Homologs in group_2257

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16975 FBDBKF_16975 91.4 Morganella morganii S1 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
EHELCC_16615 EHELCC_16615 91.4 Morganella morganii S2 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
NLDBIP_16825 NLDBIP_16825 91.4 Morganella morganii S4 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
LHKJJB_16645 LHKJJB_16645 91.4 Morganella morganii S3 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
HKOGLL_17610 HKOGLL_17610 91.4 Morganella morganii S5 metE 5-methyltetrahydropteroyltriglutamate--homocystei ne S-methyltransferase
PMI_RS17540 PMI_RS17540 77.8 Proteus mirabilis HI4320 metE 5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase

Distribution of the homologs in the orthogroup group_2257

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2257

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MZ74 0.0 1258 78 0 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4EWC2 0.0 1251 77 0 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Proteus mirabilis (strain HI4320)
A7FDD3 0.0 1246 78 0 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66FT7 0.0 1243 78 0 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR46 0.0 1241 78 0 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pestis (strain Pestoides F)
Q1CNC1 0.0 1240 78 0 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAL3 0.0 1240 78 0 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pestis
Q1CBG7 0.0 1240 78 0 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A6TGK9 0.0 1229 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XYJ1 0.0 1225 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Klebsiella pneumoniae (strain 342)
A1JIE5 0.0 1224 79 0 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A4WFZ2 0.0 1221 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Enterobacter sp. (strain 638)
A8A6T6 0.0 1221 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O9:H4 (strain HS)
B7M634 0.0 1221 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O8 (strain IAI1)
Q3YVD7 0.0 1219 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella sonnei (strain Ss046)
B6I4H1 0.0 1219 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain SE11)
A7ZU36 0.0 1219 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0SZ21 0.0 1218 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella flexneri serotype 5b (strain 8401)
A8G8B2 0.0 1218 77 0 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Serratia proteamaculans (strain 568)
B1LM00 0.0 1218 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B1IW76 0.0 1217 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FBM1 0.0 1217 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83IW0 0.0 1217 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella flexneri
B7LU25 0.0 1217 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NFD2 0.0 1216 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NV51 0.0 1215 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P25665 0.0 1215 76 1 754 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain K12)
B1XAJ3 0.0 1215 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain K12 / DH10B)
A8ACX7 0.0 1215 77 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q0TAP6 0.0 1214 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R4A4 0.0 1214 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli (strain UTI89 / UPEC)
B7MH94 0.0 1214 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
A1AHZ7 0.0 1213 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O1:K1 / APEC
Q9L6N1 0.0 1212 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TBQ7 0.0 1212 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella heidelberg (strain SL476)
B5FNW1 0.0 1212 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella dublin (strain CT_02021853)
B4TNX3 0.0 1212 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella schwarzengrund (strain CVM19633)
A9MY90 0.0 1212 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q8X8L5 0.0 1212 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O157:H7
Q32A07 0.0 1211 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
B5EZU1 0.0 1211 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella agona (strain SL483)
B5YY78 0.0 1211 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q57HP2 0.0 1211 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella choleraesuis (strain SC-B67)
Q31UF9 0.0 1210 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella boydii serotype 4 (strain Sb227)
B5QW68 0.0 1209 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella enteritidis PT4 (strain P125109)
A9MIY8 0.0 1209 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B2TVH5 0.0 1208 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q8Z3B6 0.0 1208 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella typhi
B5RFN3 0.0 1207 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B4SZ67 0.0 1206 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella newport (strain SL254)
