Homologs in group_154

Help

9 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_19980 EHELCC_19980 100.0 Morganella morganii S2 - hypothetical protein
NLDBIP_19970 NLDBIP_19970 100.0 Morganella morganii S4 - hypothetical protein
LHKJJB_19935 LHKJJB_19935 100.0 Morganella morganii S3 - hypothetical protein
HKOGLL_19750 HKOGLL_19750 100.0 Morganella morganii S5 - hypothetical protein
F4V73_RS14925 F4V73_RS14925 94.7 Morganella psychrotolerans tuf elongation factor Tu
F4V73_RS18900 F4V73_RS18900 94.7 Morganella psychrotolerans tuf elongation factor Tu
PMI_RS11060 PMI_RS11060 26.4 Proteus mirabilis HI4320 cysN sulfate adenylyltransferase subunit CysN
PMI_RS13790 PMI_RS13790 93.4 Proteus mirabilis HI4320 tuf elongation factor Tu
PMI_RS16130 PMI_RS16130 93.0 Proteus mirabilis HI4320 tuf elongation factor Tu

Distribution of the homologs in the orthogroup group_154

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_154

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A7MKI5 1.42e-165 466 95 0 240 3 tuf1 Elongation factor Tu Cronobacter sakazakii (strain ATCC BAA-894)
P0A1H5 4.2e-165 464 95 0 240 3 tufA Elongation factor Tu Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1H6 4.2e-165 464 95 0 240 3 tufA Elongation factor Tu Salmonella typhi
A9MT05 4.2e-165 464 95 0 240 3 tuf1 Elongation factor Tu Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PIW4 4.2e-165 464 95 0 240 3 tuf1 Elongation factor Tu Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57H76 4.2e-165 464 95 0 240 3 tuf1 Elongation factor Tu Salmonella choleraesuis (strain SC-B67)
A9MHG0 4.2e-165 464 95 0 240 3 tuf1 Elongation factor Tu Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q83JC4 6.03e-165 464 95 0 240 3 tufA Elongation factor Tu Shigella flexneri
Q32B27 6.03e-165 464 95 0 240 3 tuf1 Elongation factor Tu Shigella dysenteriae serotype 1 (strain Sd197)
Q31VV0 6.03e-165 464 95 0 240 3 tuf1 Elongation factor Tu Shigella boydii serotype 4 (strain Sb227)
Q3YWT3 6.03e-165 464 95 0 240 3 tuf1 Elongation factor Tu 1 Shigella sonnei (strain Ss046)
Q1R5Y2 6.03e-165 464 95 0 240 1 tuf1 Elongation factor Tu 1 Escherichia coli (strain UTI89 / UPEC)
P0CE47 6.03e-165 464 95 0 240 1 tufA Elongation factor Tu 1 Escherichia coli (strain K12)
B1IPW0 6.03e-165 464 95 0 240 3 tuf1 Elongation factor Tu 1 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TCC0 6.03e-165 464 95 0 240 3 tuf1 Elongation factor Tu 1 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGM6 6.03e-165 464 95 0 240 3 tuf1 Elongation factor Tu 1 Escherichia coli O1:K1 / APEC
A8A5E6 6.03e-165 464 95 0 240 3 tuf1 Elongation factor Tu 1 Escherichia coli O9:H4 (strain HS)
A7ZSL4 6.03e-165 464 95 0 240 3 tuf1 Elongation factor Tu 1 Escherichia coli O139:H28 (strain E24377A / ETEC)
A4W5A0 7.26e-165 464 95 0 239 3 tuf1 Elongation factor Tu Enterobacter sp. (strain 638)
Q6CZW6 8.28e-165 464 94 0 240 3 tuf1 Elongation factor Tu Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0SZX8 9.75e-165 463 95 0 240 3 tuf1 Elongation factor Tu 1 Shigella flexneri serotype 5b (strain 8401)
A7ZUJ2 2.53e-164 462 95 0 239 3 tuf2 Elongation factor Tu 2 Escherichia coli O139:H28 (strain E24377A / ETEC)
P0A6N2 2.82e-164 462 95 0 239 3 tufA Elongation factor Tu Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A6N3 2.82e-164 462 95 0 239 3 tufA Elongation factor Tu Escherichia coli O157:H7
Q3YV04 2.82e-164 462 95 0 239 3 tuf2 Elongation factor Tu 2 Shigella sonnei (strain Ss046)
Q0SY20 2.82e-164 462 95 0 239 3 tuf2 Elongation factor Tu 2 Shigella flexneri serotype 5b (strain 8401)
Q1R5U4 2.82e-164 462 95 0 239 3 tuf2 Elongation factor Tu 2 Escherichia coli (strain UTI89 / UPEC)
P0CE48 2.82e-164 462 95 0 239 1 tufB Elongation factor Tu 2 Escherichia coli (strain K12)
