Homologs in group_169

Help

9 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17540 FBDBKF_17540 26.4 Morganella morganii S1 tuf elongation factor Tu
EHELCC_19980 EHELCC_19980 34.9 Morganella morganii S2 - hypothetical protein
NLDBIP_19970 NLDBIP_19970 34.9 Morganella morganii S4 - hypothetical protein
LHKJJB_19935 LHKJJB_19935 34.9 Morganella morganii S3 - hypothetical protein
HKOGLL_19750 HKOGLL_19750 34.9 Morganella morganii S5 - hypothetical protein
F4V73_RS14925 F4V73_RS14925 29.8 Morganella psychrotolerans tuf elongation factor Tu
F4V73_RS18900 F4V73_RS18900 29.8 Morganella psychrotolerans tuf elongation factor Tu
PMI_RS13790 PMI_RS13790 29.8 Proteus mirabilis HI4320 tuf elongation factor Tu
PMI_RS16130 PMI_RS16130 29.8 Proteus mirabilis HI4320 tuf elongation factor Tu

Distribution of the homologs in the orthogroup group_169

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_169

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8L0 0.0 723 73 2 483 3 cysN Sulfate adenylyltransferase subunit 1 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JJT0 0.0 709 71 2 480 3 cysN Sulfate adenylyltransferase subunit 1 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7MJ69 0.0 697 71 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Cronobacter sakazakii (strain ATCC BAA-894)
Q66EC7 0.0 696 71 3 475 3 cysN Sulfate adenylyltransferase subunit 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZBP2 0.0 696 71 3 475 3 cysN Sulfate adenylyltransferase subunit 1 Yersinia pestis
A7FLY2 0.0 696 71 3 475 3 cysN Sulfate adenylyltransferase subunit 1 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q2NVM8 0.0 675 69 3 477 3 cysN Sulfate adenylyltransferase subunit 1 Sodalis glossinidius (strain morsitans)
B4TTW5 0.0 673 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella schwarzengrund (strain CVM19633)
A9N2D8 0.0 673 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5F415 0.0 673 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella agona (strain SL483)
B4TFX1 0.0 672 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella heidelberg (strain SL476)
B2VG01 0.0 672 68 3 478 3 cysN Sulfate adenylyltransferase subunit 1 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B5FTS9 0.0 672 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella dublin (strain CT_02021853)
B5QW22 0.0 671 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella enteritidis PT4 (strain P125109)
Q8ZMF5 0.0 671 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4T461 0.0 671 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella newport (strain SL254)
B5RDQ7 0.0 671 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5BEY8 0.0 670 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella paratyphi A (strain AKU_12601)
Q5PEH2 0.0 670 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C0PXB1 0.0 670 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella paratyphi C (strain RKS4594)
Q57KJ0 0.0 670 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella choleraesuis (strain SC-B67)
A8ANW5 0.0 669 69 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q1R7U0 0.0 668 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli (strain UTI89 / UPEC)
Q8FEJ1 0.0 668 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AEU5 0.0 668 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O1:K1 / APEC
B7MKM5 0.0 668 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8Z470 0.0 667 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella typhi
B7LXG3 0.0 667 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O8 (strain IAI1)
B7LEG9 0.0 667 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli (strain 55989 / EAEC)
A7ZQJ5 0.0 667 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32CH9 0.0 665 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Shigella dysenteriae serotype 1 (strain Sd197)
Q3YYB1 0.0 665 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Shigella sonnei (strain Ss046)
B2TZI0 0.0 665 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LQ72 0.0 665 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli (strain SMS-3-5 / SECEC)
P23845 0.0 665 68 2 477 1 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli (strain K12)
Q0TEA7 0.0 665 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1XCS7 0.0 665 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli (strain K12 / DH10B)
C4ZZQ5 0.0 665 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli (strain K12 / MC4100 / BW2952)
B7MZ52 0.0 665 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O81 (strain ED1a)
B7NT95 0.0 665 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z3B3 0.0 664 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7X7 0.0 664 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O157:H7
Q0T1I2 0.0 663 67 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Shigella flexneri serotype 5b (strain 8401)
B6I6E1 0.0 663 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli (strain SE11)
A8A3N0 0.0 663 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O9:H4 (strain HS)
Q83JX8 0.0 662 67 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Shigella flexneri
B7N6Y1 0.0 662 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7UHH0 0.0 661 68 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q31XB3 0.0 661 67 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Shigella boydii serotype 4 (strain Sb227)
B7LWK4 0.0 660 67 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1IUS8 0.0 660 67 2 477 3 cysN Sulfate adenylyltransferase subunit 1 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A9MF24 0.0 655 67 4 478 3 cysN Sulfate adenylyltransferase subunit 1 Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q7MPF2 0.0 588 61 2 461 3 cysN Sulfate adenylyltransferase subunit 1 Vibrio vulnificus (strain YJ016)
Q87SX9 0.0 588 60 3 473 3 cysN Sulfate adenylyltransferase subunit 1 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DE73 0.0 587 61 2 461 3 cysN Sulfate adenylyltransferase subunit 1 Vibrio vulnificus (strain CMCP6)
Q6LM69 0.0 585 60 4 474 3 cysN Sulfate adenylyltransferase subunit 1 Photobacterium profundum (strain SS9)
B7VKY2 0.0 584 59 3 473 3 cysN Sulfate adenylyltransferase subunit 1 Vibrio atlanticus (strain LGP32)
A7MWE9 0.0 582 60 3 473 3 cysN Sulfate adenylyltransferase subunit 1 Vibrio campbellii (strain ATCC BAA-1116)
A5F578 0.0 579 60 2 461 3 cysN Sulfate adenylyltransferase subunit 1 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C3LRM1 0.0 577 60 2 461 3 cysN Sulfate adenylyltransferase subunit 1 Vibrio cholerae serotype O1 (strain M66-2)
Q9KP20 0.0 577 60 2 461 3 cysN Sulfate adenylyltransferase subunit 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5E830 0.0 565 59 4 464 3 cysN Sulfate adenylyltransferase subunit 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FGJ9 0.0 564 59 4 464 3 cysN Sulfate adenylyltransferase subunit 1 Aliivibrio fischeri (strain MJ11)
A4SRG8 0.0 563 61 4 458 3 cysN Sulfate adenylyltransferase subunit 1 Aeromonas salmonicida (strain A449)
A0KP35 0.0 563 61 4 458 3 cysN Sulfate adenylyltransferase subunit 1 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8EB10 0.0 561 58 6 486 3 cysN Sulfate adenylyltransferase subunit 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B6ELP3 0.0 560 57 5 476 3 cysN Sulfate adenylyltransferase subunit 1 Aliivibrio salmonicida (strain LFI1238)
