Homologs in group_154

Help

9 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17540 FBDBKF_17540 93.4 Morganella morganii S1 tuf elongation factor Tu
EHELCC_19980 EHELCC_19980 88.9 Morganella morganii S2 - hypothetical protein
NLDBIP_19970 NLDBIP_19970 88.9 Morganella morganii S4 - hypothetical protein
LHKJJB_19935 LHKJJB_19935 88.9 Morganella morganii S3 - hypothetical protein
HKOGLL_19750 HKOGLL_19750 88.9 Morganella morganii S5 - hypothetical protein
F4V73_RS14925 F4V73_RS14925 92.4 Morganella psychrotolerans tuf elongation factor Tu
F4V73_RS18900 F4V73_RS18900 92.4 Morganella psychrotolerans tuf elongation factor Tu
PMI_RS11060 PMI_RS11060 29.8 Proteus mirabilis HI4320 cysN sulfate adenylyltransferase subunit CysN
PMI_RS16130 PMI_RS16130 99.5 Proteus mirabilis HI4320 tuf elongation factor Tu

Distribution of the homologs in the orthogroup group_154

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_154

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A6TEX7 0 738 94 0 394 3 tufA Elongation factor Tu Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P0A1H5 0 736 94 0 394 3 tufA Elongation factor Tu Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1H6 0 736 94 0 394 3 tufA Elongation factor Tu Salmonella typhi
A9MT05 0 736 94 0 394 3 tuf1 Elongation factor Tu Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PIW4 0 736 94 0 394 3 tuf1 Elongation factor Tu Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57H76 0 736 94 0 394 3 tuf1 Elongation factor Tu Salmonella choleraesuis (strain SC-B67)
A9MHG0 0 736 94 0 394 3 tuf1 Elongation factor Tu Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q83JC4 0 736 94 0 394 3 tufA Elongation factor Tu Shigella flexneri
Q32B27 0 736 94 0 394 3 tuf1 Elongation factor Tu Shigella dysenteriae serotype 1 (strain Sd197)
Q31VV0 0 736 94 0 394 3 tuf1 Elongation factor Tu Shigella boydii serotype 4 (strain Sb227)
A7MKI5 0 736 94 0 394 3 tuf1 Elongation factor Tu Cronobacter sakazakii (strain ATCC BAA-894)
Q3YWT3 0 736 94 0 394 3 tuf1 Elongation factor Tu 1 Shigella sonnei (strain Ss046)
Q1R5Y2 0 736 94 0 394 1 tuf1 Elongation factor Tu 1 Escherichia coli (strain UTI89 / UPEC)
P0CE47 0 736 94 0 394 1 tufA Elongation factor Tu 1 Escherichia coli (strain K12)
B1IPW0 0 736 94 0 394 3 tuf1 Elongation factor Tu 1 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TCC0 0 736 94 0 394 3 tuf1 Elongation factor Tu 1 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGM6 0 736 94 0 394 3 tuf1 Elongation factor Tu 1 Escherichia coli O1:K1 / APEC
A8A5E6 0 736 94 0 394 3 tuf1 Elongation factor Tu 1 Escherichia coli O9:H4 (strain HS)
A7ZSL4 0 736 94 0 394 3 tuf1 Elongation factor Tu 1 Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0SZX8 0 735 94 0 394 3 tuf1 Elongation factor Tu 1 Shigella flexneri serotype 5b (strain 8401)
P0A6N2 0 734 94 0 393 3 tufA Elongation factor Tu Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A6N3 0 734 94 0 393 3 tufA Elongation factor Tu Escherichia coli O157:H7
Q3YV04 0 734 94 0 393 3 tuf2 Elongation factor Tu 2 Shigella sonnei (strain Ss046)
Q0SY20 0 734 94 0 393 3 tuf2 Elongation factor Tu 2 Shigella flexneri serotype 5b (strain 8401)
Q1R5U4 0 734 94 0 393 3 tuf2 Elongation factor Tu 2 Escherichia coli (strain UTI89 / UPEC)
P0CE48 0 734 94 0 393 1 tufB Elongation factor Tu 2 Escherichia coli (strain K12)
B1IVA7 0 734 94 0 393 3 tuf2 Elongation factor Tu 2 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TA85 0 734 94 0 393 3 tuf2 Elongation factor Tu 2 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AIF3 0 734 94 0 393 3 tuf2 Elongation factor Tu 2 Escherichia coli O1:K1 / APEC
A8A779 0 734 94 0 393 3 tuf2 Elongation factor Tu 2 Escherichia coli O9:H4 (strain HS)
Q7MYE8 0 734 94 0 393 3 tuf2 Elongation factor Tu 2 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4W5A0 0 734 94 0 393 3 tuf1 Elongation factor Tu Enterobacter sp. (strain 638)
A7ZUJ2 0 733 94 0 393 3 tuf2 Elongation factor Tu 2 Escherichia coli O139:H28 (strain E24377A / ETEC)
C4K4F8 0 733 89 0 393 3 tuf Elongation factor Tu Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q7N9B1 0 732 94 0 393 3 tuf1 Elongation factor Tu 1 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4TS36 0 731 93 0 393 3 tuf2 Elongation factor Tu 2 Yersinia pestis (strain Pestoides F)
Q8ZAN8 0 731 93 0 393 3 tufB Elongation factor Tu-B Yersinia pestis
Q1C1T4 0 731 93 0 393 3 tuf2 Elongation factor Tu 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q66FQ9 0 731 93 0 393 3 tuf1 Elongation factor Tu 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FNJ0 0 731 93 0 393 3 tuf1 Elongation factor Tu 1 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q1CN86 0 729 93 0 393 3 tuf1 Elongation factor Tu 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q2NQL7 0 728 93 0 393 3 tuf1 Elongation factor Tu Sodalis glossinidius (strain morsitans)
Q6CZW6 0 726 93 0 393 3 tuf1 Elongation factor Tu Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q664R7 0 726 93 0 393 3 tuf2 Elongation factor Tu 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CCT9 0 726 93 0 393 3 tuf2 Elongation factor Tu 2 Yersinia pestis bv. Antiqua (strain Nepal516)
A7FNN8 0 726 93 0 393 3 tuf2 Elongation factor Tu 2 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8GKK1 0 726 93 0 393 3 tuf2 Elongation factor Tu 2 Serratia proteamaculans (strain 568)
A4TGY7 0 726 93 0 393 3 tuf1 Elongation factor Tu 1 Yersinia pestis (strain Pestoides F)
Q8ZJB2 0 726 93 0 393 3 tufA Elongation factor Tu-A Yersinia pestis
Q1C2U1 0 726 93 0 393 3 tuf1 Elongation factor Tu 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q0I0B9 0 724 88 0 394 3 tuf1 Elongation factor Tu 1 Shewanella sp. (strain MR-7)
Q0HNV1 0 724 88 0 394 3 tuf1 Elongation factor Tu 1 Shewanella sp. (strain MR-4)
A8G8E0 0 724 93 0 393 3 tuf1 Elongation factor Tu 1 Serratia proteamaculans (strain 568)
A0KRL0 0 722 87 0 394 3 tuf1 Elongation factor Tu Shewanella sp. (strain ANA-3)
Q65QG6 0 722 92 0 393 3 tuf1 Elongation factor Tu Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VKH7 0 721 92 0 393 3 tuf1 Elongation factor Tu Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A1JIH3 0 720 92 0 393 3 tuf1 Elongation factor Tu 1 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P43926 0 716 91 0 393 3 tufA Elongation factor Tu Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UHC1 0 716 91 0 393 3 tuf Elongation factor Tu Haemophilus influenzae (strain PittGG)
A5U9R1 0 716 91 0 393 3 tuf1 Elongation factor Tu Haemophilus influenzae (strain PittEE)
Q4QMT5 0 716 91 0 393 3 tuf2 Elongation factor Tu 2 Haemophilus influenzae (strain 86-028NP)
A1JS52 0 715 91 0 393 3 tuf2 Elongation factor Tu 2 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q4QMW6 0 714 91 0 393 3 tuf1 Elongation factor Tu 1 Haemophilus influenzae (strain 86-028NP)
