Homologs in group_2257

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16975 FBDBKF_16975 78.1 Morganella morganii S1 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
EHELCC_16615 EHELCC_16615 78.1 Morganella morganii S2 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
NLDBIP_16825 NLDBIP_16825 78.1 Morganella morganii S4 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
LHKJJB_16645 LHKJJB_16645 78.1 Morganella morganii S3 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
HKOGLL_17610 HKOGLL_17610 78.1 Morganella morganii S5 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
F4V73_RS18435 F4V73_RS18435 77.8 Morganella psychrotolerans metE 5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase

Distribution of the homologs in the orthogroup group_2257

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2257

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EWC2 0.0 1562 100 0 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Proteus mirabilis (strain HI4320)
Q7MZ74 0.0 1273 79 0 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A7FDD3 0.0 1256 79 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66FT7 0.0 1253 78 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR46 0.0 1251 78 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pestis (strain Pestoides F)
Q1CNC1 0.0 1249 78 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAL3 0.0 1249 78 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pestis
Q1CBG7 0.0 1249 78 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A1JIE5 0.0 1228 78 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8A6T6 0.0 1228 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O9:H4 (strain HS)
B7M634 0.0 1227 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O8 (strain IAI1)
Q3YVD7 0.0 1226 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella sonnei (strain Ss046)
B6I4H1 0.0 1226 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain SE11)
Q8FBM1 0.0 1226 76 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A7ZU36 0.0 1226 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83IW0 0.0 1225 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella flexneri
Q0SZ21 0.0 1224 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella flexneri serotype 5b (strain 8401)
Q31UF9 0.0 1224 76 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella boydii serotype 4 (strain Sb227)
A8G8B2 0.0 1224 77 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Serratia proteamaculans (strain 568)
Q1R4A4 0.0 1224 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain UTI89 / UPEC)
B1LM00 0.0 1224 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
Q0TAP6 0.0 1224 76 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHZ7 0.0 1224 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O1:K1 / APEC
B7MH94 0.0 1224 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7LU25 0.0 1223 76 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P25665 0.0 1223 76 1 756 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain K12)
B1IW76 0.0 1223 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XAJ3 0.0 1223 76 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain K12 / DH10B)
B7NFD2 0.0 1222 76 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B2TVH5 0.0 1222 76 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q57HP2 0.0 1222 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella choleraesuis (strain SC-B67)
B5EZU1 0.0 1222 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella agona (strain SL483)
B5YY78 0.0 1221 76 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X8L5 0.0 1221 76 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O157:H7
B7NV51 0.0 1221 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q9L6N1 0.0 1221 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TBQ7 0.0 1221 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella heidelberg (strain SL476)
Q32A07 0.0 1220 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
B4TNX3 0.0 1220 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella schwarzengrund (strain CVM19633)
A9MY90 0.0 1220 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5FNW1 0.0 1219 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella dublin (strain CT_02021853)
Q8Z3B6 0.0 1217 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella typhi
B5QW68 0.0 1217 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella enteritidis PT4 (strain P125109)
A6TGK9 0.0 1217 75 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XYJ1 0.0 1217 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Klebsiella pneumoniae (strain 342)
B4SZ67 0.0 1216 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella newport (strain SL254)
B5RFN3 0.0 1215 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5BIX4 0.0 1214 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PKP9 0.0 1214 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A4WFZ2 0.0 1212 75 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Enterobacter sp. (strain 638)
