Homologs in group_154

Help

9 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17540 FBDBKF_17540 93.0 Morganella morganii S1 tuf elongation factor Tu
EHELCC_19980 EHELCC_19980 88.9 Morganella morganii S2 - hypothetical protein
NLDBIP_19970 NLDBIP_19970 88.9 Morganella morganii S4 - hypothetical protein
LHKJJB_19935 LHKJJB_19935 88.9 Morganella morganii S3 - hypothetical protein
HKOGLL_19750 HKOGLL_19750 88.9 Morganella morganii S5 - hypothetical protein
F4V73_RS14925 F4V73_RS14925 92.6 Morganella psychrotolerans tuf elongation factor Tu
F4V73_RS18900 F4V73_RS18900 92.6 Morganella psychrotolerans tuf elongation factor Tu
PMI_RS11060 PMI_RS11060 29.8 Proteus mirabilis HI4320 cysN sulfate adenylyltransferase subunit CysN
PMI_RS13790 PMI_RS13790 99.5 Proteus mirabilis HI4320 tuf elongation factor Tu

Distribution of the homologs in the orthogroup group_154

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_154

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A6TEX7 0 741 95 0 394 3 tufA Elongation factor Tu Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MKI5 0 736 94 0 394 3 tuf1 Elongation factor Tu Cronobacter sakazakii (strain ATCC BAA-894)
P0A1H5 0 736 94 0 394 3 tufA Elongation factor Tu Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1H6 0 736 94 0 394 3 tufA Elongation factor Tu Salmonella typhi
A9MT05 0 736 94 0 394 3 tuf1 Elongation factor Tu Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PIW4 0 736 94 0 394 3 tuf1 Elongation factor Tu Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57H76 0 736 94 0 394 3 tuf1 Elongation factor Tu Salmonella choleraesuis (strain SC-B67)
A9MHG0 0 736 94 0 394 3 tuf1 Elongation factor Tu Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q83JC4 0 734 94 0 394 3 tufA Elongation factor Tu Shigella flexneri
Q32B27 0 734 94 0 394 3 tuf1 Elongation factor Tu Shigella dysenteriae serotype 1 (strain Sd197)
Q31VV0 0 734 94 0 394 3 tuf1 Elongation factor Tu Shigella boydii serotype 4 (strain Sb227)
A4W5A0 0 734 94 0 393 3 tuf1 Elongation factor Tu Enterobacter sp. (strain 638)
Q3YWT3 0 734 94 0 394 3 tuf1 Elongation factor Tu 1 Shigella sonnei (strain Ss046)
Q1R5Y2 0 734 94 0 394 1 tuf1 Elongation factor Tu 1 Escherichia coli (strain UTI89 / UPEC)
P0CE47 0 734 94 0 394 1 tufA Elongation factor Tu 1 Escherichia coli (strain K12)
B1IPW0 0 734 94 0 394 3 tuf1 Elongation factor Tu 1 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TCC0 0 734 94 0 394 3 tuf1 Elongation factor Tu 1 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGM6 0 734 94 0 394 3 tuf1 Elongation factor Tu 1 Escherichia coli O1:K1 / APEC
A8A5E6 0 734 94 0 394 3 tuf1 Elongation factor Tu 1 Escherichia coli O9:H4 (strain HS)
A7ZSL4 0 734 94 0 394 3 tuf1 Elongation factor Tu 1 Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0SZX8 0 734 94 0 394 3 tuf1 Elongation factor Tu 1 Shigella flexneri serotype 5b (strain 8401)
P0A6N2 0 733 94 0 393 3 tufA Elongation factor Tu Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A6N3 0 733 94 0 393 3 tufA Elongation factor Tu Escherichia coli O157:H7
Q3YV04 0 733 94 0 393 3 tuf2 Elongation factor Tu 2 Shigella sonnei (strain Ss046)
Q0SY20 0 733 94 0 393 3 tuf2 Elongation factor Tu 2 Shigella flexneri serotype 5b (strain 8401)
Q1R5U4 0 733 94 0 393 3 tuf2 Elongation factor Tu 2 Escherichia coli (strain UTI89 / UPEC)
P0CE48 0 733 94 0 393 1 tufB Elongation factor Tu 2 Escherichia coli (strain K12)
B1IVA7 0 733 94 0 393 3 tuf2 Elongation factor Tu 2 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TA85 0 733 94 0 393 3 tuf2 Elongation factor Tu 2 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AIF3 0 733 94 0 393 3 tuf2 Elongation factor Tu 2 Escherichia coli O1:K1 / APEC
A8A779 0 733 94 0 393 3 tuf2 Elongation factor Tu 2 Escherichia coli O9:H4 (strain HS)
C4K4F8 0 732 89 0 393 3 tuf Elongation factor Tu Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A7ZUJ2 0 731 94 0 393 3 tuf2 Elongation factor Tu 2 Escherichia coli O139:H28 (strain E24377A / ETEC)
Q7MYE8 0 731 94 0 393 3 tuf2 Elongation factor Tu 2 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4TS36 0 730 93 0 393 3 tuf2 Elongation factor Tu 2 Yersinia pestis (strain Pestoides F)
Q8ZAN8 0 730 93 0 393 3 tufB Elongation factor Tu-B Yersinia pestis
Q1C1T4 0 730 93 0 393 3 tuf2 Elongation factor Tu 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q66FQ9 0 730 93 0 393 3 tuf1 Elongation factor Tu 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FNJ0 0 730 93 0 393 3 tuf1 Elongation factor Tu 1 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7N9B1 0 729 94 0 393 3 tuf1 Elongation factor Tu 1 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1CN86 0 728 93 0 393 3 tuf1 Elongation factor Tu 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q65QG6 0 726 93 0 393 3 tuf1 Elongation factor Tu Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q2NQL7 0 725 92 0 393 3 tuf1 Elongation factor Tu Sodalis glossinidius (strain morsitans)
Q6CZW6 0 725 93 0 393 3 tuf1 Elongation factor Tu Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q664R7 0 725 93 0 393 3 tuf2 Elongation factor Tu 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CCT9 0 725 93 0 393 3 tuf2 Elongation factor Tu 2 Yersinia pestis bv. Antiqua (strain Nepal516)
A7FNN8 0 725 93 0 393 3 tuf2 Elongation factor Tu 2 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8GKK1 0 725 93 0 393 3 tuf2 Elongation factor Tu 2 Serratia proteamaculans (strain 568)
A4TGY7 0 725 93 0 393 3 tuf1 Elongation factor Tu 1 Yersinia pestis (strain Pestoides F)
Q8ZJB2 0 725 93 0 393 3 tufA Elongation factor Tu-A Yersinia pestis
Q1C2U1 0 725 93 0 393 3 tuf1 Elongation factor Tu 1 Yersinia pestis bv. Antiqua (strain Antiqua)
A8G8E0 0 723 93 0 393 3 tuf1 Elongation factor Tu 1 Serratia proteamaculans (strain 568)
Q0I0B9 0 722 87 0 394 3 tuf1 Elongation factor Tu 1 Shewanella sp. (strain MR-7)
Q0HNV1 0 722 87 0 394 3 tuf1 Elongation factor Tu 1 Shewanella sp. (strain MR-4)
A0KRL0 0 719 87 0 394 3 tuf1 Elongation factor Tu Shewanella sp. (strain ANA-3)