P57939 0 713 91 0 393 3 tufA Elongation factor Tu-A Pasteurella multocida (strain Pm70)
Q7TTF9 0 713 92 0 393 3 tufA Elongation factor Tu Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q1LSY4 0 712 86 0 393 3 tuf Elongation factor Tu Baumannia cicadellinicola subsp. Homalodisca coagulata
B0UV21 0 710 91 0 393 3 tuf Elongation factor Tu Histophilus somni (strain 2336)
Q0I1U9 0 710 91 0 393 3 tuf1 Elongation factor Tu Histophilus somni (strain 129Pt)
Q0I0A7 0 710 88 0 394 3 tuf2 Elongation factor Tu 2 Shewanella sp. (strain MR-7)
B0BQZ3 0 709 91 0 393 3 tuf1 Elongation factor Tu Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N246 0 709 91 0 393 3 tuf1 Elongation factor Tu Actinobacillus pleuropneumoniae serotype 5b (strain L20)
P57966 0 708 90 0 393 3 tufB Elongation factor Tu-B Pasteurella multocida (strain Pm70)
Q8EK70 0 708 87 0 394 3 tuf2 Elongation factor Tu 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B4RYQ8 0 707 90 0 393 3 tuf Elongation factor Tu Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q0HNT9 0 707 87 0 394 3 tuf2 Elongation factor Tu 2 Shewanella sp. (strain MR-4)
Q8EK81 0 704 87 0 394 3 tuf1 Elongation factor Tu 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q15NP2 0 701 88 0 393 3 tuf1 Elongation factor Tu Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A3Q980 0 699 89 0 393 3 tuf2 Elongation factor Tu 2 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A5F3K0 0 698 89 0 393 3 tuf1 Elongation factor Tu Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KUZ6 0 698 89 0 393 3 tufB Elongation factor Tu-B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A3Q968 0 698 89 0 393 3 tuf1 Elongation factor Tu 1 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1S204 0 697 89 0 392 3 tuf1 Elongation factor Tu Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q12SW1 0 696 87 0 394 3 tuf Elongation factor Tu Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q9KV37 0 695 89 0 393 3 tufA Elongation factor Tu-A Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P33169 0 693 88 0 393 3 tuf Elongation factor Tu Shewanella putrefaciens
A4YBY5 0 693 88 0 393 3 tuf1 Elongation factor Tu Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A0KQ95 0 693 88 0 393 3 tuf1 Elongation factor Tu Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q5QWA3 0 689 87 0 393 3 tuf1 Elongation factor Tu Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q492B2 0 688 84 0 393 3 tuf Elongation factor Tu Blochmanniella pennsylvanica (strain BPEN)
Q089R8 0 688 86 0 394 3 tuf1 Elongation factor Tu 1 Shewanella frigidimarina (strain NCIMB 400)
P59506 0 687 86 0 393 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q089Q6 0 686 86 0 394 3 tuf2 Elongation factor Tu 2 Shewanella frigidimarina (strain NCIMB 400)
A8G1F0 0 686 87 0 393 3 tuf Elongation factor Tu Shewanella sediminis (strain HAW-EB3)
Q057A2 0 686 87 0 393 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Cinara cedri (strain Cc)
O31298 0 685 89 0 393 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A8GYW2 0 682 87 0 393 3 tuf1 Elongation factor Tu Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TM14 0 682 87 0 393 3 tuf1 Elongation factor Tu Shewanella halifaxensis (strain HAW-EB4)
P09591 0 681 83 1 396 1 tufA Elongation factor Tu Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02T82 0 681 83 1 396 1 tuf1 Elongation factor Tu Pseudomonas aeruginosa (strain UCBPP-PA14)
A6UZH4 0 681 83 1 396 3 tuf1 Elongation factor Tu Pseudomonas aeruginosa (strain PA7)
A4SHU2 0 681 86 0 393 3 tuf1 Elongation factor Tu Aeromonas salmonicida (strain A449)
Q7MH43 0 681 88 0 393 3 tuf1 Elongation factor Tu 1 Vibrio vulnificus (strain YJ016)
Q7VRP0 0 681 85 0 393 3 tuf Elongation factor Tu Blochmanniella floridana
B8D851 0 680 88 0 393 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
O31297 0 680 88 0 393 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9U9 0 680 88 0 393 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q3ILP4 0 680 86 0 394 3 tuf1 Elongation factor Tu 1 Pseudoalteromonas translucida (strain TAC 125)
Q8DCQ7 0 679 88 0 393 3 tuf2 Elongation factor Tu 2 Vibrio vulnificus (strain CMCP6)
A9KW88 0 679 88 0 393 3 tuf1 Elongation factor Tu 1 Shewanella baltica (strain OS195)
Q7MGR1 0 679 88 0 393 3 tuf2 Elongation factor Tu 2 Vibrio vulnificus (strain YJ016)
Q8DD27 0 679 88 0 393 3 tuf1 Elongation factor Tu 1 Vibrio vulnificus (strain CMCP6)
A6WHR4 0 678 88 0 393 3 tuf1 Elongation factor Tu Shewanella baltica (strain OS185)
A9KWA0 0 678 88 0 393 3 tuf2 Elongation factor Tu 2 Shewanella baltica (strain OS195)
A3DBA0 0 678 88 0 393 3 tuf2 Elongation factor Tu 2 Shewanella baltica (strain OS155 / ATCC BAA-1091)
A3DA74 0 678 88 0 393 3 tuf1 Elongation factor Tu 1 Shewanella baltica (strain OS155 / ATCC BAA-1091)
A5EX84 0 678 82 1 395 3 tuf Elongation factor Tu Dichelobacter nodosus (strain VCS1703A)
Q3IJV1 0 677 86 0 394 3 tuf2 Elongation factor Tu 2 Pseudoalteromonas translucida (strain TAC 125)
A7MXE4 0 677 88 0 393 3 tuf1 Elongation factor Tu Vibrio campbellii (strain ATCC BAA-1116)
A1KRF9 0 676 84 0 394 3 tuf1 Elongation factor Tu Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P64027 0 676 84 0 394 1 tufA Elongation factor Tu Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P64026 0 676 84 0 394 3 tufA Elongation factor Tu Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5F5Q8 0 674 84 0 394 3 tuf1 Elongation factor Tu Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q877T5 0 673 87 0 393 3 tufA Elongation factor Tu Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A4JAM5 0 671 81 1 395 3 tuf1 Elongation factor Tu Burkholderia vietnamiensis (strain G4 / LMG 22486)
P42481 0 670 81 1 395 3 tuf Elongation factor Tu Thiomonas delicata
Q1H4Q1 0 670 82 1 395 3 tuf1 Elongation factor Tu 1 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q13TF5 0 670 81 1 395 3 tuf1 Elongation factor Tu Paraburkholderia xenovorans (strain LB400)
Q83ES6 0 670 80 2 396 1 tufA Elongation factor Tu Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NAK7 0 670 80 2 396 3 tuf1 Elongation factor Tu Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KD33 0 670 80 2 396 3 tuf1 Elongation factor Tu Coxiella burnetii (strain Dugway 5J108-111)
Q8D240 0 669 83 0 393 3 tuf Elongation factor Tu Wigglesworthia glossinidia brevipalpis
A4SUU7 0 669 81 1 395 3 tuf1 Elongation factor Tu Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q2YAZ9 0 669 80 1 395 3 tuf1 Elongation factor Tu Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7TT91 0 669 81 1 395 3 tuf1 Elongation factor Tu Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q79GC6 0 669 81 1 395 3 tuf1 Elongation factor Tu Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q79G84 0 669 81 1 395 3 tuf1 Elongation factor Tu Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q6LLV5 0 669 87 0 393 3 tuf2 Elongation factor Tu 2 Photobacterium profundum (strain SS9)