A9MIY8 0.0 1210 75 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8ACX7 0.0 1205 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A7MQM1 0.0 1196 75 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q6DAS2 0.0 1193 75 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NWV8 0.0 1189 75 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Sodalis glossinidius (strain morsitans)
B2VI65 0.0 1181 75 2 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q1LU68 0.0 1108 69 2 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q89B24 0.0 1015 62 2 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8KA71 0.0 1006 62 4 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A4SNB5 0.0 997 65 4 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Aeromonas salmonicida (strain A449)
P57142 0.0 983 61 4 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q6LSD6 0.0 979 64 5 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Photobacterium profundum (strain SS9)
Q491V4 0.0 960 58 2 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Blochmanniella pennsylvanica (strain BPEN)
B5FFR4 0.0 951 60 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Aliivibrio fischeri (strain MJ11)
Q5E430 0.0 951 60 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8CWK1 0.0 939 60 5 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio vulnificus (strain CMCP6)
Q7MJM6 0.0 939 60 5 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio vulnificus (strain YJ016)
Q1I4X3 0.0 929 62 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas entomophila (strain L48)
B1J2V4 0.0 927 61 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas putida (strain W619)
Q8KRG6 0.0 923 60 5 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio harveyi
A4VNE5 0.0 922 61 7 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Stutzerimonas stutzeri (strain A1501)
Q02L76 0.0 919 61 6 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
P57703 0.0 918 61 6 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7VAU6 0.0 918 61 6 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas aeruginosa (strain LESB58)
Q9KRD8 0.0 917 61 6 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4KE22 0.0 917 60 5 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A6V1K5 0.0 917 62 5 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas aeruginosa (strain PA7)
Q87XJ9 0.0 915 60 5 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1QZS5 0.0 915 61 4 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q0A6U0 0.0 914 59 4 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q058E7 0.0 914 56 4 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
A4XSY1 0.0 912 60 6 768 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas mendocina (strain ymp)
Q2KYF3 0.0 912 59 8 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella avium (strain 197N)
Q0VR89 0.0 908 59 9 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q7VVU3 0.0 906 59 9 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W791 0.0 904 59 9 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WKM7 0.0 904 59 9 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q87NA1 0.0 902 59 5 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MRX1 0.0 900 59 6 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q8EIM0 0.0 893 59 5 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7VRI8 0.0 889 56 7 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Blochmanniella floridana
A9IKD8 0.0 885 59 9 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q3JAD5 0.0 879 58 2 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q2SMS4 0.0 873 57 6 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Hahella chejuensis (strain KCTC 2396)
B4EJ37 0.0 870 57 6 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B1K5S8 0.0 869 57 7 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia orbicola (strain MC0-3)
Q0B6M7 0.0 867 57 6 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1Z0R8 0.0 866 57 6 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia ambifaria (strain MC40-6)
A1AXN4 0.0 865 55 6 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Ruthia magnifica subsp. Calyptogena magnifica
Q39AN3 0.0 865 57 6 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1BQX8 0.0 865 57 7 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia orbicola (strain AU 1054)
A0B2Z3 0.0 865 57 7 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia cenocepacia (strain HI2424)
B5ELU7 0.0 863 55 5 781 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J432 0.0 863 55 5 781 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q21N29 0.0 861 55 4 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A4JJS1 0.0 860 57 7 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q3SGL1 0.0 854 57 6 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thiobacillus denitrificans (strain ATCC 25259)
B2JNZ4 0.0 851 56 7 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A1TYT7 0.0 845 56 6 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q0K0V6 0.0 842 57 4 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9F187 0.0 840 57 4 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Cupriavidus necator