B8D9K1 0.0 552 56 4 472 3 cysN Sulfate adenylyltransferase subunit 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
C4LAG3 0.0 551 57 5 475 3 cysN Sulfate adenylyltransferase subunit 1 Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
P57498 0.0 551 56 4 472 3 cysN Sulfate adenylyltransferase subunit 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D7V3 0.0 550 56 4 472 3 cysN Sulfate adenylyltransferase subunit 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
Q21IS6 0.0 540 56 4 461 3 cysN Sulfate adenylyltransferase subunit 1 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B3PII1 0.0 532 57 5 467 3 cysN Sulfate adenylyltransferase subunit 1 Cellvibrio japonicus (strain Ueda107)
A8EWR6 0.0 532 56 2 461 3 cysN Sulfate adenylyltransferase subunit 1 Aliarcobacter butzleri (strain RM4018)
C1D890 0.0 529 55 4 466 3 cysN Sulfate adenylyltransferase subunit 1 Laribacter hongkongensis (strain HLHK9)
B1KMH4 0.0 528 54 3 466 3 cysN Sulfate adenylyltransferase subunit 1 Shewanella woodyi (strain ATCC 51908 / MS32)
C5BSJ5 0.0 527 56 4 461 3 cysN Sulfate adenylyltransferase subunit 1 Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q1QUF9 0.0 526 58 4 461 3 cysN Sulfate adenylyltransferase subunit 1 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A0Q6F0 0.0 526 55 5 464 3 cysN Sulfate adenylyltransferase subunit 1 Francisella tularensis subsp. novicida (strain U112)
B4RTW4 0.0 524 55 5 460 3 cysN Sulfate adenylyltransferase subunit 1 Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A4IXZ5 0.0 523 54 5 464 3 cysN Sulfate adenylyltransferase subunit 1 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NG10 0.0 520 54 5 464 3 cysN Sulfate adenylyltransferase subunit 1 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HG2 0.0 520 54 5 464 3 cysN Sulfate adenylyltransferase subunit 1 Francisella tularensis subsp. tularensis (strain FSC 198)
Q482Z9 5.46e-180 515 56 4 460 3 cysN Sulfate adenylyltransferase subunit 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q15VB8 1.21e-174 501 54 6 459 3 cysN Sulfate adenylyltransferase subunit 1 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q7NVN5 3.99e-174 501 54 5 468 3 cysN Sulfate adenylyltransferase subunit 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A1ST27 1.14e-171 494 52 3 460 3 cysN Sulfate adenylyltransferase subunit 1 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
O50274 6.26e-168 491 58 3 421 3 cysNC Bifunctional enzyme CysN/CysC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A6QB12 3.75e-163 473 50 6 471 3 cysN Sulfate adenylyltransferase subunit 1 Sulfurovum sp. (strain NBC37-1)
P72339 1.6e-155 459 51 4 438 3 nodQ Bifunctional enzyme NodQ Rhizobium sp. (strain N33)
Q7UMW2 9.7e-149 442 52 5 426 3 cysNC Bifunctional enzyme CysN/CysC Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A9W4X1 4.96e-144 424 50 4 428 3 cysN Sulfate adenylyltransferase subunit 1 Methylorubrum extorquens (strain PA1)
B7L0X9 1.36e-143 422 50 4 428 3 cysN Sulfate adenylyltransferase subunit 1 Methylorubrum extorquens (strain CM4 / NCIMB 13688)
P13442 1.68e-143 428 47 3 423 3 nodQ Bifunctional enzyme NodQ Rhizobium meliloti (strain 1021)
B1Z7C0 9.43e-143 421 46 3 464 3 cysN Sulfate adenylyltransferase subunit 1 Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q9PD78 9.96e-143 426 51 4 420 3 cysNC Bifunctional enzyme CysN/CysC Xylella fastidiosa (strain 9a5c)
O07309 8.85e-142 424 48 3 420 3 nodQ Bifunctional enzyme NodQ Rhizobium sp. (strain BR816)
Q87DG7 1.11e-141 423 50 4 421 3 cysNC Bifunctional enzyme CysN/CysC Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q5LES3 3.37e-139 412 49 5 431 3 cysN Sulfate adenylyltransferase subunit 1 Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64VQ9 4.48e-139 411 49 5 431 3 cysN Sulfate adenylyltransferase subunit 1 Bacteroides fragilis (strain YCH46)
Q8AAP9 1.49e-135 402 48 6 434 3 cysN Sulfate adenylyltransferase subunit 1 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
P52978 3.42e-134 404 46 6 424 3 nodQ Bifunctional enzyme NodQ Rhizobium tropici
P28604 1.68e-133 402 47 4 421 3 nodQ Bifunctional enzyme NodQ Azospirillum brasilense
P9WNM5 1.37e-119 366 48 9 419 1 cysNC Bifunctional enzyme CysN/CysC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNM4 1.37e-119 366 48 9 419 3 cysNC Bifunctional enzyme CysN/CysC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O33581 2.12e-119 362 49 5 411 3 cysN Sulfate adenylyltransferase subunit 1 Rhizobium tropici
B9JB95 2.32e-117 356 48 5 411 3 cysN Sulfate adenylyltransferase subunit 1 Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q8UH69 6.98e-117 355 47 8 428 3 cysN Sulfate adenylyltransferase subunit 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P56893 7.55e-116 353 46 7 418 3 cysN Sulfate adenylyltransferase subunit 1 Rhizobium meliloti (strain 1021)
Q57770 3.28e-55 193 32 13 439 3 tuf Elongation factor 1-alpha Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P19486 3.24e-53 187 37 10 322 3 tuf Elongation factor 1-alpha Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
A0RUM4 1.12e-52 186 35 6 317 3 tuf Elongation factor 1-alpha Cenarchaeum symbiosum (strain A)
P16018 1.22e-51 183 32 4 349 1 tuf Elongation factor 1-alpha Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P17196 2.25e-51 183 35 9 339 3 tuf Elongation factor 1-alpha Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q8TYP6 2.87e-51 182 31 13 432 3 tuf Elongation factor 1-alpha Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q979T1 4.31e-51 182 31 11 437 3 tuf Elongation factor 1-alpha Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
A8MAJ1 5.22e-51 182 34 6 329 3 tuf Elongation factor 1-alpha Caldivirga maquilingensis (strain ATCC 700844 / DSM 13496 / JCM 10307 / IC-167)
P41203 5.7e-51 182 32 13 437 3 tuf Elongation factor 1-alpha Desulfurococcus mucosus
O29325 1.75e-50 180 32 7 411 3 tuf Elongation factor 1-alpha Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q3IUD8 2.19e-50 180 31 7 367 3 tuf Elongation factor 1-alpha Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
P26751 3.72e-50 180 31 14 451 3 tuf Elongation factor 1-alpha Pyrococcus woesei
A4YCR6 6.35e-50 179 30 13 438 3 tuf Elongation factor 1-alpha Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q9HM89 8.79e-50 178 35 7 310 3 tuf Elongation factor 1-alpha Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R8C3 8.79e-50 178 35 7 310 3 tuf Elongation factor 1-alpha Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P35021 1.92e-49 178 31 13 435 1 tuf Elongation factor 1-alpha Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q8U152 1.97e-49 177 31 14 447 3 tuf Elongation factor 1-alpha Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
B8GIQ3 2.57e-49 177 29 9 427 3 tuf Elongation factor 1-alpha Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
Q9YAV0 2.57e-49 177 33 14 437 1 tuf Elongation factor 1-alpha Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
P31018 2.86e-49 177 34 6 327 1 EHI_011210 Elongation factor 1-alpha Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q18EY5 3.35e-49 177 33 7 314 3 tuf Elongation factor 1-alpha Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