Q1H4N9 0 669 81 1 395 3 tuf2 Elongation factor Tu 2 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1BRT3 0 668 81 1 395 3 tuf1 Elongation factor Tu Burkholderia orbicola (strain AU 1054)
Q39KI2 0 668 81 1 395 3 tuf1 Elongation factor Tu Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BJ48 0 668 81 1 395 3 tuf1 Elongation factor Tu Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0K3L0 0 668 81 1 395 3 tuf1 Elongation factor Tu Burkholderia cenocepacia (strain HI2424)
A4VHM8 0 667 81 1 396 3 tuf2 Elongation factor Tu 2 Stutzerimonas stutzeri (strain A1501)
Q2L2G6 0 667 80 1 395 3 tuf1 Elongation factor Tu Bordetella avium (strain 197N)
Q6LVC0 0 667 87 0 393 3 tuf1 Elongation factor Tu 1 Photobacterium profundum (strain SS9)
P33167 0 666 81 1 395 3 tuf Elongation factor Tu Burkholderia cepacia
Q47UU9 0 666 83 0 393 3 tuf1 Elongation factor Tu Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3SLQ1 0 665 82 1 394 3 tuf1 Elongation factor Tu Thiobacillus denitrificans (strain ATCC 25259)
P48864 0 665 83 0 394 3 tuf Elongation factor Tu Neisseria gonorrhoeae
Q605B0 0 665 80 2 395 3 tuf1 Elongation factor Tu Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q2SU25 0 665 80 1 395 3 tuf1 Elongation factor Tu Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PZ6 0 665 80 1 395 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain K96243)
A3NEI1 0 665 80 1 395 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 668)
Q3JMP6 0 665 80 1 395 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 1710b)
A3P0B5 0 665 80 1 395 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 1106a)
A1V8A5 0 665 80 1 395 3 tuf1 Elongation factor Tu Burkholderia mallei (strain SAVP1)
Q62GK3 0 665 80 1 395 3 tuf1 Elongation factor Tu Burkholderia mallei (strain ATCC 23344)
A2S7F9 0 665 80 1 395 3 tuf1 Elongation factor Tu Burkholderia mallei (strain NCTC 10229)
A3MRT8 0 665 80 1 395 3 tuf1 Elongation factor Tu Burkholderia mallei (strain NCTC 10247)
Q21RV6 0 665 81 1 395 3 tuf2 Elongation factor Tu 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A4VHL6 0 665 81 1 396 3 tuf1 Elongation factor Tu 1 Stutzerimonas stutzeri (strain A1501)
Q21SF0 0 664 80 1 395 3 tuf1 Elongation factor Tu 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A4XZ92 0 664 80 1 396 3 tuf Elongation factor Tu Pseudomonas mendocina (strain ymp)
C5BQ44 0 664 80 2 406 3 tuf Elongation factor Tu Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q21M86 0 664 79 3 406 3 tuf1 Elongation factor Tu Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8XGZ0 0 664 80 1 395 3 tufA Elongation factor Tu Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3J8Q0 0 663 79 1 395 3 tuf1 Elongation factor Tu Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q0K5Z9 0 662 80 1 395 3 tuf1 Elongation factor Tu Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1LI13 0 662 80 1 395 3 tuf1 Elongation factor Tu Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A1VIP8 0 662 80 1 395 3 tuf1 Elongation factor Tu Polaromonas naphthalenivorans (strain CJ2)
A6W394 0 661 79 2 406 3 tuf Elongation factor Tu Marinomonas sp. (strain MWYL1)
Q46WC7 0 661 80 1 395 3 tuf1 Elongation factor Tu Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A6T3K6 0 660 80 1 395 3 tuf1 Elongation factor Tu Janthinobacterium sp. (strain Marseille)
A1T056 0 659 83 0 393 3 tuf Elongation factor Tu Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q123F6 0 658 79 1 395 3 tuf1 Elongation factor Tu Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q81ZS3 0 658 82 1 395 3 tuf1 Elongation factor Tu Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q3BWY6 0 658 78 1 395 3 tuf1 Elongation factor Tu Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8NL22 0 658 78 1 395 3 tufA Elongation factor Tu Xanthomonas axonopodis pv. citri (strain 306)
A3M1F6 0 656 85 1 394 3 tuf1 Elongation factor Tu Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B7H1K5 0 656 85 1 394 3 tuf Elongation factor Tu Acinetobacter baumannii (strain AB307-0294)
Q4K519 0 655 79 1 396 3 tuf1 Elongation factor Tu Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5WZL4 0 655 82 2 395 3 tuf1 Elongation factor Tu Legionella pneumophila (strain Lens)
Q5ZYP5 0 654 82 2 395 3 tuf1 Elongation factor Tu Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IHR6 0 654 82 2 395 3 tuf1 Elongation factor Tu Legionella pneumophila (strain Corby)
Q5X873 0 654 82 2 395 3 tuf1 Elongation factor Tu Legionella pneumophila (strain Paris)
A8F2E9 0 653 79 0 392 3 tuf Elongation factor Tu Rickettsia massiliae (strain Mtu5)
A1TYJ5 0 653 83 2 397 3 tuf Elongation factor Tu Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B0TX03 0 653 82 0 393 3 tuf Elongation factor Tu Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A1WVD6 0 653 78 1 395 3 tuf2 Elongation factor Tu 2 Halorhodospira halophila (strain DSM 244 / SL1)
Q2S8Z8 0 652 83 1 396 3 tuf1 Elongation factor Tu Hahella chejuensis (strain KCTC 2396)
A8GT71 0 652 79 0 392 3 tuf Elongation factor Tu Rickettsia rickettsii (strain Sheila Smith)
B0BUR2 0 652 79 0 392 3 tuf Elongation factor Tu Rickettsia rickettsii (strain Iowa)
C4K2I2 0 652 79 0 392 3 tuf Elongation factor Tu Rickettsia peacockii (strain Rustic)
A8EZL8 0 652 79 0 392 3 tuf Elongation factor Tu Rickettsia canadensis (strain McKiel)
C3PPA9 0 652 79 0 392 3 tuf Elongation factor Tu Rickettsia africae (strain ESF-5)
Q6FF97 0 652 84 1 394 3 tuf1 Elongation factor Tu Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8KTA1 0 652 79 0 392 3 tuf Elongation factor Tu Rickettsia montanensis
A1WVC4 0 652 78 1 395 3 tuf1 Elongation factor Tu 1 Halorhodospira halophila (strain DSM 244 / SL1)
Q8KTA6 0 651 79 0 392 3 tuf Elongation factor Tu Rickettsia parkeri
Q5GWR8 0 651 77 1 395 3 tuf1 Elongation factor Tu Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NZX1 0 651 77 1 395 3 tuf1 Elongation factor Tu Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8KT99 0 650 79 0 392 3 tuf Elongation factor Tu Rickettsia helvetica
Q889X3 0 650 78 1 397 3 tuf Elongation factor Tu Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0VSL7 0 650 83 1 394 3 tuf1 Elongation factor Tu Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0ABH7 0 650 82 1 395 3 tuf1 Elongation factor Tu Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q92GW4 0 649 79 0 392 3 tuf Elongation factor Tu Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q7M7F1 0 649 81 1 395 3 tuf1 Elongation factor Tu Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P0A3B0 0 649 79 0 392 3 tuf Elongation factor Tu Rickettsia sibirica