B5BIX4 0.0 1204 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PKP9 0.0 1204 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A7MQM1 0.0 1195 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q6DAS2 0.0 1194 76 1 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NWV8 0.0 1189 75 0 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Sodalis glossinidius (strain morsitans)
B2VI65 0.0 1177 75 2 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q1LU68 0.0 1105 68 2 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q89B24 0.0 1007 61 2 752 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8KA71 0.0 988 60 4 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57142 0.0 983 61 3 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A4SNB5 0.0 967 63 3 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Aeromonas salmonicida (strain A449)
Q6LSD6 0.0 959 61 5 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Photobacterium profundum (strain SS9)
Q7MJM6 0.0 938 60 5 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio vulnificus (strain YJ016)
Q8CWK1 0.0 937 60 5 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio vulnificus (strain CMCP6)
Q491V4 0.0 934 57 2 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Blochmanniella pennsylvanica (strain BPEN)
Q9KRD8 0.0 929 61 6 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B5FFR4 0.0 926 58 6 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Aliivibrio fischeri (strain MJ11)
Q5E430 0.0 925 58 6 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8KRG6 0.0 922 60 4 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio harveyi
Q87NA1 0.0 919 60 4 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MRX1 0.0 915 60 5 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q0VR89 0.0 914 60 9 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q1QZS5 0.0 911 60 4 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A6V1K5 0.0 902 61 5 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas aeruginosa (strain PA7)
Q1I4X3 0.0 900 59 6 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas entomophila (strain L48)
Q2KYF3 0.0 899 58 8 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella avium (strain 197N)
Q02L76 0.0 895 60 6 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q0A6U0 0.0 895 59 5 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B7VAU6 0.0 894 60 6 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas aeruginosa (strain LESB58)
B1J2V4 0.0 894 60 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas putida (strain W619)
P57703 0.0 894 60 6 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4KE22 0.0 891 59 5 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A4XSY1 0.0 891 59 5 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas mendocina (strain ymp)
A4VNE5 0.0 890 59 7 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Stutzerimonas stutzeri (strain A1501)
Q058E7 0.0 890 55 3 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q7W791 0.0 889 59 7 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WKM7 0.0 889 59 7 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VVU3 0.0 889 59 7 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8EIM0 0.0 882 57 5 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q87XJ9 0.0 880 58 5 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B4EJ37 0.0 879 58 8 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q8XS05 0.0 877 59 6 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7VRI8 0.0 875 55 6 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Blochmanniella floridana
B5ELU7 0.0 874 55 6 785 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J432 0.0 874 55 6 785 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A9IKD8 0.0 873 58 8 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q3JAD5 0.0 871 57 2 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B1K5S8 0.0 870 58 8 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia orbicola (strain MC0-3)
Q1BQX8 0.0 869 58 8 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia orbicola (strain AU 1054)
A0B2Z3 0.0 869 58 8 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia cenocepacia (strain HI2424)
Q39AN3 0.0 866 58 9 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B1Z0R8 0.0 865 58 8 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia ambifaria (strain MC40-6)
Q0B6M7 0.0 864 58 8 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A4JJS1 0.0 860 57 7 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q0K0V6 0.0 859 58 4 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B2UJ81 0.0 858 58 8 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Ralstonia pickettii (strain 12J)
Q21N29 0.0 857 54 5 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q2SMS4 0.0 856 56 7 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Hahella chejuensis (strain KCTC 2396)
Q9F187 0.0 854 57 4 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Cupriavidus necator