B1IVA7 2.82e-164 462 95 0 239 3 tuf2 Elongation factor Tu 2 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TA85 2.82e-164 462 95 0 239 3 tuf2 Elongation factor Tu 2 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AIF3 2.82e-164 462 95 0 239 3 tuf2 Elongation factor Tu 2 Escherichia coli O1:K1 / APEC
A8A779 2.82e-164 462 95 0 239 3 tuf2 Elongation factor Tu 2 Escherichia coli O9:H4 (strain HS)
A6TEX7 1.16e-163 461 94 0 240 3 tufA Elongation factor Tu Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q664R7 4.45e-163 459 94 0 240 3 tuf2 Elongation factor Tu 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CCT9 4.45e-163 459 94 0 240 3 tuf2 Elongation factor Tu 2 Yersinia pestis bv. Antiqua (strain Nepal516)
A7FNN8 4.45e-163 459 94 0 240 3 tuf2 Elongation factor Tu 2 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TGY7 4.45e-163 459 94 0 240 3 tuf1 Elongation factor Tu 1 Yersinia pestis (strain Pestoides F)
Q8ZJB2 4.45e-163 459 94 0 240 3 tufA Elongation factor Tu-A Yersinia pestis
Q1C2U1 4.45e-163 459 94 0 240 3 tuf1 Elongation factor Tu 1 Yersinia pestis bv. Antiqua (strain Antiqua)
A1JIH3 7.05e-163 459 94 0 239 3 tuf1 Elongation factor Tu 1 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GKK1 3.72e-162 457 92 0 240 3 tuf2 Elongation factor Tu 2 Serratia proteamaculans (strain 568)
A8G8E0 1.99e-161 455 92 0 240 3 tuf1 Elongation factor Tu 1 Serratia proteamaculans (strain 568)
Q2NQL7 1.5e-159 450 92 0 240 3 tuf1 Elongation factor Tu Sodalis glossinidius (strain morsitans)
Q7MYE8 1.63e-159 450 92 0 240 3 tuf2 Elongation factor Tu 2 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N9B1 1.82e-159 450 92 0 240 3 tuf1 Elongation factor Tu 1 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JS52 2.08e-159 450 91 0 240 3 tuf2 Elongation factor Tu 2 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A4TS36 4.01e-159 449 91 0 239 3 tuf2 Elongation factor Tu 2 Yersinia pestis (strain Pestoides F)
Q8ZAN8 4.01e-159 449 91 0 239 3 tufB Elongation factor Tu-B Yersinia pestis
Q1C1T4 4.01e-159 449 91 0 239 3 tuf2 Elongation factor Tu 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q66FQ9 4.01e-159 449 91 0 239 3 tuf1 Elongation factor Tu 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FNJ0 4.01e-159 449 91 0 239 3 tuf1 Elongation factor Tu 1 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q1CN86 2.97e-158 447 91 0 239 3 tuf1 Elongation factor Tu 1 Yersinia pestis bv. Antiqua (strain Nepal516)
A0KQ95 3.14e-156 442 89 0 240 3 tuf1 Elongation factor Tu Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
C4K4F8 2.93e-155 439 88 0 242 3 tuf Elongation factor Tu Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q7TTF9 3.81e-155 439 90 0 239 3 tufA Elongation factor Tu Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A0KRL0 9.77e-155 438 87 0 243 3 tuf1 Elongation factor Tu Shewanella sp. (strain ANA-3)
Q4QMW6 1.02e-154 438 89 0 239 3 tuf1 Elongation factor Tu 1 Haemophilus influenzae (strain 86-028NP)
B0BQZ3 1.4e-154 437 89 0 239 3 tuf1 Elongation factor Tu Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N246 1.4e-154 437 89 0 239 3 tuf1 Elongation factor Tu Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A3Q968 2.37e-154 437 88 0 240 3 tuf1 Elongation factor Tu 1 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q0I0B9 3.75e-154 437 87 0 243 3 tuf1 Elongation factor Tu 1 Shewanella sp. (strain MR-7)
Q0HNV1 3.75e-154 437 87 0 243 3 tuf1 Elongation factor Tu 1 Shewanella sp. (strain MR-4)
P43926 4.09e-154 436 89 0 239 3 tufA Elongation factor Tu Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UHC1 4.09e-154 436 89 0 239 3 tuf Elongation factor Tu Haemophilus influenzae (strain PittGG)
