Homologs in group_2220

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16975 FBDBKF_16975 100.0 Morganella morganii S1 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
EHELCC_16615 EHELCC_16615 100.0 Morganella morganii S2 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
NLDBIP_16825 NLDBIP_16825 100.0 Morganella morganii S4 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
LHKJJB_16645 LHKJJB_16645 100.0 Morganella morganii S3 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
F4V73_RS18435 F4V73_RS18435 91.4 Morganella psychrotolerans metE 5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase
PMI_RS17540 PMI_RS17540 78.1 Proteus mirabilis HI4320 metE 5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase

Distribution of the homologs in the orthogroup group_2220

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2220

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MZ74 0.0 1253 79 0 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4EWC2 0.0 1245 78 0 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Proteus mirabilis (strain HI4320)
A7FDD3 0.0 1233 78 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66FT7 0.0 1231 78 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR46 0.0 1229 78 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pestis (strain Pestoides F)
Q1CNC1 0.0 1227 77 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAL3 0.0 1227 77 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pestis
Q1CBG7 0.0 1227 77 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A6TGK9 0.0 1225 77 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XYJ1 0.0 1222 77 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Klebsiella pneumoniae (strain 342)
A1JIE5 0.0 1215 78 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8A6T6 0.0 1215 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O9:H4 (strain HS)
B1IW76 0.0 1214 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7M634 0.0 1214 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O8 (strain IAI1)
A7ZU36 0.0 1214 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YVD7 0.0 1214 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella sonnei (strain Ss046)
B6I4H1 0.0 1214 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain SE11)
Q8FBM1 0.0 1214 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0SZ21 0.0 1212 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella flexneri serotype 5b (strain 8401)
B7LU25 0.0 1212 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NFD2 0.0 1212 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1LM00 0.0 1211 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
Q83IW0 0.0 1211 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella flexneri
Q1R4A4 0.0 1211 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain UTI89 / UPEC)
B7MH94 0.0 1211 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
P25665 0.0 1210 77 1 754 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain K12)
B1XAJ3 0.0 1210 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain K12 / DH10B)
A4WFZ2 0.0 1209 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Enterobacter sp. (strain 638)
A1AHZ7 0.0 1209 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O1:K1 / APEC
Q0TAP6 0.0 1209 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NV51 0.0 1208 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YY78 0.0 1208 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X8L5 0.0 1207 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O157:H7
Q32A07 0.0 1206 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
A8ACX7 0.0 1204 77 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q31UF9 0.0 1203 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella boydii serotype 4 (strain Sb227)
A8G8B2 0.0 1203 77 0 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Serratia proteamaculans (strain 568)
B2TVH5 0.0 1201 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q9L6N1 0.0 1195 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TBQ7 0.0 1195 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella heidelberg (strain SL476)
B5FNW1 0.0 1195 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella dublin (strain CT_02021853)
A9MIY8 0.0 1194 75 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5EZU1 0.0 1194 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella agona (strain SL483)
Q57HP2 0.0 1194 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella choleraesuis (strain SC-B67)
B4TNX3 0.0 1194 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella schwarzengrund (strain CVM19633)
A9MY90 0.0 1194 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q8Z3B6 0.0 1192 75 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella typhi
B5QW68 0.0 1191 75 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella enteritidis PT4 (strain P125109)
B4SZ67 0.0 1190 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella newport (strain SL254)
B5RFN3 0.0 1189 75 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5BIX4 0.0 1188 75 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PKP9 0.0 1188 75 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A7MQM1 0.0 1186 76 1 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q6DAS2 0.0 1179 75 1 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NWV8 0.0 1178 75 0 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Sodalis glossinidius (strain morsitans)
B2VI65 0.0 1162 75 2 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q1LU68 0.0 1090 68 3 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q89B24 0.0 990 61 3 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8KA71 0.0 982 61 4 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57142 0.0 976 61 3 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q6LSD6 0.0 962 62 5 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Photobacterium profundum (strain SS9)
A4SNB5 0.0 962 63 3 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Aeromonas salmonicida (strain A449)
Q7MJM6 0.0 937 60 5 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio vulnificus (strain YJ016)
Q491V4 0.0 935 57 2 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Blochmanniella pennsylvanica (strain BPEN)
Q8CWK1 0.0 934 60 5 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio vulnificus (strain CMCP6)
Q9KRD8 0.0 932 61 6 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B5FFR4 0.0 929 58 5 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Aliivibrio fischeri (strain MJ11)
Q5E430 0.0 929 58 5 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8KRG6 0.0 922 60 4 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio harveyi