Q83A62 0.0 853 55 4 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N9C7 0.0 853 55 4 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KDA0 0.0 853 55 4 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain Dugway 5J108-111)
B6J6H8 0.0 851 55 4 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain CbuK_Q154)
B6J3R8 0.0 850 55 4 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Coxiella burnetii (strain CbuG_Q212)
A1TYT7 0.0 848 55 7 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1T007 0.0 847 55 4 764 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B2JNZ4 0.0 847 57 8 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A1AXN4 0.0 846 53 6 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Ruthia magnifica subsp. Calyptogena magnifica
Q3SGL1 0.0 844 56 7 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thiobacillus denitrificans (strain ATCC 25259)
Q87BY8 0.0 843 56 8 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I621 0.0 843 56 8 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Xylella fastidiosa (strain M23)
Q9PB72 0.0 842 55 6 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Xylella fastidiosa (strain 9a5c)
B0U3F5 0.0 840 55 7 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Xylella fastidiosa (strain M12)
Q9JZQ2 0.0 825 54 8 763 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q13MI3 0.0 824 56 6 749 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Paraburkholderia xenovorans (strain LB400)
Q9JUT6 0.0 824 54 8 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M4E3 0.0 823 54 8 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria meningitidis serogroup C (strain 053442)
Q82UP6 0.0 822 54 4 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P45331 0.0 821 53 6 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5F863 0.0 818 53 8 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1KTL3 0.0 817 53 8 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B0UU16 0.0 816 53 6 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Histophilus somni (strain 2336)
Q11EU7 0.0 815 53 5 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Chelativorans sp. (strain BNC1)
Q3JPU6 0.0 814 56 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia pseudomallei (strain 1710b)
B0BQ96 0.0 814 53 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B2TBS1 0.0 813 55 6 747 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A3NY08 0.0 812 56 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia pseudomallei (strain 1106a)
A1V6R3 0.0 812 56 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia mallei (strain SAVP1)
Q62LZ2 0.0 812 56 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia mallei (strain ATCC 23344)
A2S4V8 0.0 812 56 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia mallei (strain NCTC 10229)
A3MHJ9 0.0 812 56 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia mallei (strain NCTC 10247)
Q63RX6 0.0 812 56 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia pseudomallei (strain K96243)
B3GY43 0.0 812 53 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3NC70 0.0 811 56 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia pseudomallei (strain 668)
A3N1F9 0.0 810 53 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A5UBH4 0.0 809 53 6 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Haemophilus influenzae (strain PittEE)
A5UFD9 0.0 807 53 6 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Haemophilus influenzae (strain PittGG)
Q0I3P2 0.0 806 52 6 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Histophilus somni (strain 129Pt)
Q3A7E2 0.0 806 52 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
P57843 0.0 806 53 6 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Pasteurella multocida (strain Pm70)
Q7NS23 0.0 802 55 4 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q605M0 0.0 799 55 4 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q2SY55 0.0 798 57 7 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9AMV8 0.0 796 52 5 769 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A5FJR8 0.0 794 52 10 770 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q9AAW1 0.0 794 53 3 777 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q6N765 0.0 789 52 4 772 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B3QGC4 0.0 785 52 4 772 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Rhodopseudomonas palustris (strain TIE-1)
A7HQP6 0.0 785 53 5 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q3SNK1 0.0 784 53 3 769 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q11PV4 0.0 771 50 7 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q725Q3 0.0 771 51 11 789 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B8DMM2 0.0 766 52 9 780 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q2S338 0.0 762 51 5 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Salinibacter ruber (strain DSM 13855 / M31)
Q9UT19 0.0 757 49 6 758 1 met26 Probable 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q98A73 0.0 756 51 3 768 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B1VV57 0.0 729 50 8 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q82LG4 0.0 725 50 6 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A5G0M4 0.0 724 52 7 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Acidiphilium cryptum (strain JF-5)