A8ABM5 4.07e-49 177 30 14 442 3 tuf Elongation factor 1-alpha Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
A5ULM5 5e-49 176 31 11 422 3 tuf Elongation factor 1-alpha Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
C5A5P4 5.43e-49 176 36 8 316 3 tuf Elongation factor 1-alpha Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q2FRI3 6e-49 176 33 7 324 3 tuf Elongation factor 1-alpha Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
A6UV43 7.56e-49 176 30 12 435 3 tuf Elongation factor 1-alpha Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
A4FWE9 9.9e-49 176 30 12 436 3 tuf Elongation factor 1-alpha Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q27140 1.12e-48 176 29 9 433 3 EFA2 Elongation factor 1-alpha 2 Euplotes crassus
Q6LXI1 1.14e-48 176 30 12 437 3 tuf Elongation factor 1-alpha Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A9A9U3 1.2e-48 176 30 12 436 3 tuf Elongation factor 1-alpha Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A6VGV6 1.34e-48 176 30 12 436 3 tuf Elongation factor 1-alpha Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A2STF0 1.42e-48 175 33 5 307 3 tuf Elongation factor 1-alpha Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
O93729 1.5e-48 176 33 8 338 3 tuf Elongation factor 1-alpha Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
C6A4R7 1.54e-48 175 35 7 315 3 tuf Elongation factor 1-alpha Thermococcus sibiricus (strain DSM 12597 / MM 739)
A3DMQ1 1.59e-48 176 30 11 434 3 tuf Elongation factor 1-alpha Staphylothermus marinus (strain ATCC 43588 / DSM 3639 / JCM 9404 / F1)
Q5JFZ4 1.66e-48 175 37 8 316 3 tuf Elongation factor 1-alpha Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
O27132 1.96e-48 174 37 7 299 1 tuf Elongation factor 1-alpha Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A4WKK8 3.05e-48 175 34 6 318 3 tuf Elongation factor 1-alpha Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
Q9V0V7 4.34e-48 174 31 13 444 3 tuf Elongation factor 1-alpha Pyrococcus abyssi (strain GE5 / Orsay)
B6YVG2 5.79e-48 174 33 11 375 3 tuf Elongation factor 1-alpha Thermococcus onnurineus (strain NA1)
O59153 6.29e-48 174 34 11 375 1 tuf Elongation factor 1-alpha Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q976B1 7.38e-48 174 35 6 313 3 tuf Elongation factor 1-alpha Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
A3MV69 9.76e-48 174 34 7 329 3 tuf Elongation factor 1-alpha Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
A1RRJ3 1.5e-47 173 34 8 340 3 tuf Elongation factor 1-alpha Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
Q12WT3 5.7e-47 171 33 4 310 3 tuf Elongation factor 1-alpha Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
A6UQ14 6.02e-47 171 30 12 436 3 tuf Elongation factor 1-alpha Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q27139 6.16e-47 171 30 10 436 3 EFA1 Elongation factor 1-alpha 1 Euplotes crassus
Q8TRC4 1.6e-46 170 28 8 425 3 tuf Elongation factor 1-alpha Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P07810 2.27e-46 169 34 7 315 3 tuf Elongation factor 1-alpha Methanococcus vannielii
Q464Z4 6.48e-46 168 29 9 427 3 tuf Elongation factor 1-alpha Methanosarcina barkeri (strain Fusaro / DSM 804)
P17197 7.42e-46 168 32 10 374 3 tuf Elongation factor 1-alpha Thermococcus celer
A2BN41 1.65e-45 167 32 13 437 3 tuf Elongation factor 1-alpha Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
A7I656 3.19e-45 166 27 10 433 3 tuf Elongation factor 1-alpha Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
A3CTG3 7.34e-45 165 28 10 431 3 tuf Elongation factor 1-alpha Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
P25166 3.58e-44 164 29 12 439 3 EFAA Elongation factor 1-alpha Stylonychia lemnae
Q8PUR8 6.93e-44 162 28 8 425 3 tuf Elongation factor 1-alpha Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q74MI6 3.23e-43 161 30 12 440 3 tuf Elongation factor 1-alpha Nanoarchaeum equitans (strain Kin4-M)
Q0W8G2 4.02e-43 160 33 7 320 3 tuf Elongation factor 1-alpha Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
P0CT55 2.14e-42 159 31 9 337 1 tef103 Elongation factor 1-alpha-B/C Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0CT54 2.14e-42 159 31 9 337 1 tef102 Elongation factor 1-alpha-B Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0CT53 3.09e-42 159 30 9 337 1 tef101 Elongation factor 1-alpha-A Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q96WZ1 3.82e-42 159 30 8 336 2 TEF Elongation factor 1-alpha Coccidioides immitis (strain RS)
Q2NEL1 5.65e-42 157 34 11 320 3 tuf Elongation factor 1-alpha Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q01372 2.84e-41 156 31 8 342 3 tef-1 Elongation factor 1-alpha Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q04634 3.28e-41 155 30 9 368 2 None Elongation factor 1-alpha Tetrahymena pyriformis
P86933 4.8e-41 155 27 9 423 2 TEF1 Elongation factor 1-alpha Trypanosoma brucei brucei
P86939 5.76e-41 155 27 9 423 1 Tb10.70.5670 Elongation factor 1-alpha 2 Trypanosoma brucei brucei (strain 927/4 GUTat10.1)
P86934 5.76e-41 155 27 9 423 1 TEF1 Elongation factor 1-alpha 1 Trypanosoma brucei brucei (strain 927/4 GUTat10.1)
A1RXW9 8.22e-41 154 33 10 321 3 tuf Elongation factor 1-alpha Thermofilum pendens (strain DSM 2475 / Hrk 5)
Q2HJN8 1.59e-40 154 28 9 436 3 eft-2 Elongation factor 1-alpha 2 Oscheius tipulae
P14865 1.88e-40 154 30 8 341 3 TEF-3 Elongation factor 1-alpha Mucor circinelloides f. lusitanicus
Q9Y450 2.42e-40 157 28 12 445 1 HBS1L HBS1-like protein Homo sapiens
Q09069 2.57e-40 154 31 7 334 3 TEF Elongation factor 1-alpha Sordaria macrospora
Q2KHZ2 2.71e-40 157 29 12 445 2 HBS1L HBS1-like protein Bos taurus
Q59QD6 3.01e-40 154 30 8 335 3 TEF2 Elongation factor 1-alpha 2 Candida albicans (strain SC5314 / ATCC MYA-2876)
P0CY35 3.01e-40 154 30 8 335 3 TEF1 Elongation factor 1-alpha 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q2HJN9 3.13e-40 154 28 9 436 3 eft-4 Elongation factor 1-alpha 4 Oscheius tipulae
Q9HDF6 3.36e-40 154 30 8 340 2 TEF1 Elongation factor 1-alpha Serendipita indica
Q5R6Y0 3.43e-40 157 28 12 445 2 HBS1L HBS1-like protein Pongo abelii
P14864 4.65e-40 153 30 8 341 3 TEF-2 Elongation factor 1-alpha Mucor circinelloides f. lusitanicus
Q6L202 4.87e-40 152 29 8 323 3 tuf Elongation factor 1-alpha Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
P06805 5.46e-40 153 30 8 341 3 TEF-1 Elongation factor 1-alpha Mucor circinelloides f. lusitanicus
P90519 5.68e-40 152 30 6 323 2 None Elongation factor 1-alpha Cryptosporidium parvum
Q2HJN4 6.87e-40 152 28 9 436 3 eft-1 Elongation factor 1-alpha 1 Oscheius tipulae
Q6AXM7 7.39e-40 155 28 12 445 1 Hbs1l HBS1-like protein Rattus norvegicus
P34825 7.8e-40 152 29 7 334 3 tef1 Elongation factor 1-alpha Hypocrea jecorina
Q69ZS7 1.05e-39 155 28 12 445 1 Hbs1l HBS1-like protein Mus musculus
Q2HJN6 6.59e-39 150 27 9 435 3 eft-3 Elongation factor 1-alpha 3 Oscheius tipulae
A5DPE3 7.34e-39 150 30 8 335 3 TEF1 Elongation factor 1-alpha Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q00080 8.25e-39 149 26 10 446 3 MEF-1 Elongation factor 1-alpha Plasmodium falciparum (isolate K1 / Thailand)
O42820 1.06e-38 149 31 8 327 3 TEF1 Elongation factor 1-alpha Schizophyllum commune
P28295 1.11e-38 149 30 8 339 3 TEF-1 Elongation factor 1-alpha Absidia glauca