P0A3A9 0 649 79 0 392 3 tuf Elongation factor Tu Rickettsia rickettsii
Q0AIJ7 0 648 81 1 395 3 tuf1 Elongation factor Tu 1 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
P48865 0 648 78 0 392 3 tuf Elongation factor Tu Rickettsia prowazekii (strain Madrid E)
Q8KT97 0 647 79 0 392 3 tuf Elongation factor Tu Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q0AF46 0 647 80 1 395 3 tuf2 Elongation factor Tu 2 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A5WGK9 0 647 82 1 394 3 tuf1 Elongation factor Tu 1 Psychrobacter sp. (strain PRwf-1)
Q4ZMP2 0 646 78 1 397 3 tuf Elongation factor Tu Pseudomonas syringae pv. syringae (strain B728a)
A5WH42 0 646 82 1 394 3 tuf2 Elongation factor Tu 2 Psychrobacter sp. (strain PRwf-1)
C3K2X8 0 646 78 1 396 3 tuf Elongation factor Tu Pseudomonas fluorescens (strain SBW25)
A4G9U0 0 646 80 1 395 3 tuf1 Elongation factor Tu Herminiimonas arsenicoxydans
Q47JA5 0 646 80 1 395 3 tuf1 Elongation factor Tu Dechloromonas aromatica (strain RCB)
O31301 0 646 88 0 365 3 tuf Elongation factor Tu (Fragment) Buchnera aphidicola subsp. Schlechtendalia chinensis
Q48D34 0 645 78 1 397 3 tuf Elongation factor Tu Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A6Q1L5 0 645 78 1 398 3 tuf Elongation factor Tu Nitratiruptor sp. (strain SB155-2)
Q134R0 0 645 77 2 398 3 tuf2 Elongation factor Tu 2 Rhodopseudomonas palustris (strain BisB5)
Q8KT95 0 644 78 0 392 3 tuf Elongation factor Tu Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q07KJ2 0 644 77 1 395 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain BisA53)
Q2W2H3 0 644 77 1 395 3 tuf1 Elongation factor Tu Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
O31300 0 644 88 0 365 3 tuf Elongation factor Tu (Fragment) Buchnera aphidicola subsp. Melaphis rhois
Q134S7 0 644 77 2 398 3 tuf1 Elongation factor Tu 1 Rhodopseudomonas palustris (strain BisB5)
Q2IXR2 0 644 77 1 395 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain HaA2)
B0RU96 0 644 77 1 395 3 tuf2 Elongation factor Tu 2 Xanthomonas campestris pv. campestris (strain B100)
Q4URC5 0 644 77 1 395 3 tuf2 Elongation factor Tu 2 Xanthomonas campestris pv. campestris (strain 8004)
Q8PC59 0 644 77 1 395 3 tufA Elongation factor Tu-A Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PC51 0 643 77 1 395 3 tufB Elongation factor Tu-B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4URD7 0 643 77 1 395 3 tuf1 Elongation factor Tu 1 Xanthomonas campestris pv. campestris (strain 8004)
Q6N4Q4 0 643 77 2 398 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A4IW92 0 643 81 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain WY96-3418)
Q0BKB8 0 643 81 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain OSU18)
A0Q874 0 643 81 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. novicida (strain U112)
B2SFC9 0 643 81 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A1M0 0 643 81 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain LVS)
A7NEC7 0 643 81 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q8KTA3 0 642 78 0 392 3 tuf Elongation factor Tu Rickettsia rhipicephali
Q5NID9 0 642 80 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JU2 0 642 80 0 393 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain FSC 198)
Q3SSW8 0 642 77 1 395 3 tuf Elongation factor Tu Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B0RU84 0 642 77 1 395 3 tuf1 Elongation factor Tu 1 Xanthomonas campestris pv. campestris (strain B100)
Q9P9Q9 0 641 78 1 396 1 tufA Elongation factor Tu Xylella fastidiosa (strain 9a5c)
A1W2Q5 0 639 81 1 395 3 tuf1 Elongation factor Tu 1 Acidovorax sp. (strain JS42)
Q877P8 0 639 77 1 396 3 tufA Elongation factor Tu Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q01SX2 0 638 76 1 394 3 tuf1 Elongation factor Tu Solibacter usitatus (strain Ellin6076)
Q211E6 0 638 76 1 395 3 tuf Elongation factor Tu Rhodopseudomonas palustris (strain BisB18)
A1WCN6 0 638 81 1 395 3 tuf2 Elongation factor Tu 2 Acidovorax sp. (strain JS42)
Q1QN32 0 638 76 1 395 3 tuf Elongation factor Tu Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q0BUQ2 0 637 77 1 394 3 tuf Elongation factor Tu Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A7HWP7 0 635 77 1 395 3 tuf1 Elongation factor Tu Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q3K5X4 0 635 78 1 396 3 tuf1 Elongation factor Tu Pseudomonas fluorescens (strain Pf0-1)
A2SLF9 0 634 78 1 395 3 tuf1 Elongation factor Tu Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q1D7V1 0 634 76 1 395 3 tuf1 Elongation factor Tu 1 Myxococcus xanthus (strain DK1622)
Q1D776 0 634 76 1 395 3 tuf2 Elongation factor Tu 2 Myxococcus xanthus (strain DK1622)
A1WHC3 0 633 80 1 395 3 tuf1 Elongation factor Tu Verminephrobacter eiseniae (strain EF01-2)
Q5FTY1 0 633 77 2 394 3 tuf Elongation factor Tu Gluconobacter oxydans (strain 621H)
A7HBL7 0 633 76 1 395 3 tuf1 Elongation factor Tu Anaeromyxobacter sp. (strain Fw109-5)
B2UQY9 0 632 74 0 393 3 tuf Elongation factor Tu Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q8R7V2 0 632 75 2 399 3 tufA Elongation factor Tu-A Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A9H3R7 0 632 76 2 394 3 tuf Elongation factor Tu Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q6AP73 0 632 76 1 395 3 tuf2 Elongation factor Tu 2 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A0RQJ3 0 630 74 1 399 3 tuf Elongation factor Tu Campylobacter fetus subsp. fetus (strain 82-40)
Q8R7T8 0 630 75 2 399 3 tufB Elongation factor Tu-B Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B1JDW6 0 630 78 1 396 3 tuf1 Elongation factor Tu Pseudomonas putida (strain W619)
B0KK53 0 630 78 1 396 3 tuf1 Elongation factor Tu Pseudomonas putida (strain GB-1)
A5VXN3 0 630 78 1 396 3 tuf Elongation factor Tu Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A7ZCN0 0 630 74 1 399 3 tuf Elongation factor Tu Campylobacter concisus (strain 13826)
Q88QP8 0 630 78 1 396 1 tufA Elongation factor Tu-A Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6AP86 0 630 76 1 396 3 tuf1 Elongation factor Tu 1 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q5P334 0 630 83 1 395 3 tuf1 Elongation factor Tu Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q1IFW8 0 629 77 1 396 3 tuf1 Elongation factor Tu Pseudomonas entomophila (strain L48)
Q88QN7 0 629 77 1 396 3 tufB Elongation factor Tu-B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7VJ74 0 629 75 1 398 3 tuf Elongation factor Tu Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A7GK18 0 629 78 1 394 3 tuf Elongation factor Tu Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A1TJ05 0 628 80 1 395 3 tuf1 Elongation factor Tu Paracidovorax citrulli (strain AAC00-1)