B6J3R8 0.0 833 55 4 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain CbuG_Q212)
Q8XS05 0.0 833 57 5 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q13MI3 0.0 832 57 6 748 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Paraburkholderia xenovorans (strain LB400)
Q83A62 0.0 832 55 4 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N9C7 0.0 832 55 4 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KDA0 0.0 832 55 4 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain Dugway 5J108-111)
Q9JUT6 0.0 831 55 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1KTL3 0.0 831 55 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JZQ2 0.0 831 55 6 756 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B2TBS1 0.0 829 57 6 748 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A9M4E3 0.0 829 55 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria meningitidis serogroup C (strain 053442)
B6J6H8 0.0 829 54 4 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain CbuK_Q154)
Q9PB72 0.0 828 55 8 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Xylella fastidiosa (strain 9a5c)
Q87BY8 0.0 827 55 10 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I621 0.0 827 55 10 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Xylella fastidiosa (strain M23)
Q5F863 0.0 826 55 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B3GY43 0.0 824 55 6 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N1F9 0.0 823 55 6 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BQ96 0.0 823 54 6 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B0U3F5 0.0 821 55 10 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Xylella fastidiosa (strain M12)
B2UJ81 0.0 819 56 6 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Ralstonia pickettii (strain 12J)
A1T007 0.0 818 53 4 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B0UU16 0.0 818 54 5 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Histophilus somni (strain 2336)
Q82UP6 0.0 817 54 4 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0I3P2 0.0 810 53 5 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Histophilus somni (strain 129Pt)
Q11EU7 0.0 806 53 5 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Chelativorans sp. (strain BNC1)
Q9AAW1 0.0 804 54 4 779 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P45331 0.0 803 53 5 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5FJR8 0.0 803 53 8 771 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q3A7E2 0.0 802 53 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q6N765 0.0 800 52 4 773 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q11PV4 0.0 800 52 7 768 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q3SNK1 0.0 800 54 3 769 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A5UBH4 0.0 799 53 5 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Haemophilus influenzae (strain PittEE)
B3QGC4 0.0 798 52 4 773 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Rhodopseudomonas palustris (strain TIE-1)
A5UFD9 0.0 797 53 5 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Haemophilus influenzae (strain PittGG)
A3NC70 0.0 796 55 6 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia pseudomallei (strain 668)
A3NY08 0.0 796 55 6 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia pseudomallei (strain 1106a)
P57843 0.0 795 53 5 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pasteurella multocida (strain Pm70)
Q7NS23 0.0 793 55 4 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q3JPU6 0.0 793 54 6 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia pseudomallei (strain 1710b)
A1V6R3 0.0 793 55 7 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia mallei (strain SAVP1)
Q62LZ2 0.0 793 55 7 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia mallei (strain ATCC 23344)
A2S4V8 0.0 793 55 7 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia mallei (strain NCTC 10229)
A3MHJ9 0.0 793 55 7 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia mallei (strain NCTC 10247)
Q63RX6 0.0 791 54 6 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia pseudomallei (strain K96243)
Q9AMV8 0.0 791 51 4 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A7HQP6 0.0 785 51 6 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q605M0 0.0 781 54 4 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q2SY55 0.0 781 55 6 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q98A73 0.0 762 51 3 770 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9UT19 0.0 756 49 6 763 1 met26 Probable 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q2S338 0.0 753 50 6 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salinibacter ruber (strain DSM 13855 / M31)
Q725Q3 0.0 748 49 9 786 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B8DMM2 0.0 743 51 10 783 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q82LG4 0.0 730 50 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q93J59 0.0 729 50 8 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q0WNZ5 0.0 725 48 10 769 1 MS3 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 3, chloroplastic Arabidopsis thaliana