Q40034 1.2e-38 149 26 12 447 1 BLT63 Elongation factor 1-alpha Hordeum vulgare
P51554 1.44e-38 149 29 7 335 2 None Elongation factor 1-alpha Hydra vulgaris
A0B7D6 1.7e-38 148 32 6 317 3 tuf Elongation factor 1-alpha Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
P40911 1.97e-38 149 31 7 297 2 TEF Elongation factor 1-alpha Ajellomyces capsulatus (strain G186AR / H82 / ATCC MYA-2454 / RMSCC 2432)
P0CT32 2.04e-38 148 32 7 321 1 eef1a2 Elongation factor 1-alpha Dictyostelium discoideum
P0CT31 2.04e-38 148 32 7 321 1 eef1a1 Elongation factor 1-alpha Dictyostelium discoideum
Q9Y713 2.09e-38 149 29 9 342 3 tef1 Elongation factor 1-alpha Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P02994 3.02e-38 148 30 8 346 1 TEF1 Elongation factor 1-alpha Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32769 3.23e-38 150 28 13 450 1 HBS1 Elongation factor 1 alpha-like protein Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01765 5.62e-38 147 30 8 336 3 TEF Elongation factor 1-alpha Pseudoechria curvicolla
P14963 6.26e-38 147 31 7 320 2 TEF Elongation factor 1-alpha Euglena gracilis
Q01520 8.01e-38 147 30 8 336 3 TEF Elongation factor 1-alpha Podospora anserina
P25698 1.12e-37 146 26 8 426 3 TEFS1 Elongation factor 1-alpha Glycine max
P34823 1.12e-37 146 26 9 428 2 None Elongation factor 1-alpha Daucus carota
P41752 1.66e-37 146 29 8 335 3 TEF Elongation factor 1-alpha Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q00251 1.9e-37 146 29 8 334 3 TEF1 Elongation factor 1-alpha Aureobasidium pullulans
O24534 5.37e-37 144 26 8 426 2 None Elongation factor 1-alpha Vicia faba
P54959 6.65e-37 144 30 8 336 2 None Elongation factor 1-alpha Blastocystis hominis
P0CN30 8.35e-37 144 26 10 429 3 TEF1 Elongation factor 1-alpha Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CN31 8.35e-37 144 26 10 429 2 TEF1 Elongation factor 1-alpha Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P53013 1e-36 144 27 12 438 3 eft-3 Elongation factor 1-alpha Caenorhabditis elegans
Q8GTY0 1.08e-36 144 26 12 447 1 A4 Elongation factor 1-alpha 4 Arabidopsis thaliana
Q0WL56 1.08e-36 144 26 12 447 1 A3 Elongation factor 1-alpha 3 Arabidopsis thaliana
Q8W4H7 1.08e-36 144 26 12 447 1 A2 Elongation factor 1-alpha 2 Arabidopsis thaliana
P0DH99 1.08e-36 144 26 12 447 1 A1 Elongation factor 1-alpha 1 Arabidopsis thaliana
P27592 1.17e-36 144 26 10 440 2 None Elongation factor 1-alpha Onchocerca volvulus
P34824 1.71e-36 143 25 12 447 1 None Elongation factor 1-alpha Hordeum vulgare
P29521 1.8e-36 143 26 10 435 1 None Elongation factor 1-alpha Daucus carota
Q5VTE0 1.81e-36 143 29 8 335 5 EEF1A1P5 Putative elongation factor 1-alpha-like 3 Homo sapiens
P19039 1.93e-36 143 30 7 307 3 None Elongation factor 1-alpha Apis mellifera
O49169 2.29e-36 142 26 9 428 3 EF1 Elongation factor 1-alpha Manihot esculenta
P13549 2.44e-36 143 29 8 335 2 eef1as Elongation factor 1-alpha, somatic form Xenopus laevis
O64937 2.48e-36 142 26 9 433 2 REFA1 Elongation factor 1-alpha Oryza sativa subsp. japonica
P62630 2.67e-36 143 29 8 335 2 Eef1a1 Elongation factor 1-alpha 1 Rattus norvegicus
P10126 2.67e-36 143 29 8 335 1 Eef1a1 Elongation factor 1-alpha 1 Mus musculus
P62629 2.67e-36 143 29 8 335 2 EEF1A1 Elongation factor 1-alpha 1 Cricetulus griseus
P68105 2.75e-36 142 29 8 335 1 EEF1A1 Elongation factor 1-alpha 1 Oryctolagus cuniculus
Q5R4R8 2.75e-36 142 29 8 335 2 EEF1A1 Elongation factor 1-alpha 1 Pongo abelii
Q5R1X2 2.75e-36 142 29 8 335 2 EEF1A1 Elongation factor 1-alpha 1 Pan troglodytes
P68104 2.75e-36 142 29 8 335 1 EEF1A1 Elongation factor 1-alpha 1 Homo sapiens
Q66RN5 2.75e-36 142 29 8 335 2 EEF1A1 Elongation factor 1-alpha 1 Felis catus
P68103 2.75e-36 142 29 8 335 1 EEF1A1 Elongation factor 1-alpha 1 Bos taurus
P43643 2.79e-36 142 26 11 445 2 None Elongation factor 1-alpha Nicotiana tabacum
Q03033 2.82e-36 142 26 9 433 2 TEF1 Elongation factor 1-alpha Triticum aestivum
A2Q0Z0 3.2e-36 142 29 8 335 2 EEF1A1 Elongation factor 1-alpha 1 Equus caballus
O59949 3.67e-36 142 29 9 338 2 TEF Elongation factor 1-alpha Yarrowia lipolytica (strain CLIB 122 / E 150)
Q90835 4.02e-36 142 29 8 335 2 EEF1A Elongation factor 1-alpha 1 Gallus gallus
P17786 4.15e-36 142 26 12 447 2 None Elongation factor 1-alpha Solanum lycopersicum
P05303 4.44e-36 142 26 11 447 2 eEF1alpha2 Elongation factor 1-alpha 2 Drosophila melanogaster
P29520 5.72e-36 142 26 9 442 2 None Elongation factor 1-alpha Bombyx mori
P15170 8.28e-36 142 30 10 314 1 GSPT1 Eukaryotic peptide chain release factor GTP-binding subunit ERF3A Homo sapiens
Q92005 8.47e-36 141 26 11 451 2 eef1a Elongation factor 1-alpha Danio rerio
P08736 1.47e-35 140 27 12 438 1 eEF1alpha1 Elongation factor 1-alpha 1 Drosophila melanogaster
P32186 2.89e-35 140 30 9 332 3 TEF Elongation factor 1-alpha Puccinia graminis
Q41803 3.21e-35 139 26 9 433 3 EF1A Elongation factor 1-alpha Zea mays
P41745 3.93e-35 139 28 8 335 3 TEF Elongation factor 1-alpha Blastobotrys adeninivorans
Q71V39 6.32e-35 139 25 10 445 1 EEF1A2 Elongation factor 1-alpha 2 Oryctolagus cuniculus
Q05639 6.32e-35 139 25 10 445 1 EEF1A2 Elongation factor 1-alpha 2 Homo sapiens
Q32PH8 6.32e-35 139 25 10 445 2 EEF1A2 Elongation factor 1-alpha 2 Bos taurus
P62632 7.04e-35 139 29 8 334 1 Eef1a2 Elongation factor 1-alpha 2 Rattus norvegicus
P62631 7.04e-35 139 29 8 334 1 Eef1a2 Elongation factor 1-alpha 2 Mus musculus
P17507 7.33e-35 139 29 7 328 1 eef1ao Elongation factor 1-alpha, oocyte form Xenopus laevis
Q8R050 7.78e-35 141 31 10 317 1 Gspt1 Eukaryotic peptide chain release factor GTP-binding subunit ERF3A Mus musculus
O74774 8.23e-35 140 27 13 432 1 hbs1 Elongation factor 1 alpha-like protein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P17508 8.42e-35 139 29 8 327 1 None Elongation factor 1-alpha, oocyte form Xenopus laevis
Q5R4B3 1.24e-34 140 30 10 314 2 GSPT2 Eukaryotic peptide chain release factor GTP-binding subunit ERF3B Pongo abelii
Q149F3 1.45e-34 140 30 10 314 1 Gspt2 Eukaryotic peptide chain release factor GTP-binding subunit ERF3B Mus musculus
P17506 1.55e-34 138 30 7 291 1 None Elongation factor 1-alpha Xenopus laevis
P50257 1.65e-34 139 28 9 384 2 TEF-S Elongation factor 1-alpha S Porphyra purpurea
Q8IYD1 2.19e-34 139 30 10 314 1 GSPT2 Eukaryotic peptide chain release factor GTP-binding subunit ERF3B Homo sapiens
Q41011 2.61e-34 137 26 8 426 2 None Elongation factor 1-alpha Pisum sativum
Q9W074 3.03e-34 139 27 11 440 1 HBS1 Protein HBS1 Drosophila melanogaster
P84316 7.68e-34 135 27 9 410 3 None Elongation factor 1-alpha (Fragment) Helicoverpa zea
P84315 7.68e-34 135 27 9 410 3 None Elongation factor 1-alpha (Fragment) Heliothis virescens
P84318 7.68e-34 135 27 9 410 3 None Elongation factor 1-alpha (Fragment) Helicoverpa gelotopoeon
P84320 7.68e-34 135 27 9 410 3 None Elongation factor 1-alpha (Fragment) Heliocheilus discalis
P84317 7.68e-34 135 27 9 410 3 None Elongation factor 1-alpha (Fragment) Helicoverpa armigera
P84319 7.68e-34 135 27 9 410 3 None Elongation factor 1-alpha (Fragment) Heliocheilus albipunctella
P84322 7.68e-34 135 27 9 410 3 None Elongation factor 1-alpha (Fragment) Anicla infecta
P84321 7.68e-34 135 27 9 410 3 None Elongation factor 1-alpha (Fragment) Adisura bella
Q26487 8.41e-34 135 27 9 410 1 None Elongation factor 1-alpha (Fragment) Spodoptera frugiperda