O50008 0.0 718 48 8 764 1 MS1 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 1 Arabidopsis thaliana
P05694 0.0 717 49 12 764 1 MET6 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q93J59 0.0 716 49 6 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P82610 0.0 714 47 12 772 1 MET6 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Candida albicans (strain SC5314 / ATCC MYA-2876)
P93263 0.0 711 48 8 762 2 METE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mesembryanthemum crystallinum
Q9SRV5 0.0 710 48 9 764 1 MS2 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 2 Arabidopsis thaliana
Q0WNZ5 0.0 705 48 8 763 1 MS3 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 3, chloroplastic Arabidopsis thaliana
C1KEU0 0.0 701 48 9 760 1 None 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (Fragment) Kali turgidum
Q42699 0.0 699 48 9 762 2 METE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Catharanthus roseus
A4J5C3 0.0 698 46 9 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q42662 0.0 697 48 9 762 1 MET 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Plectranthus scutellarioides
P9WK07 0.0 696 48 7 753 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WK06 0.0 696 48 7 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U1I0 0.0 696 48 7 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KHS4 0.0 696 48 7 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P65341 0.0 696 48 7 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0S6X7 0.0 693 49 12 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Rhodococcus jostii (strain RHA1)
O05564 0.0 691 47 9 766 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium leprae (strain TN)
Q2QLY5 0.0 690 49 9 763 2 Os12g0623900 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 1 Oryza sativa subsp. japonica
Q2QLY4 0.0 689 48 9 763 2 Os12g0624000 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 2 Oryza sativa subsp. japonica
Q9CG55 0.0 684 45 9 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q54X49 0.0 681 44 13 812 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Dictyostelium discoideum
A0QC69 0.0 674 46 8 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycobacterium avium (strain 104)
Q73WJ9 0.0 674 46 8 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A7GS30 0.0 669 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B7H8Z2 0.0 669 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain B4264)
Q819H7 0.0 668 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7IVP2 0.0 668 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain G9842)
Q8Y6K3 0.0 667 46 9 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
C1EQ20 0.0 667 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain 03BB102)
Q6KNA9 0.0 667 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus anthracis
A0RI12 0.0 667 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus thuringiensis (strain Al Hakam)
C3P710 0.0 667 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus anthracis (strain A0248)
A2RKK4 0.0 666 45 8 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
C3LI71 0.0 666 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
Q635S6 0.0 665 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain ZK / E33L)
B7JKY0 0.0 665 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain AH820)
Q731W2 0.0 665 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
B9IWL4 0.0 665 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain Q1)
B7HMX7 0.0 665 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus cereus (strain AH187)
Q02YT3 0.0 663 45 8 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Lactococcus lactis subsp. cremoris (strain SK11)
A9VFA6 0.0 663 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus mycoides (strain KBAB4)
Q6HEG3 0.0 663 46 11 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B8DUK6 0.0 663 45 10 774 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium animalis subsp. lactis (strain AD011)
Q71YY6 0.0 662 46 8 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KVY0 0.0 662 46 8 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q92AX9 0.0 657 46 9 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AJD5 0.0 657 45 8 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q88X63 0.0 655 47 8 768 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A1W0I5 0.0 651 45 8 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FMQ7 0.0 650 45 8 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5HTR3 0.0 649 44 8 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni (strain RM1221)
Q9PN94 0.0 649 44 8 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7H2H6 0.0 645 44 8 757 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A4VXA1 0.0 641 45 10 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus suis (strain 05ZYH33)