A7MRX1 0.0 919 60 5 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q87NA1 0.0 917 60 4 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A6V1K5 0.0 915 62 5 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas aeruginosa (strain PA7)
Q1QZS5 0.0 908 61 4 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q2KYF3 0.0 908 59 7 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella avium (strain 197N)
Q0VR89 0.0 904 59 9 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q1I4X3 0.0 902 60 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas entomophila (strain L48)
Q02L76 0.0 902 61 6 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7VAU6 0.0 900 61 6 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas aeruginosa (strain LESB58)
P57703 0.0 900 61 6 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B1J2V4 0.0 895 60 6 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas putida (strain W619)
Q4KE22 0.0 895 59 5 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A4VNE5 0.0 892 60 6 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Stutzerimonas stutzeri (strain A1501)
A4XSY1 0.0 890 59 5 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas mendocina (strain ymp)
Q0A6U0 0.0 889 59 5 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q7W791 0.0 887 59 8 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WKM7 0.0 887 59 8 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VVU3 0.0 885 59 8 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q87XJ9 0.0 884 59 5 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q058E7 0.0 884 54 3 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q8EIM0 0.0 880 58 5 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7VRI8 0.0 879 54 6 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Blochmanniella floridana
B4EJ37 0.0 875 58 8 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q8XS05 0.0 870 60 6 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A9IKD8 0.0 867 58 8 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B1Z0R8 0.0 866 58 8 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia ambifaria (strain MC40-6)
Q39AN3 0.0 865 58 9 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1BQX8 0.0 865 58 9 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia orbicola (strain AU 1054)
B1K5S8 0.0 865 58 9 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia orbicola (strain MC0-3)
Q0B6M7 0.0 865 58 8 768 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0B2Z3 0.0 865 58 9 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia cenocepacia (strain HI2424)
Q0K0V6 0.0 863 58 4 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9F187 0.0 858 58 4 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Cupriavidus necator
Q3JAD5 0.0 858 57 2 752 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q21N29 0.0 856 55 5 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B5ELU7 0.0 855 54 5 784 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J432 0.0 855 54 5 784 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q2SMS4 0.0 852 56 7 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Hahella chejuensis (strain KCTC 2396)
A9N9C7 0.0 852 55 4 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
Q83A62 0.0 852 55 4 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KDA0 0.0 852 55 4 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain Dugway 5J108-111)
A4JJS1 0.0 850 58 7 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B6J6H8 0.0 849 55 4 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain CbuK_Q154)
B6J3R8 0.0 848 54 4 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain CbuG_Q212)
B2UJ81 0.0 843 57 8 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Ralstonia pickettii (strain 12J)
Q3SGL1 0.0 840 56 7 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thiobacillus denitrificans (strain ATCC 25259)
B2JNZ4 0.0 840 56 8 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A1AXN4 0.0 838 54 6 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Ruthia magnifica subsp. Calyptogena magnifica
A1TYT7 0.0 838 55 7 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1T007 0.0 829 54 4 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q82UP6 0.0 825 55 3 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q9JZQ2 0.0 825 54 7 761 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B0BQ96 0.0 823 55 7 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
P45331 0.0 823 54 6 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q13MI3 0.0 822 57 6 747 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Paraburkholderia xenovorans (strain LB400)
B3GY43 0.0 821 55 7 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q7NS23 0.0 819 57 4 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A3N1F9 0.0 819 55 7 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A1KTL3 0.0 818 54 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9PB72 0.0 818 54 7 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Xylella fastidiosa (strain 9a5c)
Q5F863 0.0 818 54 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B0U3F5 0.0 818 54 6 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Xylella fastidiosa (strain M12)
Q9JUT6 0.0 818 54 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M4E3 0.0 817 54 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria meningitidis serogroup C (strain 053442)
Q87BY8 0.0 817 54 7 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I621 0.0 817 54 7 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Xylella fastidiosa (strain M23)
B0UU16 0.0 816 54 6 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Histophilus somni (strain 2336)
A5UBH4 0.0 816 54 6 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Haemophilus influenzae (strain PittEE)
A5UFD9 0.0 815 54 6 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Haemophilus influenzae (strain PittGG)
B2TBS1 0.0 811 56 6 747 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q3JPU6 0.0 811 56 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia pseudomallei (strain 1710b)
A1V6R3 0.0 810 56 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia mallei (strain SAVP1)
Q62LZ2 0.0 810 56 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia mallei (strain ATCC 23344)
A2S4V8 0.0 810 56 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia mallei (strain NCTC 10229)
A3MHJ9 0.0 810 56 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia mallei (strain NCTC 10247)
A3NY08 0.0 809 56 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia pseudomallei (strain 1106a)
Q63RX6 0.0 809 56 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia pseudomallei (strain K96243)