P02993 1.9e-33 135 28 8 344 1 None Elongation factor 1-alpha Artemia salina
Q9YIC0 2.51e-32 132 29 8 330 2 eef1a Elongation factor 1-alpha Oryzias latipes
Q8LPC4 3.91e-32 131 30 9 323 2 None Elongation factor 1-alpha Neopyropia yezoensis
P50256 7.12e-32 130 30 9 323 2 TEF-C Elongation factor 1-alpha C Porphyra purpurea
Q9HGI4 1.54e-31 131 25 15 439 3 SUP35 Eukaryotic peptide chain release factor GTP-binding subunit Zygosaccharomyces rouxii
Q9HGI8 7.71e-31 129 28 11 332 3 SUP35 Eukaryotic peptide chain release factor GTP-binding subunit Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q08046 1.19e-30 125 29 5 281 2 TEF1 Elongation factor 1-alpha (Fragment) Giardia intestinalis
O74718 3.07e-30 127 28 10 339 1 sup35 Eukaryotic peptide chain release factor GTP-binding subunit Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P05453 1.08e-28 123 27 15 434 1 SUP35 Eukaryotic peptide chain release factor GTP-binding subunit Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8SS29 2.28e-28 120 25 11 438 1 TEF1 Elongation factor 1-alpha Encephalitozoon cuniculi (strain GB-M1)
P23637 1.52e-27 120 27 9 330 3 SUP2 Eukaryotic peptide chain release factor GTP-binding subunit Ogataea pini
Q7YZN9 2.05e-27 119 28 11 343 2 erf3 Eukaryotic peptide chain release factor GTP-binding subunit Dictyostelium discoideum
P27634 2.88e-27 116 29 9 294 2 None Elongation factor 1-alpha (Fragment) Rhynchosciara americana
Q9HGI6 1.32e-25 114 33 7 215 3 SUP35 Eukaryotic peptide chain release factor GTP-binding subunit Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
O13354 2.98e-25 113 33 7 215 3 SUP35 Eukaryotic peptide chain release factor GTP-binding subunit Candida albicans
Q9HGI7 9.76e-25 111 33 7 215 3 SUP35 Eukaryotic peptide chain release factor GTP-binding subunit Candida maltosa
A1SNN5 2.58e-24 107 28 14 344 3 tuf Elongation factor Tu Nocardioides sp. (strain ATCC BAA-499 / JS614)
A1T4L6 6.87e-24 106 27 13 346 3 tuf Elongation factor Tu Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A0QS98 2.32e-23 105 27 13 346 1 tuf Elongation factor Tu Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q6ACZ0 5.07e-23 104 27 14 337 3 tuf Elongation factor Tu Leifsonia xyli subsp. xyli (strain CTCB07)
A4FPM7 8.46e-23 103 27 14 349 3 tuf Elongation factor Tu Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
B8HD11 1.75e-22 102 27 13 343 3 tuf Elongation factor Tu Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
A0JZ88 1.83e-22 102 27 12 343 3 tuf Elongation factor Tu Arthrobacter sp. (strain FB24)
Q7U4D1 3.16e-22 102 27 12 335 3 tuf Elongation factor Tu Parasynechococcus marenigrum (strain WH8102)
C5C0J3 3.2e-22 101 28 15 352 3 tuf Elongation factor Tu Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
A4T1R2 3.94e-22 101 28 13 343 3 tuf Elongation factor Tu Mycolicibacterium gilvum (strain PYR-GCK)
A0LRL8 4.3e-22 101 26 13 353 3 tuf Elongation factor Tu Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
P09953 7.7e-22 100 26 13 345 3 tuf Elongation factor Tu Micrococcus luteus
A1R8U9 9.39e-22 100 26 11 340 3 tuf Elongation factor Tu Paenarthrobacter aurescens (strain TC1)
Q73SD1 1e-21 100 27 12 351 3 tuf Elongation factor Tu Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QL35 1e-21 100 27 12 351 3 tuf Elongation factor Tu Mycobacterium avium (strain 104)
Q47LJ1 1.05e-21 100 27 15 356 3 tuf Elongation factor Tu Thermobifida fusca (strain YX)
Q46497 1.21e-21 101 29 10 281 3 selB Selenocysteine-specific elongation factor Desulfomicrobium baculatum
B2GIL2 1.23e-21 100 27 11 352 3 tuf Elongation factor Tu Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q1D7V1 1.38e-21 100 28 14 346 3 tuf1 Elongation factor Tu 1 Myxococcus xanthus (strain DK1622)
A7HBL7 1.5e-21 99 27 13 351 3 tuf1 Elongation factor Tu Anaeromyxobacter sp. (strain Fw109-5)
Q1D776 1.65e-21 99 28 14 346 3 tuf2 Elongation factor Tu 2 Myxococcus xanthus (strain DK1622)
A8EW02 2.02e-21 99 25 14 439 3 tuf Elongation factor Tu Aliarcobacter butzleri (strain RM4018)
Q3J8Q0 2.38e-21 99 27 14 344 3 tuf1 Elongation factor Tu Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B0RB36 2.48e-21 99 27 14 336 3 tuf Elongation factor Tu Clavibacter sepedonicus
P9WNN1 2.52e-21 99 27 10 348 1 tuf Elongation factor Tu Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNN0 2.52e-21 99 27 10 348 3 tuf Elongation factor Tu Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U071 2.52e-21 99 27 10 348 3 tuf Elongation factor Tu Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AL18 2.52e-21 99 27 10 348 3 tuf Elongation factor Tu Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KGG5 2.52e-21 99 27 10 348 3 tuf Elongation factor Tu Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A559 2.52e-21 99 27 10 348 3 tuf Elongation factor Tu Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0PM42 2.79e-21 99 27 13 351 3 tuf Elongation factor Tu Mycobacterium ulcerans (strain Agy99)
B2HSL3 2.79e-21 99 27 13 351 3 tuf Elongation factor Tu Mycobacterium marinum (strain ATCC BAA-535 / M)
A9WSW5 3.92e-21 98 27 12 343 3 tuf Elongation factor Tu Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q7V500 4.92e-21 98 25 10 331 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9313)
A5GW14 5.3e-21 98 25 10 331 3 tuf Elongation factor Tu Synechococcus sp. (strain RCC307)
A2CC87 5.4e-21 98 25 10 331 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9303)
A5CUB6 7.01e-21 97 26 14 336 3 tuf Elongation factor Tu Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q1BDD3 7.55e-21 97 27 12 338 3 tuf Elongation factor Tu Mycobacterium sp. (strain MCS)
A1UBL1 7.55e-21 97 27 12 338 3 tuf Elongation factor Tu Mycobacterium sp. (strain KMS)
A3PV96 7.55e-21 97 27 12 338 3 tuf Elongation factor Tu Mycobacterium sp. (strain JLS)
A6YG72 9.41e-21 97 24 13 439 3 tufA Elongation factor Tu, chloroplastic Pleurastrum terricola
Q98QG1 1e-20 97 28 13 316 3 tuf Elongation factor Tu Mycoplasmopsis pulmonis (strain UAB CTIP)
Q11Q98 1.02e-20 97 28 13 307 3 tuf Elongation factor Tu Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q3AMT6 1.61e-20 97 25 10 331 3 tuf Elongation factor Tu Synechococcus sp. (strain CC9605)
P42471 1.91e-20 96 28 10 338 3 tuf Elongation factor Tu Brevibacterium linens
Q5YPG4 2.3e-20 96 25 12 335 3 tuf Elongation factor Tu Nocardia farcinica (strain IFM 10152)
A5DN78 2.59e-20 96 26 12 343 3 TUF1 Elongation factor Tu, mitochondrial Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q7UZY7 2.77e-20 96 27 14 338 3 tuf Elongation factor Tu Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q6YQV8 3.73e-20 95 29 13 317 3 tuf Elongation factor Tu Onion yellows phytoplasma (strain OY-M)
Q3AW53 3.95e-20 95 24 15 447 3 tuf Elongation factor Tu Synechococcus sp. (strain CC9902)
B8I5N8 5.48e-20 95 27 12 324 3 tuf Elongation factor Tu Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A9KRZ4 5.53e-20 95 28 15 326 3 tuf Elongation factor Tu Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A6W5T5 6.01e-20 95 27 13 331 3 tuf Elongation factor Tu Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
B3E156 6.23e-20 95 27 12 331 3 tuf Elongation factor Tu Methylacidiphilum infernorum (isolate V4)
Q9XD38 6.24e-20 95 29 12 273 3 tuf Elongation factor Tu Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NF9 6.24e-20 95 29 12 273 3 tuf Elongation factor Tu Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