A1JIH3 0 719 92 0 393 3 tuf1 Elongation factor Tu 1 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P43926 0 718 92 0 393 3 tufA Elongation factor Tu Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UHC1 0 718 92 0 393 3 tuf Elongation factor Tu Haemophilus influenzae (strain PittGG)
A5U9R1 0 718 92 0 393 3 tuf1 Elongation factor Tu Haemophilus influenzae (strain PittEE)
Q4QMT5 0 718 92 0 393 3 tuf2 Elongation factor Tu 2 Haemophilus influenzae (strain 86-028NP)
A6VKH7 0 717 92 0 393 3 tuf1 Elongation factor Tu Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q4QMW6 0 717 92 0 393 3 tuf1 Elongation factor Tu 1 Haemophilus influenzae (strain 86-028NP)
A1JS52 0 716 91 0 393 3 tuf2 Elongation factor Tu 2 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P57939 0 713 91 0 393 3 tufA Elongation factor Tu-A Pasteurella multocida (strain Pm70)
Q7TTF9 0 710 91 0 393 3 tufA Elongation factor Tu Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q1LSY4 0 709 86 0 393 3 tuf Elongation factor Tu Baumannia cicadellinicola subsp. Homalodisca coagulata
Q0I0A7 0 709 87 0 394 3 tuf2 Elongation factor Tu 2 Shewanella sp. (strain MR-7)
B0BQZ3 0 708 91 0 393 3 tuf1 Elongation factor Tu Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N246 0 708 91 0 393 3 tuf1 Elongation factor Tu Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0UV21 0 707 90 0 393 3 tuf Elongation factor Tu Histophilus somni (strain 2336)
Q0I1U9 0 707 90 0 393 3 tuf1 Elongation factor Tu Histophilus somni (strain 129Pt)
P57966 0 707 90 0 393 3 tufB Elongation factor Tu-B Pasteurella multocida (strain Pm70)
Q0HNT9 0 706 87 0 394 3 tuf2 Elongation factor Tu 2 Shewanella sp. (strain MR-4)
Q8EK70 0 706 87 0 394 3 tuf2 Elongation factor Tu 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B4RYQ8 0 705 89 0 393 3 tuf Elongation factor Tu Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q8EK81 0 704 87 0 393 3 tuf1 Elongation factor Tu 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A5F3K0 0 699 89 0 393 3 tuf1 Elongation factor Tu Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KUZ6 0 699 89 0 393 3 tufB Elongation factor Tu-B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q15NP2 0 698 88 0 393 3 tuf1 Elongation factor Tu Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A3Q980 0 696 89 0 393 3 tuf2 Elongation factor Tu 2 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q9KV37 0 696 89 0 393 3 tufA Elongation factor Tu-A Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q12SW1 0 695 87 0 394 3 tuf Elongation factor Tu Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A3Q968 0 695 88 0 393 3 tuf1 Elongation factor Tu 1 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1S204 0 694 88 0 392 3 tuf1 Elongation factor Tu Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A0KQ95 0 692 88 0 393 3 tuf1 Elongation factor Tu Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P33169 0 690 87 0 393 3 tuf Elongation factor Tu Shewanella putrefaciens
A4YBY5 0 690 87 0 393 3 tuf1 Elongation factor Tu Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
P59506 0 689 86 0 393 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q492B2 0 687 84 0 393 3 tuf Elongation factor Tu Blochmanniella pennsylvanica (strain BPEN)
Q089R8 0 687 86 0 394 3 tuf1 Elongation factor Tu 1 Shewanella frigidimarina (strain NCIMB 400)
O31298 0 687 89 0 393 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q5QWA3 0 686 87 0 393 3 tuf1 Elongation factor Tu Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q089Q6 0 686 86 0 394 3 tuf2 Elongation factor Tu 2 Shewanella frigidimarina (strain NCIMB 400)
A8G1F0 0 686 87 0 393 3 tuf Elongation factor Tu Shewanella sediminis (strain HAW-EB3)
Q057A2 0 684 87 0 393 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Cinara cedri (strain Cc)
A4SHU2 0 682 87 0 393 3 tuf1 Elongation factor Tu Aeromonas salmonicida (strain A449)
A8GYW2 0 682 87 0 393 3 tuf1 Elongation factor Tu Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TM14 0 681 87 0 393 3 tuf1 Elongation factor Tu Shewanella halifaxensis (strain HAW-EB4)
Q7MH43 0 681 88 0 393 3 tuf1 Elongation factor Tu 1 Vibrio vulnificus (strain YJ016)
Q8DCQ7 0 681 88 0 393 3 tuf2 Elongation factor Tu 2 Vibrio vulnificus (strain CMCP6)
Q7VRP0 0 680 85 0 393 3 tuf Elongation factor Tu Blochmanniella floridana
Q7MGR1 0 680 88 0 393 3 tuf2 Elongation factor Tu 2 Vibrio vulnificus (strain YJ016)
Q8DD27 0 680 88 0 393 3 tuf1 Elongation factor Tu 1 Vibrio vulnificus (strain CMCP6)
A5EX84 0 679 83 1 395 3 tuf Elongation factor Tu Dichelobacter nodosus (strain VCS1703A)
P09591 0 679 82 1 396 1 tufA Elongation factor Tu Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02T82 0 679 82 1 396 1 tuf1 Elongation factor Tu Pseudomonas aeruginosa (strain UCBPP-PA14)
A6UZH4 0 679 82 1 396 3 tuf1 Elongation factor Tu Pseudomonas aeruginosa (strain PA7)
B8D851 0 679 88 0 393 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
O31297 0 679 88 0 393 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9U9 0 679 88 0 393 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A9KW88 0 678 88 0 393 3 tuf1 Elongation factor Tu 1 Shewanella baltica (strain OS195)
A6WHR4 0 677 88 0 393 3 tuf1 Elongation factor Tu Shewanella baltica (strain OS185)
A9KWA0 0 677 88 0 393 3 tuf2 Elongation factor Tu 2 Shewanella baltica (strain OS195)
A3DBA0 0 677 88 0 393 3 tuf2 Elongation factor Tu 2 Shewanella baltica (strain OS155 / ATCC BAA-1091)
A3DA74 0 677 88 0 393 3 tuf1 Elongation factor Tu 1 Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q3ILP4 0 677 85 0 394 3 tuf1 Elongation factor Tu 1 Pseudoalteromonas translucida (strain TAC 125)
A7MXE4 0 676 88 0 393 3 tuf1 Elongation factor Tu Vibrio campbellii (strain ATCC BAA-1116)
A1KRF9 0 675 84 0 394 3 tuf1 Elongation factor Tu Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P64027 0 675 84 0 394 1 tufA Elongation factor Tu Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P64026 0 675 84 0 394 3 tufA Elongation factor Tu Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q3IJV1 0 675 85 0 394 3 tuf2 Elongation factor Tu 2 Pseudoalteromonas translucida (strain TAC 125)