A1KB29 0 628 82 1 395 3 tuf1 Elongation factor Tu Azoarcus sp. (strain BH72)
A8GPF2 0 627 77 1 393 3 tuf Elongation factor Tu Rickettsia akari (strain Hartford)
B1HMZ0 0 627 78 1 393 3 tuf Elongation factor Tu Lysinibacillus sphaericus (strain C3-41)
Q2II78 0 627 78 1 395 3 tuf1 Elongation factor Tu Anaeromyxobacter dehalogenans (strain 2CP-C)
A1ALS6 0 626 79 1 395 3 tuf1 Elongation factor Tu Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q250N4 0 626 75 2 399 3 tuf Elongation factor Tu Desulfitobacterium hafniense (strain Y51)
B8G1W4 0 626 75 2 399 3 tuf Elongation factor Tu Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q8R603 0 625 78 0 392 3 tuf Elongation factor Tu Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q1IHG6 0 625 75 1 394 3 tuf1 Elongation factor Tu Koribacter versatilis (strain Ellin345)
A4J0Z5 0 625 75 2 398 3 tuf Elongation factor Tu Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A5FZW7 0 625 77 3 394 3 tuf Elongation factor Tu Acidiphilium cryptum (strain JF-5)
A0LRL8 0 625 76 2 396 3 tuf Elongation factor Tu Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A1B002 0 624 76 3 395 3 tuf1 Elongation factor Tu Paracoccus denitrificans (strain Pd 1222)
A7GZK6 0 624 74 1 399 3 tuf Elongation factor Tu Campylobacter curvus (strain 525.92)
P42479 0 624 76 1 396 3 tuf Elongation factor Tu Stigmatella aurantiaca
A5V604 0 624 75 1 394 3 tuf Elongation factor Tu Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q748X8 0 624 79 1 395 3 tuf1 Elongation factor Tu Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
P42482 0 624 75 1 397 3 tuf Elongation factor Tu Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B9KFF9 0 623 74 1 398 3 tuf Elongation factor Tu Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q5HVZ7 0 623 74 1 398 3 tuf Elongation factor Tu Campylobacter jejuni (strain RM1221)
A1VYI6 0 623 74 1 398 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
O69303 0 623 74 1 398 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7H4R3 0 623 74 1 398 3 tuf Elongation factor Tu Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FKQ5 0 623 74 1 398 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q30X13 0 622 79 1 396 3 tuf Elongation factor Tu Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A5GAW4 0 622 79 1 395 3 tuf1 Elongation factor Tu Geotalea uraniireducens (strain Rf4)
Q2RQU6 0 622 78 1 395 3 tuf2 Elongation factor Tu 2 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A1AX82 0 622 78 1 394 3 tuf2 Elongation factor Tu 2 Ruthia magnifica subsp. Calyptogena magnifica
A1SNN5 0 621 74 2 395 3 tuf Elongation factor Tu Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q1R0H7 0 620 79 1 396 3 tuf Elongation factor Tu Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B7GJ65 0 620 77 1 394 3 tuf Elongation factor Tu Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q1Q8P2 0 620 82 1 395 3 tuf1 Elongation factor Tu Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q2RQV8 0 620 78 1 395 3 tuf1 Elongation factor Tu 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A5CW32 0 620 77 1 394 3 tuf1 Elongation factor Tu Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q3AMT6 0 620 74 1 398 3 tuf Elongation factor Tu Synechococcus sp. (strain CC9605)
Q2RFP5 0 620 74 2 399 3 tuf Elongation factor Tu Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
C0Q9Y7 0 620 74 1 396 3 tuf Elongation factor Tu Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
C5D3R5 0 619 78 1 394 3 tuf Elongation factor Tu Geobacillus sp. (strain WCH70)
Q0AUG3 0 619 74 2 398 3 tuf2 Elongation factor Tu 2 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q0AUH8 0 619 74 2 398 3 tuf1 Elongation factor Tu 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A1AVJ8 0 619 77 1 394 3 tuf1 Elongation factor Tu 1 Ruthia magnifica subsp. Calyptogena magnifica
A4IJI7 0 619 77 1 394 3 tuf Elongation factor Tu Geobacillus thermodenitrificans (strain NG80-2)
Q1RHL9 0 619 75 1 394 3 tuf Elongation factor Tu Rickettsia bellii (strain RML369-C)
A8GVB2 0 619 75 1 394 3 tuf Elongation factor Tu Rickettsia bellii (strain OSU 85-389)
Q2JFH8 0 618 78 2 396 3 tuf Elongation factor Tu Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
O21245 0 618 72 0 393 3 TUFA Elongation factor Tu, mitochondrial Reclinomonas americana
C6C171 0 618 79 1 396 3 tuf Elongation factor Tu Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A5N4N1 0 618 75 2 395 3 tuf1 Elongation factor Tu Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B1KSM7 0 618 74 2 395 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Loch Maree / Type A3)
B5Z8K3 0 617 73 1 398 3 tuf Elongation factor Tu Helicobacter pylori (strain G27)
A4WVL0 0 617 74 2 395 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
B2UUW8 0 616 73 1 398 3 tuf Elongation factor Tu Helicobacter pylori (strain Shi470)
A7GJ76 0 616 74 2 395 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IGF6 0 616 74 2 395 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Okra / Type B1)
A5I7K8 0 616 74 2 395 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZ71 0 616 74 2 395 3 tuf1 Elongation factor Tu Clostridium botulinum (strain ATCC 19397 / Type A)
A5D5I8 0 616 74 2 398 3 tuf2 Elongation factor Tu 2 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A5D5K0 0 616 74 2 398 3 tuf1 Elongation factor Tu 1 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q4FQG6 0 616 81 1 394 3 tuf1 Elongation factor Tu Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B9IZJ2 0 616 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain Q1)
B7HQU2 0 616 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain AH187)
Q73F98 0 616 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain ATCC 10987 / NRS 248)
A4FPM7 0 615 75 2 395 3 tuf Elongation factor Tu Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
P56003 0 615 73 1 398 3 tuf Elongation factor Tu Helicobacter pylori (strain ATCC 700392 / 26695)
Q5L3Z9 0 615 77 1 394 3 tuf Elongation factor Tu Geobacillus kaustophilus (strain HTA426)
Q3J5S4 0 615 74 2 395 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PGI1 0 615 74 2 395 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q6HPR0 0 615 77 1 394 3 tuf Elongation factor Tu Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63H92 0 615 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain ZK / E33L)
Q814C4 0 615 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HJ46 0 615 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain B4264)
C1ET37 0 615 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain 03BB102)
B7IT17 0 615 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain G9842)
B7JKB7 0 615 77 1 394 3 tuf Elongation factor Tu Bacillus cereus (strain AH820)