C0ZVT7 6.84e-20 95 27 9 273 3 tuf Elongation factor Tu Rhodococcus erythropolis (strain PR4 / NBRC 100887)
C0Q9Y7 8.02e-20 94 26 13 345 3 tuf Elongation factor Tu Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
P02992 9.46e-20 95 28 12 306 1 TUF1 Elongation factor Tu, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C1AYS3 9.66e-20 94 32 7 198 3 tuf Elongation factor Tu Rhodococcus opacus (strain B4)
Q0SFF4 9.66e-20 94 32 7 198 3 tuf Elongation factor Tu Rhodococcus jostii (strain RHA1)
Q605B0 9.75e-20 94 27 14 345 3 tuf1 Elongation factor Tu Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
C4Z2R9 9.75e-20 94 28 15 331 3 tuf Elongation factor Tu Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
A6LPP6 1.03e-19 94 27 13 333 3 tuf1 Elongation factor Tu Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q6A6L7 1.12e-19 94 25 14 339 3 tuf Elongation factor Tu Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q2NJ20 1.16e-19 94 29 13 316 3 tuf Elongation factor Tu Aster yellows witches'-broom phytoplasma (strain AYWB)
B5RPI0 1.26e-19 94 28 11 313 3 tuf Elongation factor Tu Borrelia recurrentis (strain A1)
B5RM34 1.26e-19 94 28 11 313 3 tuf Elongation factor Tu Borrelia duttonii (strain Ly)
Q1AU14 1.36e-19 94 26 13 356 3 tuf1 Elongation factor Tu Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
P29544 1.37e-19 94 26 9 313 3 tuf3 Elongation factor Tu-3 Streptomyces ramocissimus
B2UQY9 1.39e-19 94 28 13 319 3 tuf Elongation factor Tu Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
C4LL63 1.63e-19 94 28 9 264 3 tuf Elongation factor Tu Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
A8G708 1.94e-19 93 27 14 338 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9215)
A7ZCN0 2.09e-19 93 25 10 339 3 tuf Elongation factor Tu Campylobacter concisus (strain 13826)
A3PEZ7 2.13e-19 93 27 14 338 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9301)
P23568 2.29e-19 93 27 12 328 1 tuf Elongation factor Tu Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q2SU25 2.34e-19 93 27 14 349 3 tuf1 Elongation factor Tu Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PZ6 2.34e-19 93 27 14 349 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain K96243)
A3NEI1 2.34e-19 93 27 14 349 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 668)
Q3JMP6 2.34e-19 93 27 14 349 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 1710b)
A3P0B5 2.34e-19 93 27 14 349 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 1106a)
A1V8A5 2.34e-19 93 27 14 349 3 tuf1 Elongation factor Tu Burkholderia mallei (strain SAVP1)
Q62GK3 2.34e-19 93 27 14 349 3 tuf1 Elongation factor Tu Burkholderia mallei (strain ATCC 23344)
A2S7F9 2.34e-19 93 27 14 349 3 tuf1 Elongation factor Tu Burkholderia mallei (strain NCTC 10229)
A3MRT8 2.34e-19 93 27 14 349 3 tuf1 Elongation factor Tu Burkholderia mallei (strain NCTC 10247)
P42480 2.4e-19 93 28 13 318 3 tuf Elongation factor Tu Hymenobacter ocellatus
Q318N5 2.42e-19 93 27 14 338 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9312)
Q4A597 2.43e-19 93 27 13 339 3 tuf Elongation factor Tu Mycoplasmopsis synoviae (strain 53)
Q9ZEU3 2.49e-19 93 27 11 301 3 tuf Elongation factor Tu Apple proliferation phytoplasma
A6Q1L5 2.54e-19 93 25 14 360 3 tuf Elongation factor Tu Nitratiruptor sp. (strain SB155-2)
A2BT83 2.56e-19 93 27 14 338 3 tuf Elongation factor Tu Prochlorococcus marinus (strain AS9601)
Q46WC7 2.64e-19 93 28 14 325 3 tuf1 Elongation factor Tu Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A5GIP0 2.73e-19 93 25 10 331 3 tuf Elongation factor Tu Synechococcus sp. (strain WH7803)
Q9Y700 2.82e-19 93 27 11 306 3 tuf1 Elongation factor Tu, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q1BRT3 2.97e-19 93 27 14 351 3 tuf1 Elongation factor Tu Burkholderia orbicola (strain AU 1054)
Q39KI2 2.97e-19 93 27 14 351 3 tuf1 Elongation factor Tu Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BJ48 2.97e-19 93 27 14 351 3 tuf1 Elongation factor Tu Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0K3L0 2.97e-19 93 27 14 351 3 tuf1 Elongation factor Tu Burkholderia cenocepacia (strain HI2424)
B3QZH5 2.98e-19 93 26 14 341 3 tuf Elongation factor Tu Phytoplasma mali (strain AT)
A5CCA0 3e-19 93 27 13 330 3 tuf1 Elongation factor Tu 1 Orientia tsutsugamushi (strain Boryong)
Q8XGZ0 3.06e-19 93 27 13 323 3 tufA Elongation factor Tu Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1LI13 3.09e-19 93 28 14 325 3 tuf1 Elongation factor Tu Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P29542 3.17e-19 92 31 7 202 3 tuf1 Elongation factor Tu-1 Streptomyces ramocissimus
Q250N4 3.2e-19 93 29 11 316 3 tuf Elongation factor Tu Desulfitobacterium hafniense (strain Y51)
B8G1W4 3.2e-19 93 29 11 316 3 tuf Elongation factor Tu Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A4JAM5 3.58e-19 92 27 14 351 3 tuf1 Elongation factor Tu Burkholderia vietnamiensis (strain G4 / LMG 22486)
A5FIJ9 3.65e-19 92 27 13 355 3 tuf Elongation factor Tu Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A9BCK0 3.71e-19 92 26 12 335 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9211)
A2BYN4 3.75e-19 92 34 7 198 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9515)
P95724 4.11e-19 92 26 11 353 3 tuf Elongation factor Tu Streptomyces cinnamoneus
B9MQH1 4.59e-19 92 24 11 349 3 tuf Elongation factor Tu Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
P72231 4.86e-19 92 26 12 343 3 tuf Elongation factor Tu Planobispora rosea
Q211E6 5e-19 92 27 11 318 3 tuf Elongation factor Tu Rhodopseudomonas palustris (strain BisB18)
Q826Z7 5.49e-19 92 27 9 311 3 tuf2 Elongation factor Tu 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P40175 5.65e-19 92 26 8 310 3 tuf3 Elongation factor Tu-3 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A7GZK6 5.79e-19 92 24 12 341 3 tuf Elongation factor Tu Campylobacter curvus (strain 525.92)
Q2G8Y2 5.8e-19 92 26 12 346 3 tuf Elongation factor Tu Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
B2S0H9 5.86e-19 92 27 10 313 3 tuf Elongation factor Tu Borrelia hermsii (strain HS1 / DAH)
Q46IW4 6.3e-19 92 35 5 167 3 tuf Elongation factor Tu Prochlorococcus marinus (strain NATL2A)
Q47JA5 6.3e-19 92 28 14 321 3 tuf1 Elongation factor Tu Dechloromonas aromatica (strain RCB)
P56003 7.04e-19 92 27 10 265 3 tuf Elongation factor Tu Helicobacter pylori (strain ATCC 700392 / 26695)
P42479 7.05e-19 92 27 14 347 3 tuf Elongation factor Tu Stigmatella aurantiaca
A5FZW7 7.59e-19 91 27 12 343 3 tuf Elongation factor Tu Acidiphilium cryptum (strain JF-5)
B7J241 7.88e-19 91 26 7 311 3 tuf Elongation factor Tu Borreliella burgdorferi (strain ZS7)
P50062 7.88e-19 91 26 7 311 3 tuf Elongation factor Tu Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
C3PKP2 7.95e-19 91 36 2 135 3 tuf Elongation factor Tu Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
B2UUW8 8.16e-19 91 26 7 262 3 tuf Elongation factor Tu Helicobacter pylori (strain Shi470)
P33165 8.18e-19 91 25 11 328 3 tuf Elongation factor Tu Bacteroides fragilis (strain YCH46)
Q5L890 8.18e-19 91 25 11 328 3 tuf Elongation factor Tu Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