Q877T5 0 674 87 0 393 3 tufA Elongation factor Tu Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5F5Q8 0 673 83 0 394 3 tuf1 Elongation factor Tu Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A4JAM5 0 672 81 1 395 3 tuf1 Elongation factor Tu Burkholderia vietnamiensis (strain G4 / LMG 22486)
P42481 0 671 81 1 395 3 tuf Elongation factor Tu Thiomonas delicata
Q1H4Q1 0 671 82 1 395 3 tuf1 Elongation factor Tu 1 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A4SUU7 0 670 81 1 395 3 tuf1 Elongation factor Tu Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q13TF5 0 670 81 1 395 3 tuf1 Elongation factor Tu Paraburkholderia xenovorans (strain LB400)
Q7TT91 0 670 81 1 395 3 tuf1 Elongation factor Tu Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q79GC6 0 670 81 1 395 3 tuf1 Elongation factor Tu Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q79G84 0 670 81 1 395 3 tuf1 Elongation factor Tu Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q1H4N9 0 669 82 1 395 3 tuf2 Elongation factor Tu 2 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q8D240 0 669 83 0 393 3 tuf Elongation factor Tu Wigglesworthia glossinidia brevipalpis
Q83ES6 0 669 80 2 396 1 tufA Elongation factor Tu Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NAK7 0 669 80 2 396 3 tuf1 Elongation factor Tu Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KD33 0 669 80 2 396 3 tuf1 Elongation factor Tu Coxiella burnetii (strain Dugway 5J108-111)
Q1BRT3 0 669 81 1 395 3 tuf1 Elongation factor Tu Burkholderia orbicola (strain AU 1054)
Q39KI2 0 669 81 1 395 3 tuf1 Elongation factor Tu Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BJ48 0 669 81 1 395 3 tuf1 Elongation factor Tu Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0K3L0 0 669 81 1 395 3 tuf1 Elongation factor Tu Burkholderia cenocepacia (strain HI2424)
Q6LLV5 0 668 87 0 393 3 tuf2 Elongation factor Tu 2 Photobacterium profundum (strain SS9)
Q2SU25 0 668 80 1 395 3 tuf1 Elongation factor Tu Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PZ6 0 668 80 1 395 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain K96243)
A3NEI1 0 668 80 1 395 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 668)
Q3JMP6 0 668 80 1 395 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 1710b)
A3P0B5 0 668 80 1 395 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 1106a)
A1V8A5 0 668 80 1 395 3 tuf1 Elongation factor Tu Burkholderia mallei (strain SAVP1)
Q62GK3 0 668 80 1 395 3 tuf1 Elongation factor Tu Burkholderia mallei (strain ATCC 23344)
A2S7F9 0 668 80 1 395 3 tuf1 Elongation factor Tu Burkholderia mallei (strain NCTC 10229)
A3MRT8 0 668 80 1 395 3 tuf1 Elongation factor Tu Burkholderia mallei (strain NCTC 10247)
Q2L2G6 0 668 81 1 395 3 tuf1 Elongation factor Tu Bordetella avium (strain 197N)
Q47UU9 0 667 83 0 393 3 tuf1 Elongation factor Tu Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
P33167 0 667 81 1 395 3 tuf Elongation factor Tu Burkholderia cepacia
Q3SLQ1 0 667 82 1 394 3 tuf1 Elongation factor Tu Thiobacillus denitrificans (strain ATCC 25259)
Q605B0 0 666 81 2 395 3 tuf1 Elongation factor Tu Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q2YAZ9 0 666 80 1 395 3 tuf1 Elongation factor Tu Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q6LVC0 0 666 87 0 393 3 tuf1 Elongation factor Tu 1 Photobacterium profundum (strain SS9)
P48864 0 665 83 0 394 3 tuf Elongation factor Tu Neisseria gonorrhoeae
Q0K5Z9 0 664 80 1 395 3 tuf1 Elongation factor Tu Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1LI13 0 664 80 1 395 3 tuf1 Elongation factor Tu Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A4VHM8 0 664 80 1 396 3 tuf2 Elongation factor Tu 2 Stutzerimonas stutzeri (strain A1501)
A4XZ92 0 663 80 1 396 3 tuf Elongation factor Tu Pseudomonas mendocina (strain ymp)
Q21RV6 0 663 80 1 395 3 tuf2 Elongation factor Tu 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21SF0 0 663 80 1 395 3 tuf1 Elongation factor Tu 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8XGZ0 0 663 80 1 395 3 tufA Elongation factor Tu Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q46WC7 0 663 80 1 395 3 tuf1 Elongation factor Tu Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q3J8Q0 0 662 79 1 395 3 tuf1 Elongation factor Tu Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A4VHL6 0 662 80 1 396 3 tuf1 Elongation factor Tu 1 Stutzerimonas stutzeri (strain A1501)
C5BQ44 0 661 79 2 406 3 tuf Elongation factor Tu Teredinibacter turnerae (strain ATCC 39867 / T7901)
A1VIP8 0 661 80 1 395 3 tuf1 Elongation factor Tu Polaromonas naphthalenivorans (strain CJ2)
A6T3K6 0 661 80 1 395 3 tuf1 Elongation factor Tu Janthinobacterium sp. (strain Marseille)
A6W394 0 661 79 2 406 3 tuf Elongation factor Tu Marinomonas sp. (strain MWYL1)
Q21M86 0 660 79 3 406 3 tuf1 Elongation factor Tu Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A1T056 0 659 83 0 393 3 tuf Elongation factor Tu Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q123F6 0 659 79 1 395 3 tuf1 Elongation factor Tu Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q4K519 0 657 79 1 396 3 tuf1 Elongation factor Tu Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q81ZS3 0 657 82 1 395 3 tuf1 Elongation factor Tu Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q3BWY6 0 657 78 1 395 3 tuf1 Elongation factor Tu Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8NL22 0 657 78 1 395 3 tufA Elongation factor Tu Xanthomonas axonopodis pv. citri (strain 306)
A3M1F6 0 654 85 1 394 3 tuf1 Elongation factor Tu Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B7H1K5 0 654 85 1 394 3 tuf Elongation factor Tu Acinetobacter baumannii (strain AB307-0294)
Q5WZL4 0 654 82 2 395 3 tuf1 Elongation factor Tu Legionella pneumophila (strain Lens)
Q5ZYP5 0 654 82 2 395 3 tuf1 Elongation factor Tu Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IHR6 0 654 82 2 395 3 tuf1 Elongation factor Tu Legionella pneumophila (strain Corby)
Q5X873 0 654 82 2 395 3 tuf1 Elongation factor Tu Legionella pneumophila (strain Paris)
Q6FF97 0 653 84 1 394 3 tuf1 Elongation factor Tu Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0TX03 0 652 82 0 393 3 tuf Elongation factor Tu Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A1WVD6 0 652 78 1 395 3 tuf2 Elongation factor Tu 2 Halorhodospira halophila (strain DSM 244 / SL1)