Q81VT2 0 615 77 1 394 3 tuf Elongation factor Tu Bacillus anthracis
A0R8H8 0 615 77 1 394 3 tuf Elongation factor Tu Bacillus thuringiensis (strain Al Hakam)
C3LJ80 0 615 77 1 394 3 tuf Elongation factor Tu Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9Q3 0 615 77 1 394 3 tuf Elongation factor Tu Bacillus anthracis (strain A0248)
Q47LJ1 0 615 74 2 396 3 tuf Elongation factor Tu Thermobifida fusca (strain YX)
A5GIP0 0 615 73 1 398 3 tuf Elongation factor Tu Synechococcus sp. (strain WH7803)
B3QY22 0 615 73 1 393 3 tuf Elongation factor Tu Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B6JN44 0 615 73 1 398 3 tuf Elongation factor Tu Helicobacter pylori (strain P12)
O50306 0 615 77 1 394 3 tuf Elongation factor Tu Geobacillus stearothermophilus
P33166 0 614 78 2 394 1 tuf Elongation factor Tu Bacillus subtilis (strain 168)
A9VP75 0 614 77 1 394 3 tuf Elongation factor Tu Bacillus mycoides (strain KBAB4)
Q5NQ65 0 614 75 2 396 3 tuf Elongation factor Tu Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q9ZK19 0 613 73 1 398 3 tuf Elongation factor Tu Helicobacter pylori (strain J99 / ATCC 700824)
Q839G8 0 613 78 1 394 3 tuf Elongation factor Tu Enterococcus faecalis (strain ATCC 700802 / V583)
A9KRZ4 0 613 73 3 397 3 tuf Elongation factor Tu Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A9ISD9 0 613 74 2 395 3 tuf1 Elongation factor Tu Bartonella tribocorum (strain CIP 105476 / IBS 506)
A5GW14 0 612 73 1 398 3 tuf Elongation factor Tu Synechococcus sp. (strain RCC307)
B8DLL9 0 612 78 1 396 3 tuf Elongation factor Tu Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q9Z9L6 0 612 77 2 394 3 tuf Elongation factor Tu Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A6LPP6 0 612 75 2 396 3 tuf1 Elongation factor Tu Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A7Z0N5 0 612 77 2 394 3 tuf Elongation factor Tu Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P29542 0 612 73 2 396 3 tuf1 Elongation factor Tu-1 Streptomyces ramocissimus
B0TC54 0 611 73 2 399 3 tuf Elongation factor Tu Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q6A6L7 0 611 73 2 396 3 tuf Elongation factor Tu Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q3A6R2 0 611 77 2 398 3 tuf1 Elongation factor Tu 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
C0ZIH6 0 610 76 2 394 3 tuf Elongation factor Tu Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q3A6P9 0 610 77 2 398 3 tuf2 Elongation factor Tu 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B8I5N8 0 610 74 3 400 3 tuf Elongation factor Tu Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A1T4L6 0 609 74 3 396 3 tuf Elongation factor Tu Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A0QS98 0 609 74 3 396 1 tuf Elongation factor Tu Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q0ANN1 0 609 77 1 395 3 tuf1 Elongation factor Tu Maricaulis maris (strain MCS10)
Q65PA9 0 608 76 2 395 3 tuf Elongation factor Tu Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P33165 0 608 72 0 393 3 tuf Elongation factor Tu Bacteroides fragilis (strain YCH46)
Q5L890 0 608 72 0 393 3 tuf Elongation factor Tu Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A8HTW6 0 608 77 3 396 3 tuf1 Elongation factor Tu Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q5WLR4 0 608 77 2 394 3 tuf Elongation factor Tu Shouchella clausii (strain KSM-K16)
Q99QM0 0 608 77 1 395 3 tufA Elongation factor Tu Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A8MLC4 0 608 77 3 396 3 tuf1 Elongation factor Tu Alkaliphilus oremlandii (strain OhILAs)
B6JET1 0 608 76 1 395 3 tuf Elongation factor Tu Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
C4KZP9 0 608 74 1 394 3 tuf Elongation factor Tu Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q8EX18 0 607 73 0 393 3 tuf Elongation factor Tu Malacoplasma penetrans (strain HF-2)
B9MQH1 0 607 73 3 400 3 tuf Elongation factor Tu Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A9NEN4 0 607 73 0 393 3 tuf Elongation factor Tu Acholeplasma laidlawii (strain PG-8A)
Q7U4D1 0 606 73 1 398 3 tuf Elongation factor Tu Parasynechococcus marenigrum (strain WH8102)
Q8ETY4 0 606 77 1 393 3 tuf Elongation factor Tu Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A1VAK4 0 606 77 1 396 3 tuf Elongation factor Tu Nitratidesulfovibrio vulgaris (strain DP4)
Q727D5 0 606 77 1 396 3 tuf Elongation factor Tu Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q31IY4 0 606 78 1 395 3 tuf1 Elongation factor Tu Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A8LLG2 0 606 76 2 395 3 tuf1 Elongation factor Tu Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A7I3U7 0 606 74 1 399 3 tuf Elongation factor Tu Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q3A9P8 0 606 73 2 398 3 tuf2 Elongation factor Tu 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3A9R3 0 606 73 2 398 3 tuf1 Elongation factor Tu 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B2RL52 0 605 72 1 394 3 tuf Elongation factor Tu Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
A8F982 0 605 76 2 395 3 tuf Elongation factor Tu Bacillus pumilus (strain SAFR-032)
B1YGU8 0 604 75 1 394 3 tuf Elongation factor Tu Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q7V500 0 604 72 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9313)
A4XI37 0 604 73 3 400 3 tuf Elongation factor Tu Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q2S1P8 0 603 72 2 395 3 tuf1 Elongation factor Tu Salinibacter ruber (strain DSM 13855 / M31)
Q1AU14 0 603 74 3 399 3 tuf1 Elongation factor Tu Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A0L5V8 0 603 77 1 395 3 tuf1 Elongation factor Tu Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
C4Z2R9 0 603 72 3 396 3 tuf Elongation factor Tu Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
P64029 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain MW2)
A8YZP5 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBT9 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain MSSA476)
Q6GJC0 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain MRSA252)
P99152 0 603 75 0 393 1 tuf Elongation factor Tu Staphylococcus aureus (strain N315)
P64028 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QEK0 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain Newman)
Q5HIC7 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain COL)
Q2YSB3 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQA2 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain JH9)
Q2G0N0 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ92 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain USA300)
A6TZ25 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain JH1)
A7WYX6 0 603 75 0 393 3 tuf Elongation factor Tu Staphylococcus aureus (strain Mu3 / ATCC 700698)