O50008 0.0 723 48 10 768 1 MS1 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 1 Arabidopsis thaliana
P93263 0.0 722 48 9 768 2 METE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mesembryanthemum crystallinum
P82610 0.0 720 48 12 770 1 MET6 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Candida albicans (strain SC5314 / ATCC MYA-2876)
B1VV57 0.0 715 48 7 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q42699 0.0 715 49 10 765 2 METE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Catharanthus roseus
Q9SRV5 0.0 715 48 10 768 1 MS2 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 2 Arabidopsis thaliana
Q42662 0.0 707 48 10 765 1 MET 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Plectranthus scutellarioides
P05694 0.0 706 47 10 768 1 MET6 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C1KEU0 0.0 703 48 9 762 1 None 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (Fragment) Kali turgidum
A5G0M4 0.0 699 50 7 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Acidiphilium cryptum (strain JF-5)
P9WK07 0.0 698 48 8 752 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WK06 0.0 698 48 8 752 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U1I0 0.0 698 48 8 752 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KHS4 0.0 698 48 8 752 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P65341 0.0 698 48 8 752 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0S6X7 0.0 696 48 7 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Rhodococcus jostii (strain RHA1)
Q2QLY4 0.0 694 48 12 767 2 Os12g0624000 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 2 Oryza sativa subsp. japonica
Q2QLY5 0.0 693 48 12 767 2 Os12g0623900 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 1 Oryza sativa subsp. japonica
A0QC69 0.0 690 47 6 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium avium (strain 104)
Q73WJ9 0.0 689 47 6 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q54X49 0.0 685 44 15 821 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Dictyostelium discoideum
A4J5C3 0.0 683 46 8 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
O05564 0.0 676 47 8 751 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium leprae (strain TN)
Q9CG55 0.0 671 45 6 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
B8DUK6 0.0 655 46 9 773 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium animalis subsp. lactis (strain AD011)
Q8Y6K3 0.0 650 45 8 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A0AJD5 0.0 649 45 8 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q02YT3 0.0 649 44 9 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Lactococcus lactis subsp. cremoris (strain SK11)
Q71YY6 0.0 648 45 9 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KVY0 0.0 648 45 9 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
A2RKK4 0.0 648 44 9 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
A1W0I5 0.0 648 44 8 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A7H2H6 0.0 647 44 10 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FMQ7 0.0 646 44 8 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q92AX9 0.0 646 45 7 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5HTR3 0.0 645 43 8 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni (strain RM1221)
Q9PN94 0.0 645 44 8 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B7IVP2 0.0 644 45 11 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain G9842)
Q6KNA9 0.0 644 45 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus anthracis
C3P710 0.0 644 45 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus anthracis (strain A0248)
C1EQ20 0.0 643 45 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain 03BB102)
A0RI12 0.0 643 45 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus thuringiensis (strain Al Hakam)
C3LI71 0.0 643 45 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
Q819H7 0.0 642 45 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7H8Z2 0.0 642 45 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain B4264)
B9IWL4 0.0 642 45 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain Q1)
B7HMX7 0.0 642 45 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain AH187)
B7JKY0 0.0 642 45 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain AH820)
Q117R7 0.0 642 44 11 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Trichodesmium erythraeum (strain IMS101)
Q635S6 0.0 641 45 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain ZK / E33L)
Q731W2 0.0 641 45 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
A8FCD2 0.0 640 44 10 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus pumilus (strain SAFR-032)
Q6HEG3 0.0 639 44 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
A9VFA6 0.0 639 45 12 770 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus mycoides (strain KBAB4)