A5U9R1 4.09e-154 436 89 0 239 3 tuf1 Elongation factor Tu Haemophilus influenzae (strain PittEE)
Q4QMT5 4.09e-154 436 89 0 239 3 tuf2 Elongation factor Tu 2 Haemophilus influenzae (strain 86-028NP)
Q65QG6 4.93e-154 436 88 0 239 3 tuf1 Elongation factor Tu Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q12SW1 6.63e-154 436 87 0 240 3 tuf Elongation factor Tu Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A3Q980 1.68e-153 435 88 0 240 3 tuf2 Elongation factor Tu 2 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
P33169 2.07e-153 435 87 0 240 3 tuf Elongation factor Tu Shewanella putrefaciens
A4YBY5 2.07e-153 435 87 0 240 3 tuf1 Elongation factor Tu Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6VKH7 2.38e-153 434 88 0 239 3 tuf1 Elongation factor Tu Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A1S204 2.57e-153 434 88 0 238 3 tuf1 Elongation factor Tu Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A4SHU2 2.81e-153 434 87 0 240 3 tuf1 Elongation factor Tu Aeromonas salmonicida (strain A449)
B0UV21 2.97e-153 434 88 0 239 3 tuf Elongation factor Tu Histophilus somni (strain 2336)
Q0I1U9 2.97e-153 434 88 0 239 3 tuf1 Elongation factor Tu Histophilus somni (strain 129Pt)
P57939 1.02e-152 433 88 0 239 3 tufA Elongation factor Tu-A Pasteurella multocida (strain Pm70)
P57966 2.89e-152 432 88 0 239 3 tufB Elongation factor Tu-B Pasteurella multocida (strain Pm70)
Q089R8 7.82e-152 431 86 0 240 3 tuf1 Elongation factor Tu 1 Shewanella frigidimarina (strain NCIMB 400)
Q089Q6 1.05e-151 430 86 0 240 3 tuf2 Elongation factor Tu 2 Shewanella frigidimarina (strain NCIMB 400)
P59506 2.16e-151 429 83 0 239 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A8G1F0 1.17e-150 428 86 0 240 3 tuf Elongation factor Tu Shewanella sediminis (strain HAW-EB3)
Q7VRP0 1.93e-150 427 84 0 239 3 tuf Elongation factor Tu Blochmanniella floridana
Q1LSY4 4.33e-150 426 85 0 242 3 tuf Elongation factor Tu Baumannia cicadellinicola subsp. Homalodisca coagulata
Q0HNT9 1.64e-149 425 87 0 243 3 tuf2 Elongation factor Tu 2 Shewanella sp. (strain MR-4)
Q9KV37 1.88e-149 425 85 0 240 3 tufA Elongation factor Tu-A Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8EK70 2.33e-149 424 87 0 243 3 tuf2 Elongation factor Tu 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A5F3K0 2.39e-149 424 85 0 240 3 tuf1 Elongation factor Tu Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KUZ6 2.39e-149 424 85 0 240 3 tufB Elongation factor Tu-B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q492B2 3.42e-149 424 83 0 239 3 tuf Elongation factor Tu Blochmanniella pennsylvanica (strain BPEN)
Q0I0A7 4.5e-149 424 87 0 243 3 tuf2 Elongation factor Tu 2 Shewanella sp. (strain MR-7)
A8GYW2 1.1e-148 423 85 0 240 3 tuf1 Elongation factor Tu Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
O31298 2.22e-148 422 89 0 239 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B8D851 2.32e-148 422 88 0 239 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
O31297 2.32e-148 422 88 0 239 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9U9 2.32e-148 422 88 0 239 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q8EK81 2.32e-148 422 87 0 243 3 tuf1 Elongation factor Tu 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0TM14 3.97e-148 421 84 0 240 3 tuf1 Elongation factor Tu Shewanella halifaxensis (strain HAW-EB4)
A9KW88 7.01e-148 421 87 0 240 3 tuf1 Elongation factor Tu 1 Shewanella baltica (strain OS195)
A6WHR4 7.65e-148 421 87 0 240 3 tuf1 Elongation factor Tu Shewanella baltica (strain OS185)
A9KWA0 7.65e-148 421 87 0 240 3 tuf2 Elongation factor Tu 2 Shewanella baltica (strain OS195)
A3DBA0 7.65e-148 421 87 0 240 3 tuf2 Elongation factor Tu 2 Shewanella baltica (strain OS155 / ATCC BAA-1091)
