pyrABCN Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C3NEM0 0.000196 47 22 8 310 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3MQE3 0.000196 47 22 8 310 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
B8DDR7 0.000198 47 23 7 227 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4a (strain HCC23)
Q71YI1 0.0002 47 23 7 227 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4b (strain F2365)
Q92AH3 0.0002 47 23 7 227 3 carB Carbamoyl phosphate synthase large chain Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
C1KWD4 0.000218 47 23 7 227 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4b (strain CLIP80459)
A9WSA8 0.000219 47 24 6 183 3 carB Carbamoyl phosphate synthase large chain Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
P46537 0.000225 47 22 6 224 3 carB Carbamoyl phosphate synthase large chain Bacillus caldolyticus
P46537 0.001 45 22 7 235 3 carB Carbamoyl phosphate synthase large chain Bacillus caldolyticus
Q59599 0.00023 47 20 4 243 3 carB Carbamoyl phosphate synthase large chain Neisseria gonorrhoeae
Q9ZKT2 0.00024 47 24 4 175 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain J99 / ATCC 700824)
O25577 0.000247 47 24 4 175 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain ATCC 700392 / 26695)
Q6GHN2 0.000248 47 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MRSA252)
A7GRL1 0.000275 47 21 11 338 3 carB Carbamoyl phosphate synthase large chain Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q9CCR2 0.000287 47 23 6 237 3 carB Carbamoyl phosphate synthase large chain Mycobacterium leprae (strain TN)
P63740 0.000299 47 21 8 250 1 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain N315)
P63739 0.000299 47 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IS88 0.000299 47 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH9)
A6U122 0.000299 47 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH1)
A7X1F4 0.000299 47 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8Z3P0 0.000302 47 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain USA300 / TCH1516)
Q6GA10 0.000302 47 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MSSA476)
A6QGA4 0.000302 47 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Newman)
Q5HGM9 0.000302 47 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain COL)
Q2FZ72 0.000302 47 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHN5 0.000302 47 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain USA300)
A2C2S8 0.000307 46 21 12 338 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL1A)
P58940 0.000323 47 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MW2)
B1L9P4 0.000344 46 26 6 149 3 ddl D-alanine--D-alanine ligase Thermotoga sp. (strain RQ2)
P46805 0.000344 46 26 6 149 3 ddl D-alanine--D-alanine ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O66949 0.000357 46 22 10 297 1 purD Phosphoribosylamine--glycine ligase Aquifex aeolicus (strain VF5)
A1VT89 0.000359 46 23 11 332 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Polaromonas naphthalenivorans (strain CJ2)
A2RI72 0.00037 46 23 11 246 3 ddl D-alanine--D-alanine ligase Lactococcus lactis subsp. cremoris (strain MG1363)
P0CQ36 0.000401 46 26 9 214 3 ADE2 Phosphoribosylaminoimidazole carboxylase Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
C4L5W3 0.000409 46 23 6 200 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
C6DEU1 0.000416 45 22 6 213 3 ddl D-alanine--D-alanine ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q59969 0.000429 46 22 8 310 3 carB Carbamoyl phosphate synthase large chain Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A0AJU0 0.000568 46 22 7 227 3 carB Carbamoyl phosphate synthase large chain Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q1WVA9 0.000582 46 22 3 192 3 carB Carbamoyl phosphate synthase large chain Ligilactobacillus salivarius (strain UCC118)
Q8PPA6 0.000587 45 23 4 150 3 ddl D-alanine--D-alanine ligase Xanthomonas axonopodis pv. citri (strain 306)
A5GX22 0.000626 45 26 8 190 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain RCC307)
P13258 0.000632 45 21 3 183 3 carB Carbamoyl phosphate synthase large chain (Fragment) Methanosarcina barkeri
B2A170 0.00065 46 25 4 164 3 carB Carbamoyl phosphate synthase large chain Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
A4VIT1 0.000654 45 23 7 232 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Stutzerimonas stutzeri (strain A1501)
A9VTC6 0.000675 45 22 7 235 3 carB Carbamoyl phosphate synthase large chain Bacillus mycoides (strain KBAB4)
A9VTC6 0.001 45 21 9 308 3 carB Carbamoyl phosphate synthase large chain Bacillus mycoides (strain KBAB4)
Q30R95 0.000687 45 24 5 157 3 ddl D-alanine--D-alanine ligase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q9HP43 0.000695 45 21 4 191 3 carB Carbamoyl phosphate synthase large chain Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B3WEF5 0.000697 45 22 5 214 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus casei (strain BL23)
Q9RLS9 0.000704 45 21 5 235 3 carB1 Carbamoyl phosphate synthase arginine-specific large chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q97AJ3 0.000707 45 20 14 344 3 carB Carbamoyl phosphate synthase large chain Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
P58944 0.000717 45 20 4 230 3 carB Carbamoyl phosphate synthase large chain Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8RBK0 0.000736 45 20 7 263 3 carB Carbamoyl phosphate synthase large chain Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q031X8 0.000771 45 23 10 245 3 ddl D-alanine--D-alanine ligase Lactococcus lactis subsp. cremoris (strain SK11)
Q04H29 0.000774 45 23 4 177 3 carB Carbamoyl phosphate synthase large chain Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
P0C017 0.000803 45 23 9 217 2 ADE2 Phosphoribosylaminoimidazole carboxylase Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q2YXG5 0.000807 45 21 8 250 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain bovine RF122 / ET3-1)
A0KKW8 0.000813 45 23 5 222 1 ddl D-alanine--D-alanine ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B2G564 0.000821 45 22 7 231 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHN6 0.000821 45 22 7 231 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus reuteri (strain DSM 20016)
B7IUP6 0.000866 45 22 7 235 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain G9842)
Q732I3 0.000866 45 20 9 308 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8Y665 0.000881 45 22 7 227 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P81185 0.000882 40 60 0 28 1 None Propionyl-CoA carboxylase alpha chain (Fragment) Myxococcus xanthus
B9EB69 0.001 45 21 13 338 3 carB Carbamoyl phosphate synthase large chain Macrococcus caseolyticus (strain JCSC5402)
Q03WW7 0.001 45 21 6 239 3 carB Carbamoyl phosphate synthase large chain Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11565
Feature type CDS
Gene accC
Product acetyl-CoA carboxylase biotin carboxylase subunit
Location 463153 - 464502 (strand: -1)
Length 1350 (nucleotides) / 449 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_250
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00289 Biotin carboxylase, N-terminal domain
PF02785 Biotin carboxylase C-terminal domain
PF02786 Carbamoyl-phosphate synthase L chain, ATP binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4770 Lipid transport and metabolism (I) I Acetyl/propionyl-CoA carboxylase, alpha subunit