B5E298 0.0 637 44 11 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae serotype 19F (strain G54)
Q9KFP1 0.0 637 46 9 751 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A7GS30 0.0 636 44 9 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A4VXA1 0.0 636 44 9 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus suis (strain 05ZYH33)
Q97S31 0.0 636 44 11 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q03L46 0.0 635 44 10 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
B1IAA7 0.0 635 44 11 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae (strain Hungary19A-6)
A8AV19 0.0 635 44 9 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
P80877 0.0 634 45 9 762 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus subtilis (strain 168)
A3CL11 0.0 634 44 8 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus sanguinis (strain SK36)
Q8DQT2 0.0 634 44 11 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04LT6 0.0 634 44 11 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A1A1F4 0.0 632 45 8 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q8G651 0.0 632 45 9 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium longum (strain NCC 2705)
B3DS65 0.0 632 45 9 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium longum (strain DJO10A)
Q8FQB2 0.0 631 45 9 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
O67606 0.0 631 44 15 784 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Aquifex aeolicus (strain VF5)
Q65KT8 0.0 630 45 9 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B5YJD3 0.0 629 43 13 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B7GRV8 0.0 627 45 8 750 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q88X63 0.0 623 45 8 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A7Z3U1 0.0 622 44 9 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q2JKE8 0.0 619 45 10 768 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8CWX6 0.0 619 45 13 758 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8DJY0 0.0 608 45 12 768 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5HS05 0.0 604 44 11 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CMP5 0.0 603 44 11 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P65343 0.0 602 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain N315)
P65342 0.0 602 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WY46 0.0 602 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A5IPT7 0.0 602 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain JH9)
A6TYK8 0.0 602 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain JH1)
Q2YVH7 0.0 602 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NY94 0.0 601 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain MW2)
Q6GCB6 0.0 601 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain MSSA476)
Q6GJW2 0.0 601 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain MRSA252)
A8YZI1 0.0 600 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
A6QE38 0.0 600 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain Newman)
Q5HIT8 0.0 600 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain COL)
Q2G122 0.0 600 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJQ7 0.0 600 45 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain USA300)
A5IMS4 0.0 596 41 14 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A9B0A2 0.0 595 46 16 768 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
P65345 0.0 594 44 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P65344 0.0 594 44 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus agalactiae serotype III (strain NEM316)
Q3JYS3 0.0 594 44 12 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8NRB3 0.0 592 43 10 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QDA4 0.0 592 43 10 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Corynebacterium glutamicum (strain R)
Q4L330 0.0 589 44 12 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus haemolyticus (strain JCSC1435)
B1LC63 0.0 580 41 14 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermotoga sp. (strain RQ2)
Q9X112 0.0 580 41 14 764 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q39586 6.39e-178 533 41 18 794 2 None 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Chlamydomonas reinhardtii
C3N775 2.06e-45 169 31 8 335 3 metE Methionine synthase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NGG0 4.74e-45 167 31 8 335 3 metE Methionine synthase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MWZ5 1.49e-44 166 30 8 335 3 metE Methionine synthase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MR07 1.49e-44 166 30 8 335 3 metE Methionine synthase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C4KID3 1.49e-44 166 30 8 335 3 metE Methionine synthase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3MZ55 1.49e-44 166 30 8 335 3 metE Methionine synthase Sulfolobus islandicus (strain M.16.27)