A2CC87 0 602 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9303)
Q1MPT8 0 602 76 2 396 3 tuf Elongation factor Tu Lawsonia intracellularis (strain PHE/MN1-00)
Q0RRS3 0 602 77 2 396 3 tuf Elongation factor Tu Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
P42475 0 602 72 0 393 3 tuf1 Elongation factor Tu Fibrobacter succinogenes (strain ATCC 19169 / S85)
Q89J82 0 602 75 1 395 3 tuf Elongation factor Tu Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8CQ81 0 601 75 0 393 3 tuf Elongation factor Tu Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRK4 0 601 75 0 393 3 tuf Elongation factor Tu Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A9BCK0 0 601 72 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9211)
B8ELG5 0 601 76 1 394 3 tuf Elongation factor Tu Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
A0ALY8 0 601 76 1 393 3 tuf Elongation factor Tu Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y422 0 601 76 1 393 1 tuf Elongation factor Tu Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WB9 0 601 76 1 393 3 tuf Elongation factor Tu Listeria monocytogenes serotype 4b (strain F2365)
C1KZK6 0 601 76 1 393 3 tuf Elongation factor Tu Listeria monocytogenes serotype 4b (strain CLIP80459)
Q5YPG4 0 601 73 3 396 3 tuf Elongation factor Tu Nocardia farcinica (strain IFM 10152)
Q4L3K9 0 600 75 0 393 3 tuf Elongation factor Tu Staphylococcus haemolyticus (strain JCSC1435)
B8DAY7 0 600 76 1 393 3 tuf Elongation factor Tu Listeria monocytogenes serotype 4a (strain HCC23)
Q927I6 0 600 76 1 393 3 tuf Elongation factor Tu Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B9E8Q0 0 600 76 1 391 3 tuf Elongation factor Tu Macrococcus caseolyticus (strain JCSC5402)
A4YSJ0 0 600 75 1 395 3 tuf Elongation factor Tu Bradyrhizobium sp. (strain ORS 278)
A5ELM9 0 600 75 1 395 3 tuf Elongation factor Tu Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q5LMR5 0 600 75 2 395 3 tuf1 Elongation factor Tu Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A2BYN4 0 600 72 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9515)
Q6YQV8 0 600 71 0 394 3 tuf Elongation factor Tu Onion yellows phytoplasma (strain OY-M)
P18906 0 600 72 0 393 3 tuf Elongation factor Tu Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q72GW4 0 599 72 3 405 3 tuf1 Elongation factor Tu Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B8J1A0 0 599 78 2 395 3 tuf Elongation factor Tu Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q160Y4 0 598 76 2 394 3 tuf1 Elongation factor Tu Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q7UZY7 0 598 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q46IW4 0 598 72 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain NATL2A)
A3PEZ7 0 598 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9301)
Q01698 0 598 72 3 405 1 tuf Elongation factor Tu Thermus aquaticus
A2C4U5 0 598 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain NATL1A)
P60339 0 598 72 3 405 1 tufB Elongation factor Tu-B Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A2BT83 0 597 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain AS9601)
Q318N5 0 597 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9312)
A8G708 0 597 71 1 398 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9215)
A8LC58 0 597 77 2 396 3 tuf Elongation factor Tu Parafrankia sp. (strain EAN1pec)
Q2G8Y2 0 597 74 1 394 3 tuf Elongation factor Tu Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q039K9 0 597 72 1 392 3 tuf Elongation factor Tu Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WE38 0 597 72 1 392 3 tuf Elongation factor Tu Lacticaseibacillus casei (strain BL23)
P42480 0 597 72 1 394 3 tuf Elongation factor Tu Hymenobacter ocellatus
P60338 0 597 72 3 405 1 tufA Elongation factor Tu-A Thermus thermophilus
Q5SHN6 0 597 72 3 405 1 tufA Elongation factor Tu-A Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q39Y08 0 596 79 1 395 3 tuf1 Elongation factor Tu Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B9DKV8 0 596 75 1 393 3 tuf Elongation factor Tu Staphylococcus carnosus (strain TM300)
A8EW02 0 595 72 3 402 3 tuf Elongation factor Tu Aliarcobacter butzleri (strain RM4018)
P50068 0 595 71 0 391 3 tuf Elongation factor Tu Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJG3 0 595 71 0 391 3 tuf Elongation factor Tu Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q67JU1 0 595 76 1 393 3 tuf Elongation factor Tu Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q30TQ5 0 595 73 2 399 3 tuf Elongation factor Tu Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A9BHA7 0 594 71 3 398 3 tuf Elongation factor Tu Petrotoga mobilis (strain DSM 10674 / SJ95)
Q9XD38 0 594 74 4 400 3 tuf Elongation factor Tu Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NF9 0 594 74 4 400 3 tuf Elongation factor Tu Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q28UW7 0 594 75 2 395 3 tuf1 Elongation factor Tu Jannaschia sp. (strain CCS1)
Q82DQ0 0 594 74 2 395 3 tuf1 Elongation factor Tu 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A6X0A2 0 594 75 2 395 3 tuf1 Elongation factor Tu Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q53871 0 594 74 2 395 3 tuf1 Elongation factor Tu-1 Streptomyces collinus
Q2N9A8 0 593 76 1 394 3 tuf Elongation factor Tu Erythrobacter litoralis (strain HTCC2594)
P40174 0 593 74 2 395 3 tuf1 Elongation factor Tu-1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B0SSH9 0 593 72 3 400 3 tuf Elongation factor Tu Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SAF6 0 593 72 3 400 3 tuf Elongation factor Tu Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q2NJ20 0 593 71 0 394 3 tuf Elongation factor Tu Aster yellows witches'-broom phytoplasma (strain AYWB)
B5ZC31 0 592 71 0 391 3 tuf Elongation factor Tu Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q3AW53 0 592 73 1 398 3 tuf Elongation factor Tu Synechococcus sp. (strain CC9902)
Q49V58 0 592 75 1 390 3 tuf Elongation factor Tu Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q05FI3 0 592 71 1 397 3 tuf Elongation factor Tu Carsonella ruddii (strain PV)
A6U842 0 592 75 2 395 3 tuf1 Elongation factor Tu Sinorhizobium medicae (strain WSM419)
Q925Y6 0 592 75 2 395 3 tufA Elongation factor Tu Rhizobium meliloti (strain 1021)
P64025 0 592 75 2 395 3 tufA Elongation factor Tu Brucella suis biovar 1 (strain 1330)
A5VR08 0 592 75 2 395 3 tuf1 Elongation factor Tu Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P64024 0 592 75 2 395 3 tufA Elongation factor Tu Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13790
Feature type CDS
Gene tuf
Product elongation factor Tu
Location 3065932 - 3067116 (strand: -1)
Length 1185 (nucleotides) / 394 (amino acids)
In genomic island GI62