A3NC70 0.0 809 56 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia pseudomallei (strain 668)
P57843 0.0 808 54 6 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pasteurella multocida (strain Pm70)
Q0I3P2 0.0 807 53 6 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Histophilus somni (strain 129Pt)
Q11EU7 0.0 806 53 4 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Chelativorans sp. (strain BNC1)
Q3A7E2 0.0 795 52 7 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q2SY55 0.0 795 57 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A5FJR8 0.0 794 52 10 777 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q605M0 0.0 790 55 4 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q9AAW1 0.0 789 53 3 777 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A7HQP6 0.0 784 54 6 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q6N765 0.0 782 52 6 776 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B3QGC4 0.0 780 52 6 776 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Rhodopseudomonas palustris (strain TIE-1)
Q3SNK1 0.0 779 53 3 769 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q9AMV8 0.0 779 51 5 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q11PV4 0.0 767 50 7 770 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q725Q3 0.0 766 51 11 785 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q2S338 0.0 759 51 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salinibacter ruber (strain DSM 13855 / M31)
B8DMM2 0.0 757 52 10 781 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q9UT19 0.0 747 49 6 760 1 met26 Probable 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q98A73 0.0 743 50 3 774 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q82LG4 0.0 731 51 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
B1VV57 0.0 729 50 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
P05694 0.0 725 49 12 766 1 MET6 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A5G0M4 0.0 718 52 7 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Acidiphilium cryptum (strain JF-5)
Q93J59 0.0 716 50 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P82610 0.0 707 47 12 771 1 MET6 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Candida albicans (strain SC5314 / ATCC MYA-2876)
A4J5C3 0.0 701 47 10 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
P93263 0.0 699 47 9 763 2 METE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mesembryanthemum crystallinum
O50008 0.0 699 47 9 769 1 MS1 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 1 Arabidopsis thaliana
Q0WNZ5 0.0 697 48 9 762 1 MS3 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 3, chloroplastic Arabidopsis thaliana
P9WK07 0.0 694 49 9 754 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WK06 0.0 694 49 9 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U1I0 0.0 694 49 9 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KHS4 0.0 694 49 9 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P65341 0.0 694 49 9 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q42699 0.0 693 48 10 762 2 METE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Catharanthus roseus
Q9SRV5 0.0 693 48 9 762 1 MS2 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 2 Arabidopsis thaliana
Q0S6X7 0.0 690 49 9 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Rhodococcus jostii (strain RHA1)
O05564 0.0 690 48 10 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium leprae (strain TN)
C1KEU0 0.0 686 47 9 759 1 None 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (Fragment) Kali turgidum
Q9CG55 0.0 686 45 8 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q42662 0.0 681 48 11 764 1 MET 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Plectranthus scutellarioides
A2RKK4 0.0 679 46 9 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
Q54X49 0.0 678 43 14 814 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Dictyostelium discoideum
Q02YT3 0.0 675 45 9 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Lactococcus lactis subsp. cremoris (strain SK11)
Q2QLY5 0.0 673 47 10 763 2 Os12g0623900 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 1 Oryza sativa subsp. japonica
Q2QLY4 0.0 672 47 10 763 2 Os12g0624000 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 2 Oryza sativa subsp. japonica
B8DUK6 0.0 671 46 9 769 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium animalis subsp. lactis (strain AD011)
A0QC69 0.0 668 47 9 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium avium (strain 104)
Q73WJ9 0.0 667 47 11 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8Y6K3 0.0 662 46 8 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71YY6 0.0 657 46 8 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KVY0 0.0 657 46 8 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
A0AJD5 0.0 656 46 7 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q92AX9 0.0 654 46 8 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A1W0I5 0.0 652 45 9 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FMQ7 0.0 650 45 9 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A3CL11 0.0 650 46 8 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus sanguinis (strain SK36)
A1A1F4 0.0 650 45 8 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A7GS30 0.0 650 45 12 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q5HTR3 0.0 649 45 9 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni (strain RM1221)
A4VXA1 0.0 648 46 8 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus suis (strain 05ZYH33)
Q9PN94 0.0 648 45 9 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B7IVP2 0.0 648 45 11 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain G9842)
B7H8Z2 0.0 648 45 12 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain B4264)
Q819H7 0.0 647 45 12 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
C1EQ20 0.0 647 45 11 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain 03BB102)
Q6KNA9 0.0 647 45 12 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus anthracis
A0RI12 0.0 647 45 11 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus thuringiensis (strain Al Hakam)
C3P710 0.0 647 45 12 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus anthracis (strain A0248)
A7H2H6 0.0 646 45 9 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
C3LI71 0.0 646 45 12 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
B7JKY0 0.0 646 45 12 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain AH820)
Q117R7 0.0 645 44 9 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Trichodesmium erythraeum (strain IMS101)