P42439 8.32e-19 91 28 9 265 3 tuf Elongation factor Tu Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QBH0 8.4e-19 91 28 9 265 3 tuf Elongation factor Tu Corynebacterium glutamicum (strain R)
Q7VA05 8.71e-19 91 27 14 338 3 tuf Elongation factor Tu Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q01698 8.74e-19 91 25 12 348 1 tuf Elongation factor Tu Thermus aquaticus
A2C4U5 8.95e-19 91 35 5 167 3 tuf Elongation factor Tu Prochlorococcus marinus (strain NATL1A)
Q13TF5 9.13e-19 91 26 20 449 3 tuf1 Elongation factor Tu Paraburkholderia xenovorans (strain LB400)
B6JN44 9.73e-19 91 27 9 264 3 tuf Elongation factor Tu Helicobacter pylori (strain P12)
Q0K5Z9 1.05e-18 91 28 14 325 3 tuf1 Elongation factor Tu Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7M7F1 1.06e-18 91 28 13 307 3 tuf1 Elongation factor Tu Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q3A9P8 1.15e-18 91 27 14 332 3 tuf2 Elongation factor Tu 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A4XI37 1.19e-18 91 25 12 345 3 tuf Elongation factor Tu Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q8BFR5 1.2e-18 91 28 15 323 1 Tufm Elongation factor Tu, mitochondrial Mus musculus
B5Z8K3 1.23e-18 91 25 7 262 3 tuf Elongation factor Tu Helicobacter pylori (strain G27)
A8YUS2 1.23e-18 91 30 7 209 3 tuf Elongation factor Tu Lactobacillus helveticus (strain DPC 4571)
A9BHA7 1.26e-18 91 24 18 450 3 tuf Elongation factor Tu Petrotoga mobilis (strain DSM 10674 / SJ95)
Q4A7K0 1.43e-18 91 26 12 340 3 tuf Elongation factor Tu Mesomycoplasma hyopneumoniae (strain 7448)
Q600B6 1.43e-18 91 26 12 340 3 tuf Elongation factor Tu Mesomycoplasma hyopneumoniae (strain 232)
Q72GW4 1.44e-18 91 24 12 348 3 tuf1 Elongation factor Tu Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q83GW1 1.45e-18 90 24 12 331 3 tuf Elongation factor Tu Tropheryma whipplei (strain Twist)
B8ELG5 1.49e-18 90 27 10 318 3 tuf Elongation factor Tu Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q055E6 1.51e-18 90 28 12 273 3 tuf1 Elongation factor Tu Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04PT6 1.51e-18 90 28 12 273 3 tuf Elongation factor Tu Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q042T5 1.53e-18 90 25 12 331 3 tuf Elongation factor Tu Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
P85834 1.56e-18 91 29 15 323 1 Tufm Elongation factor Tu, mitochondrial Rattus norvegicus
Q74JU6 1.56e-18 90 31 7 208 3 tuf Elongation factor Tu Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A1T056 1.65e-18 90 27 11 321 3 tuf Elongation factor Tu Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q4A9G1 1.67e-18 90 26 12 340 3 tuf Elongation factor Tu Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q9ZK19 1.76e-18 90 26 7 262 3 tuf Elongation factor Tu Helicobacter pylori (strain J99 / ATCC 700824)
Q04FQ4 1.76e-18 90 28 10 273 3 tuf Elongation factor Tu Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q7VJ74 1.82e-18 90 25 10 329 3 tuf Elongation factor Tu Helicobacter hepaticus (strain ATCC 51449 / 3B1)
P33167 1.88e-18 90 27 14 351 3 tuf Elongation factor Tu Burkholderia cepacia
Q2YAZ9 1.91e-18 90 26 14 354 3 tuf1 Elongation factor Tu Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
C4ZB99 1.99e-18 90 27 15 328 3 tuf Elongation factor Tu Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
P60338 2.06e-18 90 24 12 348 1 tufA Elongation factor Tu-A Thermus thermophilus
Q5SHN6 2.06e-18 90 24 12 348 1 tufA Elongation factor Tu-A Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
C5CC66 2.2e-18 90 26 13 349 3 tuf Elongation factor Tu Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
Q661E5 2.22e-18 90 25 7 311 3 tuf Elongation factor Tu Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q83ES6 2.24e-18 90 28 14 342 1 tufA Elongation factor Tu Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NAK7 2.24e-18 90 28 14 342 3 tuf1 Elongation factor Tu Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KD33 2.24e-18 90 28 14 342 3 tuf1 Elongation factor Tu Coxiella burnetii (strain Dugway 5J108-111)
B0SSH9 2.27e-18 90 27 11 291 3 tuf Elongation factor Tu Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SAF6 2.27e-18 90 27 11 291 3 tuf Elongation factor Tu Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q039K9 2.28e-18 90 26 11 318 3 tuf Elongation factor Tu Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WE38 2.28e-18 90 26 11 318 3 tuf Elongation factor Tu Lacticaseibacillus casei (strain BL23)
A0KRL0 2.33e-18 90 26 12 319 3 tuf1 Elongation factor Tu Shewanella sp. (strain ANA-3)
Q0I0B9 2.37e-18 90 25 12 331 3 tuf1 Elongation factor Tu 1 Shewanella sp. (strain MR-7)
Q0HNV1 2.37e-18 90 25 12 331 3 tuf1 Elongation factor Tu 1 Shewanella sp. (strain MR-4)
B8DTV7 2.41e-18 90 25 9 342 3 tuf Elongation factor Tu Bifidobacterium animalis subsp. lactis (strain AD011)
Q0SN31 2.41e-18 90 26 9 315 3 tuf Elongation factor Tu Borreliella afzelii (strain PKo)
Q0AUG3 2.47e-18 90 27 10 318 3 tuf2 Elongation factor Tu 2 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B3ETZ7 2.48e-18 90 26 14 342 3 tuf Elongation factor Tu Amoebophilus asiaticus (strain 5a2)
Q83NT9 2.5e-18 90 24 13 335 3 tuf Elongation factor Tu Tropheryma whipplei (strain TW08/27)
Q07KJ2 2.53e-18 90 26 11 318 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain BisA53)
Q2JFH8 2.55e-18 90 26 13 352 3 tuf Elongation factor Tu Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A6LE88 2.55e-18 90 26 10 330 3 tuf Elongation factor Tu Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q5GWR8 2.57e-18 90 24 16 448 3 tuf1 Elongation factor Tu Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NZX1 2.57e-18 90 24 16 448 3 tuf1 Elongation factor Tu Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P13927 2.58e-18 90 25 11 326 3 tuf Elongation factor Tu Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
A4SUU7 2.69e-18 90 27 14 344 3 tuf1 Elongation factor Tu Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
P30768 2.85e-18 90 26 10 339 3 tuf Elongation factor Tu Mycobacterium leprae (strain TN)
B8ZSC1 2.85e-18 90 26 10 339 3 tuf Elongation factor Tu Mycobacterium leprae (strain Br4923)
A9H3R7 2.85e-18 90 25 10 353 3 tuf Elongation factor Tu Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q3A9R3 2.92e-18 90 26 14 332 3 tuf1 Elongation factor Tu 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8FS84 3.01e-18 90 27 8 265 3 tuf Elongation factor Tu Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q21RV6 3.36e-18 89 27 12 321 3 tuf2 Elongation factor Tu 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q0I0A7 3.49e-18 89 30 5 196 3 tuf2 Elongation factor Tu 2 Shewanella sp. (strain MR-7)
Q21SF0 3.52e-18 89 27 12 321 3 tuf1 Elongation factor Tu 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q0HNT9 3.56e-18 89 30 5 196 3 tuf2 Elongation factor Tu 2 Shewanella sp. (strain MR-4)
Q03YI2 3.83e-18 89 27 13 332 3 tuf Elongation factor Tu Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q0ID59 3.89e-18 89 34 2 155 3 tuf Elongation factor Tu Synechococcus sp. (strain CC9311)
A0LIH6 4.11e-18 89 25 11 351 3 tuf1 Elongation factor Tu Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q123F6 4.16e-18 89 26 13 323 3 tuf1 Elongation factor Tu Polaromonas sp. (strain JS666 / ATCC BAA-500)
P49411 4.37e-18 90 28 13 332 1 TUFM Elongation factor Tu, mitochondrial Homo sapiens