A8F2E9 0 652 79 0 392 3 tuf Elongation factor Tu Rickettsia massiliae (strain Mtu5)
Q5GWR8 0 652 78 1 395 3 tuf1 Elongation factor Tu Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NZX1 0 652 78 1 395 3 tuf1 Elongation factor Tu Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A1WVC4 0 651 78 1 395 3 tuf1 Elongation factor Tu 1 Halorhodospira halophila (strain DSM 244 / SL1)
A8EZL8 0 651 79 0 392 3 tuf Elongation factor Tu Rickettsia canadensis (strain McKiel)
A8GT71 0 650 79 0 392 3 tuf Elongation factor Tu Rickettsia rickettsii (strain Sheila Smith)
B0BUR2 0 650 79 0 392 3 tuf Elongation factor Tu Rickettsia rickettsii (strain Iowa)
C4K2I2 0 650 79 0 392 3 tuf Elongation factor Tu Rickettsia peacockii (strain Rustic)
Q8KTA1 0 650 79 0 392 3 tuf Elongation factor Tu Rickettsia montanensis
C3PPA9 0 650 79 0 392 3 tuf Elongation factor Tu Rickettsia africae (strain ESF-5)
A1TYJ5 0 650 83 2 397 3 tuf Elongation factor Tu Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q8KTA6 0 650 79 0 392 3 tuf Elongation factor Tu Rickettsia parkeri
Q2S8Z8 0 650 83 1 396 3 tuf1 Elongation factor Tu Hahella chejuensis (strain KCTC 2396)
Q8KT99 0 649 79 0 392 3 tuf Elongation factor Tu Rickettsia helvetica
Q0ABH7 0 649 82 1 395 3 tuf1 Elongation factor Tu Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q92GW4 0 648 79 0 392 3 tuf Elongation factor Tu Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q0VSL7 0 648 83 1 394 3 tuf1 Elongation factor Tu Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A5WGK9 0 648 82 1 394 3 tuf1 Elongation factor Tu 1 Psychrobacter sp. (strain PRwf-1)
P0A3B0 0 647 79 0 392 3 tuf Elongation factor Tu Rickettsia sibirica
P0A3A9 0 647 79 0 392 3 tuf Elongation factor Tu Rickettsia rickettsii
Q889X3 0 647 77 1 397 3 tuf Elongation factor Tu Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q7M7F1 0 647 81 1 395 3 tuf1 Elongation factor Tu Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A5WH42 0 647 82 1 394 3 tuf2 Elongation factor Tu 2 Psychrobacter sp. (strain PRwf-1)
Q0AIJ7 0 647 80 1 395 3 tuf1 Elongation factor Tu 1 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
P48865 0 646 78 0 392 3 tuf Elongation factor Tu Rickettsia prowazekii (strain Madrid E)
O31300 0 646 88 0 365 3 tuf Elongation factor Tu (Fragment) Buchnera aphidicola subsp. Melaphis rhois
Q8KT97 0 645 78 0 392 3 tuf Elongation factor Tu Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q0AF46 0 645 80 1 395 3 tuf2 Elongation factor Tu 2 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A4G9U0 0 645 80 1 395 3 tuf1 Elongation factor Tu Herminiimonas arsenicoxydans
Q47JA5 0 645 80 1 395 3 tuf1 Elongation factor Tu Dechloromonas aromatica (strain RCB)
O31301 0 645 88 0 365 3 tuf Elongation factor Tu (Fragment) Buchnera aphidicola subsp. Schlechtendalia chinensis
B0RU96 0 645 77 1 395 3 tuf2 Elongation factor Tu 2 Xanthomonas campestris pv. campestris (strain B100)
Q4URC5 0 645 77 1 395 3 tuf2 Elongation factor Tu 2 Xanthomonas campestris pv. campestris (strain 8004)
Q8PC59 0 645 77 1 395 3 tufA Elongation factor Tu-A Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A6Q1L5 0 644 78 1 398 3 tuf Elongation factor Tu Nitratiruptor sp. (strain SB155-2)
Q8PC51 0 644 77 1 395 3 tufB Elongation factor Tu-B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4URD7 0 644 77 1 395 3 tuf1 Elongation factor Tu 1 Xanthomonas campestris pv. campestris (strain 8004)
Q134R0 0 644 77 2 398 3 tuf2 Elongation factor Tu 2 Rhodopseudomonas palustris (strain BisB5)
Q8KT95 0 643 78 0 392 3 tuf Elongation factor Tu Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q07KJ2 0 643 77 1 395 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain BisA53)
Q4ZMP2 0 643 77 1 397 3 tuf Elongation factor Tu Pseudomonas syringae pv. syringae (strain B728a)
Q2W2H3 0 643 77 1 395 3 tuf1 Elongation factor Tu Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q134S7 0 643 77 2 398 3 tuf1 Elongation factor Tu 1 Rhodopseudomonas palustris (strain BisB5)
Q2IXR2 0 643 77 1 395 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain HaA2)
C3K2X8 0 643 77 1 396 3 tuf Elongation factor Tu Pseudomonas fluorescens (strain SBW25)
B0RU84 0 643 77 1 395 3 tuf1 Elongation factor Tu 1 Xanthomonas campestris pv. campestris (strain B100)
Q6N4Q4 0 642 77 2 398 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q48D34 0 642 77 1 397 3 tuf Elongation factor Tu Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A4IW92 0 642 81 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain WY96-3418)
Q0BKB8 0 642 81 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain OSU18)
A0Q874 0 642 81 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. novicida (strain U112)
B2SFC9 0 642 81 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A1M0 0 642 81 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain LVS)
A7NEC7 0 642 81 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q9P9Q9 0 642 78 1 396 1 tufA Elongation factor Tu Xylella fastidiosa (strain 9a5c)
Q5NID9 0 642 80 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JU2 0 642 80 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain FSC 198)
Q3SSW8 0 641 77 1 395 3 tuf Elongation factor Tu Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q8KTA3 0 641 78 0 392 3 tuf Elongation factor Tu Rickettsia rhipicephali
A1W2Q5 0 640 82 1 395 3 tuf1 Elongation factor Tu 1 Acidovorax sp. (strain JS42)
Q877P8 0 640 77 1 396 3 tufA Elongation factor Tu Xylella fastidiosa (strain Temecula1 / ATCC 700964)
A1WCN6 0 639 81 1 395 3 tuf2 Elongation factor Tu 2 Acidovorax sp. (strain JS42)
Q211E6 0 637 76 1 395 3 tuf Elongation factor Tu Rhodopseudomonas palustris (strain BisB18)
Q01SX2 0 637 76 1 394 3 tuf1 Elongation factor Tu Solibacter usitatus (strain Ellin6076)
Q1QN32 0 637 76 1 395 3 tuf Elongation factor Tu Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q0BUQ2 0 637 77 1 394 3 tuf Elongation factor Tu Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A7HWP7 0 635 77 1 395 3 tuf1 Elongation factor Tu Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A1WHC3 0 634 80 1 395 3 tuf1 Elongation factor Tu Verminephrobacter eiseniae (strain EF01-2)