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_154
Orthogroup size 10
N. genomes 7

Actions

Genomic region

Domains

PF00009 Elongation factor Tu GTP binding domain
PF03143 Elongation factor Tu C-terminal domain
PF03144 Elongation factor Tu domain 2

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0050 Translation, ribosomal structure and biogenesis (J) J Translation elongation factor EF-Tu, a GTPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02358 elongation factor Tu Plant-pathogen interaction -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG046459 elongation factor Tu VF0460 Adherence

Protein Sequence

MSKEKFERSKPHVNVGTIGHVDHGKTTLTAAITTVLAKTYGGAARAFDQIDNAPEEKARGITISTSHVEYDTPTRHYAHVDCPGHADYVKNMITGAAQMDGAILVVAATDGPMPQTREHILLGRQVGVPYIIVFLNKCDMVDDEELLELVEMEVRELLSQYDFPGDDTPVIRGSALKALEGEAEWEAKIVELAEALDSYIPEPERAIDKPFLLPIEDVFSISGRGTVVTGRVERGIIKVGDEVEIVGIKETTKTTCTGVEMFRKLLDEGRAGENVGVLLRGTKREEIERGQVLAKPGSINPHNKFESEVYILSKDEGGRHTPFFKGYRPQFYFRTTDVTGTIELPEGVEMVMPGDNVNMIVELIHPIAMDEGLRFAIREGGRTVGAGVVAKVLG

Flanking regions ( +/- flanking 50bp)

TTTAGTTTACGCTCCCTCTGTGAGAGGGAGCGATATTAAGGAATATAGTCGTGTCTAAAGAAAAATTTGAACGTTCAAAACCGCACGTTAACGTTGGTACTATCGGCCACGTTGACCACGGTAAAACAACTCTGACTGCTGCAATCACTACAGTTTTAGCTAAAACTTACGGTGGTGCTGCTCGTGCATTCGACCAAATCGATAATGCGCCAGAAGAAAAAGCGCGTGGTATCACCATCTCTACTTCACACGTAGAATACGATACTCCAACTCGCCACTACGCACACGTAGACTGCCCAGGTCACGCCGACTATGTTAAAAACATGATCACTGGTGCTGCGCAAATGGACGGAGCTATTCTGGTAGTAGCAGCAACTGATGGTCCAATGCCACAAACTCGTGAGCACATCCTGTTAGGTCGTCAGGTTGGTGTTCCTTACATCATCGTATTCCTGAACAAATGTGACATGGTAGATGATGAAGAGCTGTTAGAATTAGTTGAAATGGAAGTTCGTGAACTTCTGTCTCAATACGATTTCCCAGGTGATGACACTCCAGTAATCCGTGGTTCAGCGCTGAAAGCACTGGAAGGCGAAGCAGAGTGGGAAGCAAAAATTGTTGAATTAGCAGAAGCACTGGATTCTTATATCCCAGAGCCAGAGCGTGCAATTGACAAACCATTCCTGTTACCAATCGAAGATGTATTCTCAATCTCAGGCCGTGGTACAGTAGTTACTGGTCGTGTAGAGCGTGGTATCATCAAAGTAGGTGATGAAGTTGAGATTGTTGGTATCAAAGAAACCACCAAAACAACTTGTACTGGCGTTGAAATGTTCCGTAAATTACTTGACGAAGGTCGTGCAGGTGAGAACGTAGGTGTTCTGCTGCGTGGTACAAAACGTGAAGAAATCGAACGTGGACAAGTACTGGCGAAACCAGGTTCAATCAACCCACACAACAAATTTGAATCAGAAGTTTATATTCTGAGCAAAGATGAAGGTGGTCGTCACACTCCATTCTTCAAAGGCTACCGTCCACAGTTCTACTTCCGTACAACTGACGTAACTGGTACTATCGAATTACCAGAAGGCGTAGAAATGGTAATGCCAGGCGACAACGTGAACATGATCGTTGAACTGATCCACCCAATCGCAATGGACGAAGGTTTACGCTTCGCAATCCGTGAAGGTGGCCGTACAGTAGGTGCGGGTGTTGTTGCTAAAGTATTAGGTTAATTACTCGGTAATTTTCCTAAAGAAGGGCATCAATTGATGCCCTTTTTATG