B5E298 0.0 639 45 9 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae serotype 19F (strain G54)
A3CL11 0.0 639 45 8 752 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus sanguinis (strain SK36)
Q03L46 0.0 638 44 9 758 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
A8FCD2 0.0 637 46 14 760 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus pumilus (strain SAFR-032)
Q97S31 0.0 637 45 9 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B1IAA7 0.0 637 45 9 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae (strain Hungary19A-6)
Q117R7 0.0 636 44 11 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Trichodesmium erythraeum (strain IMS101)
Q8DQT2 0.0 634 44 9 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04LT6 0.0 634 44 9 753 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8FQB2 0.0 632 45 10 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P80877 0.0 632 46 8 763 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus subtilis (strain 168)
A1A1F4 0.0 631 45 10 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A8AV19 0.0 630 44 8 752 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8G651 0.0 628 44 8 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium longum (strain NCC 2705)
B3DS65 0.0 628 44 8 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium longum (strain DJO10A)
B5YJD3 0.0 627 44 14 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q8DJY0 0.0 624 46 14 767 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
O67606 0.0 624 44 14 772 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Aquifex aeolicus (strain VF5)
B7GRV8 0.0 623 44 11 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q9KFP1 0.0 620 45 10 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A7Z3U1 0.0 619 45 9 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q65KT8 0.0 612 45 10 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B1LC63 0.0 609 43 13 755 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermotoga sp. (strain RQ2)
Q9X112 0.0 609 43 13 755 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q5HS05 0.0 603 44 14 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L330 0.0 603 44 14 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus haemolyticus (strain JCSC1435)
Q8CMP5 0.0 603 44 14 765 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A5IMS4 0.0 603 41 12 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q2JKE8 0.0 601 44 9 756 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
P65343 0.0 600 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain N315)
P65342 0.0 600 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YVH7 0.0 600 45 13 759 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A7WY46 0.0 600 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NY94 0.0 599 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain MW2)
Q6GCB6 0.0 599 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain MSSA476)
Q6GJW2 0.0 599 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain MRSA252)
A5IPT7 0.0 598 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain JH9)
A6TYK8 0.0 598 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain JH1)
A8YZI1 0.0 598 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
A6QE38 0.0 598 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain Newman)
Q5HIT8 0.0 598 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain COL)
Q2G122 0.0 598 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJQ7 0.0 598 45 14 761 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Staphylococcus aureus (strain USA300)
Q8NRB3 0.0 592 43 12 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QDA4 0.0 592 43 12 754 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Corynebacterium glutamicum (strain R)
Q8CWX6 0.0 588 44 13 760 1 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P65345 0.0 587 44 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P65344 0.0 587 44 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus agalactiae serotype III (strain NEM316)
Q3JYS3 0.0 587 44 13 762 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A9B0A2 0.0 577 45 15 763 3 metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q39586 1.56e-178 535 41 19 791 2 None 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase Chlamydomonas reinhardtii
C3N775 8.86e-45 167 30 7 331 3 metE Methionine synthase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NGG0 2.43e-44 166 30 7 332 3 metE Methionine synthase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MWZ5 6.76e-44 164 30 7 331 3 metE Methionine synthase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MR07 6.76e-44 164 30 7 331 3 metE Methionine synthase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C4KID3 6.76e-44 164 30 7 331 3 metE Methionine synthase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3MZ55 6.76e-44 164 30 7 331 3 metE Methionine synthase Sulfolobus islandicus (strain M.16.27)