Q3K5X4 0 634 78 1 396 3 tuf1 Elongation factor Tu Pseudomonas fluorescens (strain Pf0-1)
Q1D7V1 0 634 76 1 395 3 tuf1 Elongation factor Tu 1 Myxococcus xanthus (strain DK1622)
A7HBL7 0 633 76 1 395 3 tuf1 Elongation factor Tu Anaeromyxobacter sp. (strain Fw109-5)
Q1D776 0 633 76 1 395 3 tuf2 Elongation factor Tu 2 Myxococcus xanthus (strain DK1622)
A2SLF9 0 633 78 1 395 3 tuf1 Elongation factor Tu Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q5FTY1 0 633 77 2 394 3 tuf Elongation factor Tu Gluconobacter oxydans (strain 621H)
Q8R7V2 0 632 75 2 399 3 tufA Elongation factor Tu-A Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A9H3R7 0 631 76 2 394 3 tuf Elongation factor Tu Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B2UQY9 0 631 74 0 393 3 tuf Elongation factor Tu Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q6AP73 0 631 76 1 395 3 tuf2 Elongation factor Tu 2 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q8R7T8 0 630 75 2 399 3 tufB Elongation factor Tu-B Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A1TJ05 0 629 80 1 395 3 tuf1 Elongation factor Tu Paracidovorax citrulli (strain AAC00-1)
A0RQJ3 0 629 74 1 399 3 tuf Elongation factor Tu Campylobacter fetus subsp. fetus (strain 82-40)
A7GK18 0 629 79 1 394 3 tuf Elongation factor Tu Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B1JDW6 0 629 77 1 396 3 tuf1 Elongation factor Tu Pseudomonas putida (strain W619)
B0KK53 0 629 77 1 396 3 tuf1 Elongation factor Tu Pseudomonas putida (strain GB-1)
A5VXN3 0 629 77 1 396 3 tuf Elongation factor Tu Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q1IFW8 0 629 77 1 396 3 tuf1 Elongation factor Tu Pseudomonas entomophila (strain L48)
Q88QN7 0 629 77 1 396 3 tufB Elongation factor Tu-B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88QP8 0 629 77 1 396 1 tufA Elongation factor Tu-A Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6AP86 0 629 76 1 396 3 tuf1 Elongation factor Tu 1 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A7ZCN0 0 629 74 1 399 3 tuf Elongation factor Tu Campylobacter concisus (strain 13826)
Q7VJ74 0 628 75 1 398 3 tuf Elongation factor Tu Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q5P334 0 628 83 1 395 3 tuf1 Elongation factor Tu Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q2II78 0 628 78 1 395 3 tuf1 Elongation factor Tu Anaeromyxobacter dehalogenans (strain 2CP-C)
A8GPF2 0 627 77 1 393 3 tuf Elongation factor Tu Rickettsia akari (strain Hartford)
B1HMZ0 0 627 78 1 393 3 tuf Elongation factor Tu Lysinibacillus sphaericus (strain C3-41)
A1KB29 0 627 82 1 395 3 tuf1 Elongation factor Tu Azoarcus sp. (strain BH72)
A1ALS6 0 627 79 1 395 3 tuf1 Elongation factor Tu Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q748X8 0 625 79 1 395 3 tuf1 Elongation factor Tu Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q250N4 0 625 74 2 399 3 tuf Elongation factor Tu Desulfitobacterium hafniense (strain Y51)
B8G1W4 0 625 74 2 399 3 tuf Elongation factor Tu Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A4J0Z5 0 624 75 2 398 3 tuf Elongation factor Tu Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A0LRL8 0 624 76 2 396 3 tuf Elongation factor Tu Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q1IHG6 0 624 75 1 394 3 tuf1 Elongation factor Tu Koribacter versatilis (strain Ellin345)
A7GZK6 0 624 74 1 399 3 tuf Elongation factor Tu Campylobacter curvus (strain 525.92)
A1B002 0 624 76 3 395 3 tuf1 Elongation factor Tu Paracoccus denitrificans (strain Pd 1222)
A5FZW7 0 624 76 3 394 3 tuf Elongation factor Tu Acidiphilium cryptum (strain JF-5)
P42482 0 623 75 1 397 3 tuf Elongation factor Tu Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P42479 0 623 76 1 396 3 tuf Elongation factor Tu Stigmatella aurantiaca
A5GAW4 0 623 79 1 395 3 tuf1 Elongation factor Tu Geotalea uraniireducens (strain Rf4)
B9KFF9 0 623 74 1 398 3 tuf Elongation factor Tu Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q8R603 0 623 78 0 392 3 tuf Elongation factor Tu Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A1AX82 0 623 79 1 394 3 tuf2 Elongation factor Tu 2 Ruthia magnifica subsp. Calyptogena magnifica
A5V604 0 622 75 1 394 3 tuf Elongation factor Tu Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q2RQU6 0 622 78 1 395 3 tuf2 Elongation factor Tu 2 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q30X13 0 622 78 1 396 3 tuf Elongation factor Tu Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q1R0H7 0 622 79 1 396 3 tuf Elongation factor Tu Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q5HVZ7 0 622 73 1 398 3 tuf Elongation factor Tu Campylobacter jejuni (strain RM1221)
A1VYI6 0 622 73 1 398 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
O69303 0 622 73 1 398 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7H4R3 0 622 73 1 398 3 tuf Elongation factor Tu Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FKQ5 0 622 73 1 398 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q1Q8P2 0 621 82 1 395 3 tuf1 Elongation factor Tu Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A1SNN5 0 621 74 2 395 3 tuf Elongation factor Tu Nocardioides sp. (strain ATCC BAA-499 / JS614)
A1AVJ8 0 620 78 1 394 3 tuf1 Elongation factor Tu 1 Ruthia magnifica subsp. Calyptogena magnifica
B7GJ65 0 620 77 1 394 3 tuf Elongation factor Tu Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q2RQV8 0 620 78 1 395 3 tuf1 Elongation factor Tu 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A5N4N1 0 619 75 2 395 3 tuf1 Elongation factor Tu Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
A5CW32 0 619 77 1 394 3 tuf1 Elongation factor Tu Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
C6C171 0 619 79 1 396 3 tuf Elongation factor Tu Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A4IJI7 0 619 77 1 394 3 tuf Elongation factor Tu Geobacillus thermodenitrificans (strain NG80-2)
C5D3R5 0 619 78 1 394 3 tuf Elongation factor Tu Geobacillus sp. (strain WCH70)
Q3AMT6 0 618 73 1 398 3 tuf Elongation factor Tu Synechococcus sp. (strain CC9605)