Q88X63 0.0 645 46 9 773 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q731W2 0.0 644 45 12 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q03L46 0.0 644 45 9 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
A8AV19 0.0 644 45 8 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q6HEG3 0.0 644 45 12 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q635S6 0.0 643 45 11 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain ZK / E33L)
B9IWL4 0.0 642 45 11 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain Q1)
B7HMX7 0.0 642 45 11 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain AH187)
A9VFA6 0.0 642 45 12 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus mycoides (strain KBAB4)
B5E298 0.0 641 45 9 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae serotype 19F (strain G54)
B1IAA7 0.0 640 45 9 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae (strain Hungary19A-6)
Q97S31 0.0 639 45 9 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8DQT2 0.0 637 45 9 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04LT6 0.0 637 45 9 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8G651 0.0 636 45 9 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium longum (strain NCC 2705)
B3DS65 0.0 636 45 9 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium longum (strain DJO10A)
B7GRV8 0.0 632 45 11 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q9KFP1 0.0 624 46 10 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P80877 0.0 622 45 9 762 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus subtilis (strain 168)
A8FCD2 0.0 620 45 11 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus pumilus (strain SAFR-032)
B5YJD3 0.0 620 44 12 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q8FQB2 0.0 620 45 10 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
O67606 0.0 620 44 14 773 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Aquifex aeolicus (strain VF5)
A7Z3U1 0.0 614 45 9 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q8DJY0 0.0 612 44 13 775 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q65KT8 0.0 611 46 9 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q5HS05 0.0 608 46 15 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CMP5 0.0 608 46 15 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P65343 0.0 607 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain N315)
P65342 0.0 607 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WY46 0.0 607 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2JKE8 0.0 606 44 10 774 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8NY94 0.0 606 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain MW2)
Q6GCB6 0.0 606 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain MSSA476)
Q6GJW2 0.0 606 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain MRSA252)
A8YZI1 0.0 605 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
A6QE38 0.0 605 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain Newman)
Q5HIT8 0.0 605 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain COL)
Q2YVH7 0.0 605 45 13 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G122 0.0 605 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJQ7 0.0 605 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain USA300)
B1LC63 0.0 605 43 13 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermotoga sp. (strain RQ2)
Q9X112 0.0 605 43 13 756 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A5IPT7 0.0 605 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain JH9)
A6TYK8 0.0 605 45 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain JH1)
A5IMS4 0.0 598 42 13 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q4L330 0.0 597 44 14 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus haemolyticus (strain JCSC1435)
A4QDA4 0.0 593 44 12 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Corynebacterium glutamicum (strain R)
Q8NRB3 0.0 592 44 12 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8CWX6 0.0 584 43 12 760 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A9B0A2 0.0 579 46 15 772 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
P65345 0.0 577 43 13 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P65344 0.0 577 43 13 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus agalactiae serotype III (strain NEM316)
Q3JYS3 0.0 577 43 13 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q39586 5.82e-176 528 42 19 789 2 None 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Chlamydomonas reinhardtii
C3N775 1.51e-46 172 31 7 332 3 metE Methionine synthase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NGG0 3.41e-46 171 31 7 332 3 metE Methionine synthase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MWZ5 9.08e-46 170 31 7 332 3 metE Methionine synthase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MR07 9.08e-46 170 31 7 332 3 metE Methionine synthase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C4KID3 9.08e-46 170 31 7 332 3 metE Methionine synthase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3MZ55 9.08e-46 170 31 7 332 3 metE Methionine synthase Sulfolobus islandicus (strain M.16.27)
Q980A9 6.51e-45 167 30 6 332 3 metE Methionine synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9YA91 3.81e-44 165 33 7 333 3 metE Methionine synthase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q975N4 7.6e-42 159 30 8 332 3 metE Methionine synthase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q4JAI4 4.35e-41 157 29 8 332 3 metE Methionine synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q8TH63 3.07e-35 140 28 7 337 3 metE Methionine synthase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q5JH51 3.33e-35 140 28 6 335 3 metE Methionine synthase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9V085 3.38e-31 128 27 7 337 3 metE Methionine synthase Pyrococcus abyssi (strain GE5 / Orsay)
O58816 8.75e-31 127 27 9 338 3 metE Methionine synthase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P57704 1.16e-24 109 32 11 303 3 metE Methionine synthase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q979L4 1.02e-22 103 29 9 305 3 metE Methionine synthase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q58868 3.12e-21 98 26 16 353 3 metE Methionine synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O26869 9.4e-20 94 29 17 337 3 metE Methionine synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P55299 1.72e-18 90 28 14 338 1 metE Methionine synthase Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_17610
Feature type CDS
Gene metE
Product 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
Location 22506 - 24791 (strand: -1)
Length 2286 (nucleotides) / 761 (amino acids)