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11060
Feature type CDS
Gene cysN
Product sulfate adenylyltransferase subunit CysN
Location 2433227 - 2434684 (strand: -1)
Length 1458 (nucleotides) / 485 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_169
Orthogroup size 10
N. genomes 7

Actions

Genomic region

Domains

PF00009 Elongation factor Tu GTP binding domain
PF22594 GTP-eEF1A C-terminal domain-like

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2895 Inorganic ion transport and metabolism (P) P Sulfate adenylyltransferase subunit 1, EFTu-like GTPase family

Kegg Ortholog Annotation(s)

Protein Sequence

MGLAAIKTNQLIAGEIAQSGGVENYLKTQQNKGLLRFLTCGNVDDGKSTLIGRLLHDTRQIYEDQLSTLQNESKKIGTQGEKLDLALLVDGLAAEREQGITIDVAYRYFSTAKRKFIIADTPGHAQYTRNMATGASTSTLSILLIDARKGVQEQTRRHSFISTLLGIRHLVVAINKMDLLDYQQEIFESIQQDYLHFAQQLPRDLTIEFVPISALEGDNVVSPSLNMPWYTGETLLALLEDAPVKFKLGAKSQRLRFPVQYVNRPDLDFRGYSGTVSSGSLYQGQQIKVLPSGQRSTIKRIVTFDGDLTQAQVGQAITLVLADEIDISRGDIIVDANDTTANVSNHALVDIVWMSEQPLVQGQTLDIKVAGKKSRAKIENIHYQVDVDKLTQQVTESLALNAIGHVEVLFEEPLVLDNYQLNAQTGGLIFIDRLSNVTVGAGLIREIRDNVQPTTSQYDAFEIELNQLIRRHFPHWGARDLLGGK

Flanking regions ( +/- flanking 50bp)

GCTTCAATGGAACTTAAAAAACGTCAGGGTTATTTTTAATAGGAGTCACTATGGGACTTGCAGCCATCAAAACCAACCAACTGATCGCCGGTGAAATAGCACAATCAGGTGGTGTAGAAAATTATTTAAAAACACAACAGAACAAAGGGTTATTACGTTTTTTAACCTGTGGCAATGTTGATGACGGAAAAAGCACCTTAATTGGTCGCTTACTTCATGATACGCGGCAGATCTACGAAGATCAGCTCTCCACCTTACAAAACGAAAGTAAAAAGATTGGTACTCAAGGTGAAAAATTAGATCTCGCTTTGCTGGTGGACGGTTTAGCGGCTGAACGAGAGCAAGGGATCACTATTGATGTAGCTTATCGCTATTTTTCAACAGCCAAACGAAAATTTATTATTGCCGATACGCCGGGACATGCACAATATACCCGCAATATGGCGACAGGAGCATCAACGAGTACGCTTTCTATTCTGCTGATCGATGCTCGAAAAGGGGTACAAGAGCAAACTCGCCGCCATAGTTTTATTAGCACACTCCTTGGGATCCGTCACTTAGTGGTCGCGATTAATAAAATGGATCTACTTGATTATCAACAAGAGATCTTTGAGTCGATCCAACAAGATTACCTGCACTTTGCACAACAATTACCGCGCGATCTCACTATCGAATTTGTGCCTATCTCTGCACTGGAGGGAGATAATGTAGTATCTCCTTCATTAAATATGCCTTGGTATACAGGAGAAACACTGTTGGCATTACTTGAAGATGCGCCGGTTAAATTTAAATTAGGGGCTAAATCTCAAAGATTGCGTTTTCCTGTACAGTATGTGAATCGTCCTGATTTAGATTTTAGAGGCTACAGTGGCACAGTTTCATCAGGCTCTCTTTATCAAGGACAACAGATCAAAGTATTACCCTCAGGACAGCGTTCAACCATTAAACGTATTGTGACTTTTGATGGCGATCTGACTCAGGCGCAAGTGGGTCAAGCGATTACACTGGTGTTAGCGGATGAAATCGATATTAGTCGTGGCGACATTATTGTTGATGCTAACGATACTACTGCTAATGTTAGCAATCATGCGTTGGTGGATATCGTATGGATGTCAGAACAACCGTTAGTACAGGGGCAAACCCTTGATATCAAAGTAGCGGGCAAAAAAAGTCGTGCCAAAATAGAGAATATTCACTATCAAGTTGATGTGGATAAGCTCACTCAACAAGTGACCGAAAGTTTAGCGCTAAATGCCATTGGGCATGTTGAAGTGTTATTTGAAGAGCCATTGGTGCTGGATAACTATCAACTTAATGCACAAACAGGAGGGCTTATTTTTATTGATAGATTAAGCAATGTCACGGTGGGTGCTGGTCTTATTCGAGAAATTCGCGACAACGTGCAACCCACAACTTCCCAATACGATGCATTTGAAATTGAACTCAATCAGTTGATCCGCCGCCATTTTCCGCATTGGGGCGCAAGAGACTTACTGGGAGGAAAATAGTGACGATACATCAAGATATTGTCTGGCATCCTCATCAAATAGGGTTAAAA