Q2RFP5 0 618 74 2 399 3 tuf Elongation factor Tu Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q0AUG3 0 618 74 2 398 3 tuf2 Elongation factor Tu 2 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q0AUH8 0 618 74 2 398 3 tuf1 Elongation factor Tu 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q1RHL9 0 617 75 1 394 3 tuf Elongation factor Tu Rickettsia bellii (strain RML369-C)
A8GVB2 0 617 75 1 394 3 tuf Elongation factor Tu Rickettsia bellii (strain OSU 85-389)
O21245 0 617 72 0 393 3 TUFA Elongation factor Tu, mitochondrial Reclinomonas americana
Q4FQG6 0 617 81 1 394 3 tuf1 Elongation factor Tu Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
C0Q9Y7 0 617 73 1 396 3 tuf Elongation factor Tu Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
B9IZJ2 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain Q1)
B7HQU2 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain AH187)
Q73F98 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain ATCC 10987 / NRS 248)
B5Z8K3 0 617 73 1 398 3 tuf Elongation factor Tu Helicobacter pylori (strain G27)
Q6HPR0 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63H92 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain ZK / E33L)
Q814C4 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HJ46 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain B4264)
C1ET37 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain 03BB102)
B7JKB7 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain AH820)
Q81VT2 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus anthracis
A0R8H8 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus thuringiensis (strain Al Hakam)
C3LJ80 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9Q3 0 617 77 1 394 3 tuf Elongation factor Tu Bacillus anthracis (strain A0248)
A4WVL0 0 616 74 2 395 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
B7IT17 0 616 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain G9842)
A5D5I8 0 616 74 2 398 3 tuf2 Elongation factor Tu 2 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A4FPM7 0 615 75 2 395 3 tuf Elongation factor Tu Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
B2UUW8 0 615 73 1 398 3 tuf Elongation factor Tu Helicobacter pylori (strain Shi470)
Q2JFH8 0 615 78 2 396 3 tuf Elongation factor Tu Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A5D5K0 0 615 74 2 398 3 tuf1 Elongation factor Tu 1 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
P56003 0 615 73 1 398 3 tuf Elongation factor Tu Helicobacter pylori (strain ATCC 700392 / 26695)
Q5L3Z9 0 615 77 1 394 3 tuf Elongation factor Tu Geobacillus kaustophilus (strain HTA426)
A7GJ76 0 615 73 2 395 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IGF6 0 615 73 2 395 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Okra / Type B1)
A5I7K8 0 615 73 2 395 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZ71 0 615 73 2 395 3 tuf1 Elongation factor Tu Clostridium botulinum (strain ATCC 19397 / Type A)
Q3J5S4 0 615 74 2 395 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PGI1 0 615 74 2 395 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A9VP75 0 615 77 1 394 3 tuf Elongation factor Tu Bacillus mycoides (strain KBAB4)
Q47LJ1 0 615 74 2 396 3 tuf Elongation factor Tu Thermobifida fusca (strain YX)
O50306 0 615 77 1 394 3 tuf Elongation factor Tu Geobacillus stearothermophilus
B1KSM7 0 615 74 2 395 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Loch Maree / Type A3)
B3QY22 0 615 73 1 393 3 tuf Elongation factor Tu Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A5GIP0 0 614 73 1 398 3 tuf Elongation factor Tu Synechococcus sp. (strain WH7803)
A9KRZ4 0 614 74 3 397 3 tuf Elongation factor Tu Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B6JN44 0 614 73 1 398 3 tuf Elongation factor Tu Helicobacter pylori (strain P12)
Q5NQ65 0 613 75 2 396 3 tuf Elongation factor Tu Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
P33166 0 613 78 2 394 1 tuf Elongation factor Tu Bacillus subtilis (strain 168)
Q9Z9L6 0 613 78 2 394 3 tuf Elongation factor Tu Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q839G8 0 613 78 1 394 3 tuf Elongation factor Tu Enterococcus faecalis (strain ATCC 700802 / V583)
Q9ZK19 0 612 73 1 398 3 tuf Elongation factor Tu Helicobacter pylori (strain J99 / ATCC 700824)
A9ISD9 0 612 74 2 395 3 tuf1 Elongation factor Tu Bartonella tribocorum (strain CIP 105476 / IBS 506)
A5GW14 0 612 73 1 398 3 tuf Elongation factor Tu Synechococcus sp. (strain RCC307)
A7Z0N5 0 612 77 2 394 3 tuf Elongation factor Tu Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P29542 0 611 73 2 396 3 tuf1 Elongation factor Tu-1 Streptomyces ramocissimus
B8DLL9 0 611 78 1 396 3 tuf Elongation factor Tu Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A6LPP6 0 610 74 2 396 3 tuf1 Elongation factor Tu Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B8I5N8 0 610 74 3 400 3 tuf Elongation factor Tu Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q6A6L7 0 610 73 2 396 3 tuf Elongation factor Tu Cutibacterium acnes (strain DSM 16379 / KPA171202)
P33165 0 610 73 0 393 3 tuf Elongation factor Tu Bacteroides fragilis (strain YCH46)
Q5L890 0 610 73 0 393 3 tuf Elongation factor Tu Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q3A6R2 0 610 77 2 398 3 tuf1 Elongation factor Tu 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B0TC54 0 609 73 2 399 3 tuf Elongation factor Tu Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A8MLC4 0 609 77 3 396 3 tuf1 Elongation factor Tu Alkaliphilus oremlandii (strain OhILAs)
Q65PA9 0 608 76 2 395 3 tuf Elongation factor Tu Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
C0ZIH6 0 608 75 2 394 3 tuf Elongation factor Tu Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A8HTW6 0 608 77 3 396 3 tuf1 Elongation factor Tu Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q3A6P9 0 608 76 2 398 3 tuf2 Elongation factor Tu 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q5WLR4 0 608 77 2 394 3 tuf Elongation factor Tu Shouchella clausii (strain KSM-K16)
B6JET1 0 608 76 1 395 3 tuf Elongation factor Tu Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A1T4L6 0 607 74 3 396 3 tuf Elongation factor Tu Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