Contig

Accession ZDB_701
Length 44890 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2220
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01717 Cobalamin-independent synthase, Catalytic domain
PF08267 Cobalamin-independent synthase, N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0620 Amino acid transport and metabolism (E) E Methionine synthase II (cobalamin-independent)

Kegg Ortholog Annotation(s)

Protein Sequence

MTTHNHTLGFPRIGLKRELKKALEGYWAGQISQDELRDTGRELRRRHWQLQKEAGVELLPVGDFAWYDHVLGTSLLFGNVPPRHAGADGKIDLDTLFRIARGRAPSGEPAAAAEMTKWFNTNYHYIVPEFQRGQTFTVSWPQLFDEVDEALEQGFAVKPVLLGPVTYLWLGKVKGAQFDRLSLLPSLSEAYKNVLEKLAQRGIEWIQIDEPALVLDLPPEWQDAYRTAYDALQGHAKLLLTTYFDGVSHHLPLIRELPVQGLHVDFVAGDDDIQAIHDALPADWLLSAGLINGRNVWRADLRQKYDVIAPLAGKRDLWIGTSCSLLHSPIDLRDETKLDEEVKSWFAFAQQKCEELALLTRAVNSGSADDIAALAEYSAPITRRRDSSRVHNAAVAARLAAVTARDSERAAPYAERAEEQRRRFNLPLWPTTTIGSFPQTTEIRGLRLNFKKGNIDKAFYRTNISEHIKQAINEQERLGLDVLVHGEAERNDMVEYFGEHLDGYVFTQNGWVQSYGSRCVKPPVIIGDISRPEPITVDWATYAQSLTSKPVKGMLTGPVTILCWSFPREDVSRETIAKQIALALRDEVDDLQKAGIGIIQIDEPALREGLPLRRAEWAEYLTWAVDAFRLNAAVADNDTQIHTHMCYCEFNDIMDSIAALDADVITIETSRSDMELLEAFEDFDYPNEIGPGVYDIHSPNVPEVEWIEALLRKAADKIAVERLWVNPDCGLKTRGWDETRKALANMVEAARRLRENPLTSR

Flanking regions ( +/- flanking 50bp)