Q980A9 2.89e-44 166 30 8 335 3 metE Methionine synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9YA91 2.22e-41 157 32 8 336 3 metE Methionine synthase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q975N4 1.98e-40 155 29 6 333 3 metE Methionine synthase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q4JAI4 3.33e-40 154 29 8 330 3 metE Methionine synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q5JH51 5.48e-33 133 29 8 340 3 metE Methionine synthase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8TH63 7.66e-32 130 26 7 339 3 metE Methionine synthase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9V085 7.19e-29 121 25 7 339 3 metE Methionine synthase Pyrococcus abyssi (strain GE5 / Orsay)
O58816 7.54e-29 121 26 9 340 3 metE Methionine synthase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q58868 9.22e-22 100 26 15 349 3 metE Methionine synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P57704 1.18e-21 100 30 14 347 3 metE Methionine synthase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q979L4 1.12e-20 97 28 10 309 3 metE Methionine synthase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
O26869 2.32e-16 84 27 14 331 3 metE Methionine synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P55299 9.22e-16 82 28 14 334 1 metE Methionine synthase Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q56837 4.23e-06 53 22 9 322 1 xecA1 2-hydroxypropyl-CoM lyase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17540
Feature type CDS
Gene metE
Product 5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase
Location 3850350 - 3852623 (strand: 1)
Length 2274 (nucleotides) / 757 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2257
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01717 Cobalamin-independent synthase, Catalytic domain
PF08267 Cobalamin-independent synthase, N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0620 Amino acid transport and metabolism (E) E Methionine synthase II (cobalamin-independent)

Kegg Ortholog Annotation(s)

Protein Sequence

MTIRNHTLGFPRIGLNRELKKAQESYWAGNISQAELLAVGKELRARHWQQQANAGVELLPVGDFAWYDQVLGTSLLLGNIPPRHRNEDGRLDLDTLFRVARGRAPTGKPAAASEMTKWFNTNYHYIVPEFQQGQSFTLAWQQLLDEVDEALALGHNVKPVLLGPITYLWLGKVKGPEFDRLSLLDAILPVYQQVLSQLQQKGIEWVQIDEPALVLDLPIEWQNAYQVAYQALTGQVKLLLTTYFDGITHHLDIIKNLPVNGLHIDLCAGQDALQVIHQALPKDWVLSLGVINGRNVWKADLTTRYQQVVALKGKRPLWIGTSCSLLHSPIDLSAETKLDDEVKSWFAFAVQKCAEVALLAKALNAPEGEYDEQLAQYSAPIRQREHSSRVHNAKVAARLQAINAQDGERTSPYQQRAKVQRARFNFPLWPTTTIGSFPQTTEIRTVRLDFKKGRIDTTAYRTNISEHIKQAIDEQERLGLDVLVHGEAERNDMVEYFGEHFEGYVFTQNGWVQSYGSRCVKPPVIIGDISRPAPITVDWATYAQSLTDKPVKGMLTGPVTILCWSFPREDVSRETIAKQIALALRDEVDDLQKAGIGIIQIDEPALREGLPLRRDEWQAYLDWAVDAFKLSAAIADDETQIHTHMCYCEFNDIMEAIAALDADVITIETSRSDMELLEAFEHFDYPNEIGPGVYDIHSPNVPNVEWIVGLLRKAQSRIPAERLWVNPDCGLKTRGWSETRAALANMVEAAKYLRQNV

Flanking regions ( +/- flanking 50bp)

AGATTATGGATGTGTAAACATCTAGACGGCTAAAAACAGGATTTTTTATTATGACAATTCGCAATCACACATTAGGTTTCCCACGTATTGGCTTAAATAGAGAGCTAAAAAAGGCACAAGAGAGCTATTGGGCTGGTAATATTTCTCAGGCAGAACTTCTGGCAGTTGGTAAAGAATTACGCGCTCGTCATTGGCAACAGCAAGCTAATGCAGGAGTCGAATTATTACCCGTTGGCGATTTTGCTTGGTACGACCAAGTCTTGGGTACTAGTCTCCTATTAGGCAATATACCGCCACGCCATCGTAATGAAGATGGTCGCCTAGATCTTGATACTCTATTTCGAGTGGCGAGAGGCAGAGCACCAACGGGTAAACCTGCGGCCGCCTCAGAAATGACAAAATGGTTTAATACTAACTATCACTATATCGTGCCAGAATTTCAGCAAGGACAATCATTTACACTGGCGTGGCAACAGCTACTGGATGAAGTCGATGAGGCTTTAGCATTAGGCCATAATGTGAAACCGGTACTTTTGGGGCCGATCACCTACTTATGGTTAGGAAAAGTTAAAGGACCTGAGTTTGATAGATTGTCACTGTTAGACGCTATTTTACCTGTTTATCAGCAAGTATTGAGTCAGTTACAGCAAAAAGGTATCGAGTGGGTACAAATTGATGAGCCTGCACTGGTTCTTGATTTACCCATTGAGTGGCAAAATGCTTATCAAGTTGCTTATCAAGCATTGACTGGACAGGTTAAACTATTATTGACTACCTATTTTGATGGTATTACTCATCATCTTGATATTATTAAAAACTTACCGGTAAATGGGCTACATATTGATCTATGTGCAGGACAGGACGCATTGCAAGTTATACACCAAGCATTGCCTAAAGACTGGGTGTTATCGTTAGGGGTCATTAATGGTCGCAACGTCTGGAAAGCGGATCTAACTACCCGTTATCAACAAGTAGTTGCATTAAAAGGTAAGCGTCCATTATGGATTGGCACATCATGCTCTTTGTTGCATAGTCCAATTGATTTAAGTGCGGAGACTAAGCTTGATGATGAAGTGAAAAGCTGGTTTGCCTTTGCGGTGCAAAAATGTGCAGAAGTGGCGTTACTCGCAAAAGCATTAAATGCACCAGAAGGTGAATATGACGAACAACTTGCCCAATACAGTGCCCCCATTCGTCAACGTGAACACTCTAGTCGTGTACATAATGCAAAAGTGGCCGCACGCTTGCAGGCGATTAATGCACAAGACGGTGAAAGAACATCGCCTTATCAACAACGAGCTAAAGTGCAACGCGCTCGGTTTAATTTCCCTCTGTGGCCAACGACAACCATAGGTTCATTCCCACAAACTACCGAGATCCGCACAGTACGTTTAGACTTTAAAAAAGGGCGTATTGATACCACTGCTTATCGCACTAATATTAGCGAGCATATTAAGCAAGCCATAGATGAACAAGAGCGCTTAGGGCTTGATGTGTTGGTTCATGGTGAAGCTGAGCGTAATGACATGGTTGAATATTTTGGCGAGCATTTTGAAGGTTATGTCTTTACTCAAAATGGCTGGGTACAAAGCTACGGCTCCCGCTGCGTAAAACCGCCGGTGATCATTGGTGATATTAGCCGTCCTGCACCGATTACGGTAGATTGGGCGACTTATGCTCAATCATTAACCGATAAGCCAGTTAAGGGTATGTTAACTGGGCCAGTGACTATTTTATGTTGGTCTTTCCCGCGTGAGGATGTCAGCCGTGAAACTATCGCTAAACAAATTGCGTTAGCGTTACGTGATGAGGTGGATGATTTACAAAAAGCCGGTATCGGTATTATTCAGATAGATGAGCCTGCATTACGCGAAGGATTACCGTTACGTCGTGATGAGTGGCAAGCATACCTAGATTGGGCTGTTGATGCCTTTAAGCTCAGTGCAGCTATCGCTGATGATGAGACACAAATTCATACACATATGTGTTATTGCGAGTTTAATGACATTATGGAGGCGATTGCTGCATTGGATGCGGATGTGATCACCATTGAAACATCACGCTCAGATATGGAGTTATTAGAAGCCTTTGAACATTTTGATTATCCAAATGAAATTGGTCCTGGGGTATACGATATTCATTCGCCTAATGTACCGAATGTAGAATGGATTGTTGGATTGTTAAGAAAAGCGCAATCGCGTATCCCTGCGGAACGTTTATGGGTAAATCCAGATTGCGGTTTAAAAACGCGGGGGTGGAGTGAAACCCGTGCAGCATTGGCAAATATGGTTGAAGCGGCTAAATATTTACGCCAGAACGTATAATAATATTTAAATAATATATTTTAGTAGCCTGTTATTTTGATGTTATCAAT