C4KZP9 0 607 74 1 394 3 tuf Elongation factor Tu Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q99QM0 0 607 77 1 395 3 tufA Elongation factor Tu Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A0QS98 0 607 74 3 396 1 tuf Elongation factor Tu Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A9NEN4 0 607 73 0 393 3 tuf Elongation factor Tu Acholeplasma laidlawii (strain PG-8A)
Q0ANN1 0 606 77 1 395 3 tuf1 Elongation factor Tu Maricaulis maris (strain MCS10)
B9MQH1 0 606 73 3 400 3 tuf Elongation factor Tu Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q8ETY4 0 606 77 1 393 3 tuf Elongation factor Tu Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q7U4D1 0 605 73 1 398 3 tuf Elongation factor Tu Parasynechococcus marenigrum (strain WH8102)
Q3A9P8 0 605 73 2 398 3 tuf2 Elongation factor Tu 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3A9R3 0 605 73 2 398 3 tuf1 Elongation factor Tu 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B2RL52 0 605 72 1 394 3 tuf Elongation factor Tu Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q8EX18 0 605 73 0 393 3 tuf Elongation factor Tu Malacoplasma penetrans (strain HF-2)
Q31IY4 0 605 78 1 395 3 tuf1 Elongation factor Tu Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A8LLG2 0 605 76 2 395 3 tuf1 Elongation factor Tu Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A7I3U7 0 605 74 1 399 3 tuf Elongation factor Tu Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A8F982 0 605 76 2 395 3 tuf Elongation factor Tu Bacillus pumilus (strain SAFR-032)
P64029 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain MW2)
A8YZP5 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBT9 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain MSSA476)
Q6GJC0 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain MRSA252)
P99152 0 604 76 0 393 1 tuf Elongation factor Tu Staphylococcus aureus (strain N315)
P64028 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QEK0 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain Newman)
Q5HIC7 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain COL)
Q2YSB3 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQA2 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain JH9)
Q2G0N0 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ92 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain USA300)
A6TZ25 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain JH1)
A7WYX6 0 604 76 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain Mu3 / ATCC 700698)
A2CC87 0 603 72 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9303)
B1YGU8 0 603 75 1 394 3 tuf Elongation factor Tu Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q2S1P8 0 603 72 2 395 3 tuf1 Elongation factor Tu Salinibacter ruber (strain DSM 13855 / M31)
A1VAK4 0 603 77 1 396 3 tuf Elongation factor Tu Nitratidesulfovibrio vulgaris (strain DP4)
Q727D5 0 603 77 1 396 3 tuf Elongation factor Tu Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A4XI37 0 603 73 3 400 3 tuf Elongation factor Tu Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q7V500 0 603 72 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9313)
C4Z2R9 0 603 72 3 396 3 tuf Elongation factor Tu Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
A0L5V8 0 602 77 1 395 3 tuf1 Elongation factor Tu Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q1AU14 0 602 74 3 399 3 tuf1 Elongation factor Tu Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q0RRS3 0 601 77 2 396 3 tuf Elongation factor Tu Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q89J82 0 601 75 1 395 3 tuf Elongation factor Tu Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8CQ81 0 601 75 0 393 3 tuf Elongation factor Tu Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRK4 0 601 75 0 393 3 tuf Elongation factor Tu Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1MPT8 0 601 76 2 396 3 tuf Elongation factor Tu Lawsonia intracellularis (strain PHE/MN1-00)
A9BCK0 0 600 72 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9211)
B8ELG5 0 600 76 1 394 3 tuf Elongation factor Tu Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q4L3K9 0 600 75 0 393 3 tuf Elongation factor Tu Staphylococcus haemolyticus (strain JCSC1435)
Q6YQV8 0 600 72 0 394 3 tuf Elongation factor Tu Onion yellows phytoplasma (strain OY-M)
A0ALY8 0 600 76 1 393 3 tuf Elongation factor Tu Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y422 0 600 76 1 393 1 tuf Elongation factor Tu Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WB9 0 600 76 1 393 3 tuf Elongation factor Tu Listeria monocytogenes serotype 4b (strain F2365)
C1KZK6 0 600 76 1 393 3 tuf Elongation factor Tu Listeria monocytogenes serotype 4b (strain CLIP80459)
B9E8Q0 0 600 76 1 391 3 tuf Elongation factor Tu Macrococcus caseolyticus (strain JCSC5402)
A4YSJ0 0 600 75 1 395 3 tuf Elongation factor Tu Bradyrhizobium sp. (strain ORS 278)
A5ELM9 0 600 75 1 395 3 tuf Elongation factor Tu Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
P18906 0 599 72 0 393 3 tuf Elongation factor Tu Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
B8DAY7 0 599 76 1 393 3 tuf Elongation factor Tu Listeria monocytogenes serotype 4a (strain HCC23)
Q927I6 0 599 76 1 393 3 tuf Elongation factor Tu Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P42475 0 599 72 0 393 3 tuf1 Elongation factor Tu Fibrobacter succinogenes (strain ATCC 19169 / S85)
Q5LMR5 0 599 75 2 395 3 tuf1 Elongation factor Tu Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A2BYN4 0 599 72 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9515)
Q5YPG4 0 599 73 3 396 3 tuf Elongation factor Tu Nocardia farcinica (strain IFM 10152)
Q72GW4 0 598 72 3 405 3 tuf1 Elongation factor Tu Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q160Y4 0 598 76 2 394 3 tuf1 Elongation factor Tu Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q46IW4 0 598 72 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain NATL2A)
Q7UZY7 0 598 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B8J1A0 0 598 78 2 395 3 tuf Elongation factor Tu Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A3PEZ7 0 597 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9301)