GTTGATTATGGATGTGTAAACATCTGGATGGCTAAATGATAGGATTTTTTATGACGACACATAATCACACTCTGGGTTTTCCGCGTATCGGTCTGAAAAGAGAACTGAAAAAAGCGCTTGAAGGTTACTGGGCAGGACAGATTTCACAGGATGAGCTGCGCGATACCGGCCGTGAATTACGCCGCCGTCACTGGCAGCTGCAAAAAGAGGCCGGGGTTGAATTATTACCGGTCGGGGATTTCGCCTGGTACGATCACGTTCTCGGCACCAGCCTGCTGTTCGGTAATGTGCCACCACGCCATGCCGGTGCCGACGGGAAAATTGACCTCGATACCCTGTTCCGTATTGCCCGCGGCCGTGCACCTTCCGGTGAACCGGCGGCTGCGGCGGAAATGACCAAATGGTTTAATACCAACTATCACTACATTGTGCCGGAGTTTCAGCGCGGGCAAACCTTCACCGTGAGCTGGCCGCAGCTGTTTGACGAGGTGGATGAGGCGCTGGAGCAGGGCTTTGCGGTTAAACCGGTGCTGCTCGGCCCGGTAACCTATCTGTGGCTCGGCAAAGTGAAAGGGGCTCAGTTTGACCGCTTATCATTACTGCCGTCACTGTCAGAAGCCTATAAAAACGTGCTGGAAAAGCTGGCGCAGCGCGGTATTGAGTGGATTCAGATTGATGAACCGGCTCTGGTGCTGGATCTGCCGCCGGAGTGGCAGGATGCTTACCGTACGGCATATGATGCTTTGCAGGGACATGCAAAACTGCTGCTGACCACCTATTTTGACGGAGTAAGCCATCACTTACCGCTGATCCGTGAGTTACCGGTGCAGGGGCTGCACGTCGATTTTGTCGCGGGCGATGATGATATTCAGGCTATCCACGACGCATTACCGGCGGACTGGCTGCTCTCTGCCGGCCTGATTAACGGGCGCAACGTCTGGCGTGCCGATCTGCGGCAAAAATATGATGTAATCGCCCCGCTGGCCGGAAAACGTGACCTGTGGATCGGGACATCCTGCTCATTGCTTCACAGCCCGATTGACCTGCGTGATGAAACCAAACTGGATGAAGAAGTCAAAAGCTGGTTTGCCTTCGCACAGCAGAAATGTGAGGAACTGGCATTGCTGACCCGCGCGGTCAATAGCGGCTCGGCAGATGATATCGCCGCGCTGGCGGAATACAGTGCCCCGATTACCCGCCGCCGTGATTCTTCCCGTGTTCACAATGCTGCGGTGGCAGCCCGGCTGGCGGCGGTAACCGCCCGCGACAGCGAACGCGCCGCGCCGTATGCCGAACGCGCAGAGGAACAGCGCCGCCGTTTTAACCTGCCGCTGTGGCCGACCACCACAATCGGATCTTTCCCGCAAACCACGGAAATCCGTGGGCTGCGTCTGAACTTCAAAAAAGGGAATATCGATAAAGCGTTCTACCGCACTAATATCTCTGAACATATTAAGCAGGCGATTAATGAGCAGGAACGGCTCGGACTGGATGTGCTGGTTCACGGCGAAGCGGAACGTAATGACATGGTGGAGTATTTCGGCGAGCATCTCGACGGCTATGTCTTTACGCAGAACGGCTGGGTGCAGAGCTACGGCTCGCGCTGTGTGAAGCCGCCGGTGATTATCGGTGATATCAGCCGTCCGGAACCGATCACCGTTGACTGGGCGACCTACGCGCAATCCCTCACCAGCAAGCCGGTGAAAGGCATGCTGACCGGGCCGGTAACCATTCTCTGCTGGTCATTCCCGCGTGAAGATGTCAGCCGTGAAACCATTGCCAAACAGATCGCTCTGGCGCTGCGTGATGAAGTGGACGATTTGCAGAAAGCCGGGATCGGTATTATCCAGATCGATGAACCGGCACTGCGCGAAGGGCTGCCGCTGCGCCGGGCAGAATGGGCGGAGTATCTCACCTGGGCGGTAGATGCCTTCCGGCTGAATGCGGCGGTCGCGGATAATGACACCCAGATCCACACCCATATGTGTTACTGCGAATTCAATGACATCATGGATTCTATTGCGGCGCTGGATGCGGATGTGATCACCATTGAAACATCACGCTCGGATATGGAACTGCTGGAAGCATTTGAAGATTTCGATTATCCGAATGAAATCGGGCCGGGTGTTTATGATATTCACTCGCCGAATGTGCCGGAAGTGGAGTGGATTGAAGCCCTGCTGCGCAAAGCGGCGGATAAGATTGCGGTGGAGCGTCTGTGGGTTAACCCGGACTGCGGCCTGAAAACACGCGGCTGGGATGAAACCCGCAAAGCCCTGGCGAACATGGTGGAAGCGGCGCGCCGTCTGCGGGAAAATCCGCTGACATCCCGCTGAGTTTATTTATATATAAAGAAGAAAAAAGCCGGTCAGTAATGACCGGCTTT