Kegg Ortholog Annotation(s)

Protein Sequence

MLEKILIANRGEIALRILRACKELGIKAVAVHSSADRDLKHVLLADETICIGPAASAKSYLNIPAIISAAEISGSQAIHPGYGFLSENADFAEQVERSGFVFIGPKADTIRLMGDKVSAIHAMKETGVPCVPGSDGPLSDDMPLNHTIAHRIGYPVIIKASGGGGGRGMRVVRNDADLEEAIAMTKGEAKAAFNNDVVYMEKFLENPRHVEIQIMADGQGHAVYLAERDCSMQRRHQKVVEEAPAPGISAELRKSIGERCAKACIDIGYRGAGTFEFLFEDGEFYFIEMNTRIQVEHPVTEMITGIDLIKEQLRVASGLPLSVKQKDIHVKGHAIECRINAEDPHTFLPSPGKITRFHSPGGFGVRWESHIYAGYTVPPYYDSMIGKLITYGETREIAIARMKNALAELIIDGIKTNIELHQLIMNDENFCKGGTNIHYLEKKLGLHEV

Flanking regions ( +/- flanking 50bp)

CCTGTCGAATTTGACGAGCCACTGGTCGTCATCGAATAACGAGGCGAATCATGCTGGAAAAAATCCTTATTGCTAACCGGGGTGAAATTGCACTGCGCATCCTGCGGGCCTGTAAAGAGCTCGGCATTAAAGCAGTTGCTGTTCATTCCTCCGCGGATCGTGATTTAAAACACGTTTTACTGGCTGACGAAACCATTTGTATTGGTCCGGCAGCCTCCGCGAAAAGTTACCTGAATATCCCGGCGATTATCTCTGCCGCAGAAATTTCAGGATCCCAGGCTATTCATCCGGGATACGGTTTCTTATCTGAAAACGCTGACTTTGCTGAACAAGTTGAACGCTCAGGCTTTGTCTTTATCGGCCCGAAAGCCGATACCATCCGTCTGATGGGCGATAAAGTCTCTGCAATCCACGCGATGAAAGAAACGGGTGTTCCGTGTGTACCGGGCTCTGACGGCCCGCTCAGCGACGATATGCCGCTGAATCACACCATCGCACACCGCATTGGTTATCCGGTTATCATCAAAGCTTCCGGCGGCGGCGGCGGACGCGGTATGCGCGTTGTCCGCAATGACGCTGATCTCGAAGAAGCGATTGCCATGACCAAGGGTGAAGCCAAAGCGGCATTCAACAATGACGTGGTTTACATGGAGAAATTCCTTGAAAACCCGCGTCACGTTGAAATCCAGATTATGGCTGATGGTCAGGGACATGCGGTTTATCTGGCAGAACGTGACTGCTCCATGCAGCGCCGTCACCAGAAAGTCGTTGAAGAAGCGCCGGCTCCGGGCATCAGCGCCGAACTGCGTAAAAGTATCGGTGAGCGCTGTGCCAAAGCCTGTATCGATATCGGCTATCGCGGTGCCGGTACATTTGAGTTTCTGTTTGAAGACGGCGAGTTCTATTTTATTGAGATGAACACCCGTATTCAGGTTGAACATCCGGTCACTGAAATGATCACCGGTATTGACCTGATTAAAGAGCAGCTGCGTGTCGCATCCGGCCTGCCGCTCTCTGTTAAACAGAAAGATATTCATGTGAAAGGCCATGCGATCGAGTGCCGTATCAATGCCGAAGATCCGCATACTTTCCTGCCAAGCCCGGGCAAAATTACCCGCTTCCACTCACCGGGTGGTTTCGGTGTCCGCTGGGAATCACATATTTACGCCGGTTATACCGTGCCGCCATACTATGATTCCATGATTGGCAAGCTGATCACTTATGGTGAAACCCGTGAAATTGCTATCGCCCGTATGAAAAATGCGCTGGCGGAGTTAATTATTGACGGAATTAAAACCAATATTGAGCTGCATCAGCTGATTATGAATGATGAAAACTTCTGCAAAGGTGGAACAAACATCCACTATCTGGAGAAAAAACTCGGTCTTCACGAGGTCTGATTTTCATCTTCTGCCCTATATCAGGCCCCTGTCATTCAGGGGCTTTTTTA