P60339 0 597 72 3 405 1 tufB Elongation factor Tu-B Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q01698 0 597 72 3 405 1 tuf Elongation factor Tu Thermus aquaticus
A2C4U5 0 597 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain NATL1A)
Q318N5 0 597 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9312)
A2BT83 0 596 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain AS9601)
A8G708 0 596 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9215)
A8LC58 0 596 76 2 396 3 tuf Elongation factor Tu Parafrankia sp. (strain EAN1pec)
Q039K9 0 596 72 1 392 3 tuf Elongation factor Tu Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WE38 0 596 72 1 392 3 tuf Elongation factor Tu Lacticaseibacillus casei (strain BL23)
P42480 0 596 72 1 394 3 tuf Elongation factor Tu Hymenobacter ocellatus
P60338 0 596 72 3 405 1 tufA Elongation factor Tu-A Thermus thermophilus
Q5SHN6 0 596 72 3 405 1 tufA Elongation factor Tu-A Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q39Y08 0 596 78 1 395 3 tuf1 Elongation factor Tu Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B9DKV8 0 595 75 1 393 3 tuf Elongation factor Tu Staphylococcus carnosus (strain TM300)
Q2G8Y2 0 595 74 1 394 3 tuf Elongation factor Tu Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A6X0A2 0 595 75 2 395 3 tuf1 Elongation factor Tu Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A8EW02 0 595 72 3 402 3 tuf Elongation factor Tu Aliarcobacter butzleri (strain RM4018)
Q2NJ20 0 594 71 0 394 3 tuf Elongation factor Tu Aster yellows witches'-broom phytoplasma (strain AYWB)
P50068 0 594 71 0 391 3 tuf Elongation factor Tu Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJG3 0 594 71 0 391 3 tuf Elongation factor Tu Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q30TQ5 0 594 73 2 399 3 tuf Elongation factor Tu Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q82DQ0 0 594 74 2 395 3 tuf1 Elongation factor Tu 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A9BHA7 0 593 71 3 398 3 tuf Elongation factor Tu Petrotoga mobilis (strain DSM 10674 / SJ95)
Q9XD38 0 593 74 4 400 3 tuf Elongation factor Tu Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NF9 0 593 74 4 400 3 tuf Elongation factor Tu Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q67JU1 0 593 75 1 393 3 tuf Elongation factor Tu Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q53871 0 593 74 2 395 3 tuf1 Elongation factor Tu-1 Streptomyces collinus
P40174 0 593 74 2 395 3 tuf1 Elongation factor Tu-1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q28UW7 0 592 75 2 395 3 tuf1 Elongation factor Tu Jannaschia sp. (strain CCS1)
Q05FI3 0 592 71 1 397 3 tuf Elongation factor Tu Carsonella ruddii (strain PV)
Q49V58 0 592 75 1 390 3 tuf Elongation factor Tu Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B0SSH9 0 592 72 3 400 3 tuf Elongation factor Tu Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SAF6 0 592 72 3 400 3 tuf Elongation factor Tu Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q3AW53 0 592 73 1 398 3 tuf Elongation factor Tu Synechococcus sp. (strain CC9902)
Q2N9A8 0 592 76 1 394 3 tuf Elongation factor Tu Erythrobacter litoralis (strain HTCC2594)
B5ZC31 0 591 71 0 391 3 tuf Elongation factor Tu Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
A6KYK9 0 591 74 0 393 3 tuf Elongation factor Tu Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q1GDV0 0 591 77 2 395 3 tuf1 Elongation factor Tu Ruegeria sp. (strain TM1040)
Q4A597 0 591 71 0 393 3 tuf Elongation factor Tu Mycoplasmopsis synoviae (strain 53)
Q7VA05 0 590 70 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A6W5T5 0 590 74 2 396 3 tuf Elongation factor Tu Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16130
Feature type CDS
Gene tuf
Product elongation factor Tu
Location 3579887 - 3581071 (strand: 1)
Length 1185 (nucleotides) / 394 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_154
Orthogroup size 10
N. genomes 7

Actions

Genomic region

Domains

PF00009 Elongation factor Tu GTP binding domain
PF03143 Elongation factor Tu C-terminal domain
PF03144 Elongation factor Tu domain 2

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0050 Translation, ribosomal structure and biogenesis (J) J Translation elongation factor EF-Tu, a GTPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02358 elongation factor Tu Plant-pathogen interaction -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG046459 elongation factor Tu VF0460 Adherence

Protein Sequence

MSKEKFERSKPHVNVGTIGHVDHGKTTLTAAITTVLAKTYGGAARAFDQIDNAPEEKARGITISTSHVEYDTPTRHYAHVDCPGHADYVKNMITGAAQMDGAILVVAATDGPMPQTREHILLGRQVGVPYIIVFLNKCDMVDDEELLELVEMEVRELLSQYDFPGDDTPVIRGSALKALEGEAEWEAKIVELAEALDTYIPEPERAIDKPFLLPIEDVFSISGRGTVVTGRVERGIIKVGDEVEIVGIKETAKTTCTGVEMFRKLLDEGRAGENVGVLLRGTKREEIERGQVLAKPGSINPHNKFESEVYILSKDEGGRHTPFFKGYRPQFYFRTTDVTGTIELPEGVEMVMPGDNVNMIVELIHPIAMDEGLRFAIREGGRTVGAGVVAKVLG

Flanking regions ( +/- flanking 50bp)

TGGTTGATGTGGTGTAACCACCGATTCCGTGTCTTAGAGGGACAATTTAAATGTCTAAAGAAAAATTTGAACGTTCAAAACCGCACGTTAACGTTGGTACTATCGGCCACGTTGACCACGGTAAAACAACTCTGACTGCTGCAATCACTACAGTTTTAGCTAAAACTTACGGTGGTGCTGCTCGTGCATTTGACCAAATCGATAATGCACCAGAAGAAAAAGCGCGTGGTATCACCATCTCTACTTCACACGTAGAATACGATACTCCAACTCGCCACTACGCACACGTAGACTGCCCAGGCCACGCCGACTATGTTAAAAACATGATCACTGGTGCTGCGCAAATGGACGGAGCTATTCTGGTAGTAGCAGCAACTGATGGTCCAATGCCACAAACTCGTGAGCACATCCTGTTAGGTCGTCAGGTTGGTGTTCCTTACATCATCGTATTCCTGAACAAATGTGACATGGTAGATGATGAAGAGCTGTTAGAATTAGTTGAAATGGAAGTTCGTGAACTTCTGTCTCAATACGATTTCCCAGGCGATGACACTCCAGTAATCCGTGGTTCAGCGCTGAAAGCACTGGAAGGCGAAGCAGAGTGGGAAGCAAAAATTGTTGAATTAGCAGAAGCACTGGATACTTATATCCCAGAGCCAGAGCGTGCAATTGACAAACCATTCCTGTTACCAATCGAAGATGTATTCTCAATCTCAGGTCGTGGTACAGTAGTTACTGGTCGTGTAGAGCGTGGTATCATCAAAGTAGGTGATGAAGTTGAGATTGTTGGTATCAAAGAAACCGCAAAAACAACTTGTACTGGCGTTGAAATGTTCCGTAAATTACTTGACGAAGGTCGTGCAGGTGAGAACGTAGGTGTTCTGCTGCGTGGTACAAAACGTGAAGAAATCGAACGTGGACAAGTACTGGCGAAACCAGGTTCAATCAACCCACACAACAAATTTGAATCAGAAGTTTATATTCTGAGCAAAGATGAAGGTGGTCGTCACACTCCATTCTTCAAAGGCTACCGTCCACAGTTCTACTTCCGTACAACTGACGTAACTGGTACTATCGAATTACCAGAAGGCGTAGAAATGGTAATGCCAGGCGACAACGTGAACATGATCGTTGAACTGATCCACCCAATCGCAATGGACGAAGGTTTACGCTTCGCAATCCGTGAAGGTGGCCGTACAGTAGGTGCGGGTGTTGTTGCTAAAGTATTAGGTTAATTCCTAGCTTTATTATTTTTGAAAAGGGCATCTGATGATGCCCTTTTTTA