Q9YA91 1.33e-43 164 33 7 329 3 metE Methionine synthase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q980A9 4.06e-43 162 29 7 331 3 metE Methionine synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q975N4 3.12e-41 157 30 7 331 3 metE Methionine synthase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q4JAI4 6.38e-40 153 29 8 331 3 metE Methionine synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q5JH51 9.02e-35 139 29 9 337 3 metE Methionine synthase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8TH63 1.44e-33 135 28 7 336 3 metE Methionine synthase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9V085 6.63e-31 127 27 6 333 3 metE Methionine synthase Pyrococcus abyssi (strain GE5 / Orsay)
O58816 1.39e-30 126 27 8 334 3 metE Methionine synthase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P57704 3.18e-24 108 32 11 303 3 metE Methionine synthase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q979L4 5.56e-23 104 29 9 301 3 metE Methionine synthase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q58868 3.35e-20 95 26 15 351 3 metE Methionine synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O26869 3.05e-19 92 29 17 336 3 metE Methionine synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P55299 2.84e-18 89 27 12 330 1 metE Methionine synthase Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS18435
Feature type CDS
Gene metE
Product 5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase
Location 20739 - 23021 (strand: -1)
Length 2283 (nucleotides) / 760 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000009
Length 74461 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2257
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01717 Cobalamin-independent synthase, Catalytic domain
PF08267 Cobalamin-independent synthase, N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0620 Amino acid transport and metabolism (E) E Methionine synthase II (cobalamin-independent)

Kegg Ortholog Annotation(s)

Protein Sequence

MTTHNHTLGFPRIGLKRELKKALESYWAGQVSQEELHETGRELRLRHWQQQKEAGVELLPVGDFAWYDHVLGTSLLFGNVPPRHASADGQIDLDTLFRIARGRAPTGEPAAASEMTKWFNTNYHYIVPEFQRGQTFSVSWQQLFDEVDEALAQGFNIKPVLLGPVTYLWLGKVKGASFDRLSLLPSLLAAYKTVLVKLAERGIEWVQVDEPALVLDLPKEWQDAYRTAYDALQGHSKLLLTTYFDSVSHHLPLIRELPVQGLHVDFIAGNDDIQAIHNALPADWLLSLGLINGRNVWRTDLRAKYDSVQAITGKRDLWIGTSCSLLHSPIDLREETKLDEEVKSWFAFAQQKCEELALLTRAVNSGSANDIAALDTYSAPITARRYSKRVHNADVAARLAAITARDSERDAPYEARAKAQRSRFNLPLWPTTTIGSFPQTTEIRGLRLNFKKGNIDKAFYRTNISEHIKQAINEQERLGLDVLVHGEAERNDMVEYFGEHLDGYVFTQNGWVQSYGSRCVKPPVIIGDISRPEPITVEWATYAQSLTSKPVKGMLTGPITILCWSFPREDISRETIAKQIALALRDEVDDLQKAGIGIIQIDEPALREGLPLRRAEWADYLTWAVDAFRLNASVADNDTQIHTHMCYCEFNDIMDSIAALDADVITIETSRSDMELLEVFEDFDYPNEIGPGVYDIHSPNVPEVEWMEALLRKAADKIAVERLWVNPDCGLKTRGWDETRKALANMVEAARRLRANPDYT

Flanking regions ( +/- flanking 50bp)

GATTATGGATGTGTAAACATCTGGATGGCTAAATGACGGGGATTTTTTTTATGACAACACATAATCACACACTGGGTTTTCCGCGTATCGGCTTGAAAAGAGAGCTGAAAAAAGCACTTGAGAGTTATTGGGCAGGACAAGTTTCACAGGAAGAATTACACGAAACTGGGCGGGAACTGCGTCTGCGTCACTGGCAGCAGCAAAAAGAGGCAGGAGTTGAATTATTGCCTGTGGGAGATTTCGCATGGTATGACCATGTGCTGGGTACCAGTCTGCTGTTCGGCAATGTACCGCCGCGTCATGCAAGTGCGGATGGTCAGATTGACCTTGATACCTTGTTCCGTATCGCCCGTGGTCGTGCGCCAACCGGCGAACCGGCAGCCGCATCAGAAATGACCAAATGGTTTAACACCAATTATCACTATATTGTGCCGGAATTTCAGCGCGGGCAAACCTTCAGTGTCAGTTGGCAGCAACTGTTTGACGAAGTGGATGAAGCACTGGCGCAGGGCTTTAATATCAAGCCGGTACTGCTCGGACCGGTAACCTATCTGTGGTTGGGGAAAGTGAAAGGTGCATCATTTGACCGCCTATCATTACTGCCGTCACTGTTAGCAGCCTATAAAACGGTGCTGGTAAAACTGGCAGAGCGCGGTATTGAATGGGTTCAGGTTGATGAACCCGCACTGGTGCTGGATTTGCCAAAAGAGTGGCAGGATGCTTATCGTACGGCATACGATGCATTACAGGGACACAGTAAATTACTCCTGACCACCTATTTTGACAGTGTCAGTCATCACTTACCACTAATCCGCGAACTGCCAGTGCAGGGGCTGCATGTCGATTTTATTGCGGGCAATGATGATATTCAGGCTATCCATAATGCATTACCGGCAGACTGGCTGCTCTCTCTGGGACTGATTAACGGGCGCAATGTATGGCGTACGGATCTCCGTGCTAAATATGATTCAGTGCAGGCGATCACCGGCAAGCGGGATTTGTGGATCGGCACCTCCTGCTCTCTGCTGCACAGCCCGATTGATCTGCGCGAAGAGACAAAATTAGATGAAGAAGTAAAAAGCTGGTTTGCATTCGCACAGCAAAAATGTGAGGAACTGGCACTGCTGACCCGCGCAGTCAACAGTGGTTCAGCGAATGATATTGCCGCACTGGATACGTACAGTGCGCCAATCACAGCGCGGCGTTACTCAAAACGTGTGCATAATGCGGATGTGGCAGCACGTCTGGCAGCCATCACAGCCCGGGACAGTGAGCGTGATGCGCCTTATGAAGCGCGGGCAAAAGCCCAGCGCAGTCGTTTTAATCTGCCGCTGTGGCCGACAACTACCATCGGCTCTTTCCCGCAAACCACGGAAATTCGCGGGCTGCGGCTGAATTTCAAAAAAGGGAATATCGATAAAGCGTTCTACCGCACTAATATCTCAGAACATATTAAGCAGGCAATTAATGAGCAGGAACGGCTCGGGCTGGATGTGCTGGTACACGGCGAAGCCGAGCGCAATGACATGGTGGAATACTTCGGGGAGCATCTCGACGGCTACGTTTTCACTCAAAACGGCTGGGTACAGAGCTATGGCTCCCGCTGTGTTAAACCGCCGGTAATCATCGGTGATATCAGCCGTCCGGAGCCAATCACCGTCGAATGGGCGACTTATGCACAATCCCTCACCAGCAAACCGGTAAAAGGCATGTTAACCGGACCTATCACCATTCTGTGCTGGTCATTCCCGCGTGAAGATATCAGCCGTGAAACTATCGCCAAACAGATTGCGCTGGCACTGCGTGATGAAGTGGATGACCTGCAGAAAGCGGGGATCGGCATTATTCAGATCGACGAACCGGCACTGCGCGAAGGCTTGCCGCTGCGCCGCGCAGAATGGGCGGATTATCTGACGTGGGCGGTGGATGCATTCCGTCTGAATGCCTCAGTTGCAGATAATGATACCCAGATCCACACCCACATGTGTTACTGCGAATTCAATGACATTATGGACTCAATTGCTGCGCTGGATGCGGATGTGATCACTATCGAAACATCACGCTCCGATATGGAACTGCTGGAAGTATTTGAAGATTTTGACTATCCGAATGAGATTGGACCGGGTGTTTATGACATTCACTCACCGAATGTCCCGGAAGTGGAATGGATGGAAGCATTGTTGCGCAAAGCGGCGGATAAAATTGCCGTTGAGCGCCTGTGGGTCAACCCAGACTGTGGTCTGAAAACCCGTGGCTGGGATGAAACCCGCAAAGCCCTGGCAAACATGGTGGAAGCAGCGCGCCGCCTGCGGGCAAATCCGGACTATACTTAATGATAGGTTACACACTGTAATTTAGTGATTTATGTCACGTTTTTATGTAA