A3DA74 7.65e-148 421 87 0 240 3 tuf1 Elongation factor Tu 1 Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q47UU9 1.76e-147 420 81 0 243 3 tuf1 Elongation factor Tu Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B4RYQ8 2.07e-147 419 84 0 239 3 tuf Elongation factor Tu Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q3ILP4 3.5e-147 419 82 0 240 3 tuf1 Elongation factor Tu 1 Pseudoalteromonas translucida (strain TAC 125)
Q057A2 4.17e-147 419 84 0 240 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Cinara cedri (strain Cc)
A1T056 5.66e-147 418 82 0 239 3 tuf Elongation factor Tu Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q15NP2 1.5e-146 417 83 0 240 3 tuf1 Elongation factor Tu Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q3IJV1 1.55e-146 417 82 0 240 3 tuf2 Elongation factor Tu 2 Pseudoalteromonas translucida (strain TAC 125)
Q5QWA3 9e-146 415 82 0 239 3 tuf1 Elongation factor Tu Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
O31300 1.15e-144 411 85 0 230 3 tuf Elongation factor Tu (Fragment) Buchnera aphidicola subsp. Melaphis rhois
Q8D240 1.51e-144 412 80 0 239 3 tuf Elongation factor Tu Wigglesworthia glossinidia brevipalpis
O31301 1.67e-144 411 86 0 230 3 tuf Elongation factor Tu (Fragment) Buchnera aphidicola subsp. Schlechtendalia chinensis
Q3SLQ1 6.49e-144 410 81 1 243 3 tuf1 Elongation factor Tu Thiobacillus denitrificans (strain ATCC 25259)
A4VHM8 1.98e-143 409 82 1 245 3 tuf2 Elongation factor Tu 2 Stutzerimonas stutzeri (strain A1501)
P09591 8.39e-143 408 82 1 245 1 tufA Elongation factor Tu Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02T82 8.39e-143 408 82 1 245 1 tuf1 Elongation factor Tu Pseudomonas aeruginosa (strain UCBPP-PA14)
A6UZH4 8.39e-143 408 82 1 245 3 tuf1 Elongation factor Tu Pseudomonas aeruginosa (strain PA7)
Q7MH43 1.51e-142 407 85 0 240 3 tuf1 Elongation factor Tu 1 Vibrio vulnificus (strain YJ016)
A1TYJ5 1.71e-142 407 82 1 242 3 tuf Elongation factor Tu Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A4XZ92 1.84e-142 407 81 1 245 3 tuf Elongation factor Tu Pseudomonas mendocina (strain ymp)
A4VHL6 2.13e-142 407 82 1 245 3 tuf1 Elongation factor Tu 1 Stutzerimonas stutzeri (strain A1501)
Q8DCQ7 5.03e-142 406 84 0 240 3 tuf2 Elongation factor Tu 2 Vibrio vulnificus (strain CMCP6)
Q21M86 5.04e-142 406 80 1 246 3 tuf1 Elongation factor Tu Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q7MGR1 6.19e-142 405 84 0 239 3 tuf2 Elongation factor Tu 2 Vibrio vulnificus (strain YJ016)
Q8DD27 6.19e-142 405 84 0 239 3 tuf1 Elongation factor Tu 1 Vibrio vulnificus (strain CMCP6)
A5EX84 1.44e-141 405 81 1 244 3 tuf Elongation factor Tu Dichelobacter nodosus (strain VCS1703A)
A7MXE4 4.01e-141 404 84 0 239 3 tuf1 Elongation factor Tu Vibrio campbellii (strain ATCC BAA-1116)
A3M1F6 4.63e-141 404 82 1 240 3 tuf1 Elongation factor Tu Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B7H1K5 4.63e-141 404 82 1 240 3 tuf Elongation factor Tu Acinetobacter baumannii (strain AB307-0294)
Q877T5 5.75e-141 403 84 0 239 3 tufA Elongation factor Tu Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q81ZS3 8.01e-141 403 81 1 244 3 tuf1 Elongation factor Tu Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q2S8Z8 1.46e-140 402 82 1 242 3 tuf1 Elongation factor Tu Hahella chejuensis (strain KCTC 2396)
Q6LLV5 1.89e-140 402 84 0 239 3 tuf2 Elongation factor Tu 2 Photobacterium profundum (strain SS9)
Q5ZYP5 2.14e-140 402 82 2 244 3 tuf1 Elongation factor Tu Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IHR6 2.14e-140 402 82 2 244 3 tuf1 Elongation factor Tu Legionella pneumophila (strain Corby)
Q5X873 2.14e-140 402 82 2 244 3 tuf1 Elongation factor Tu Legionella pneumophila (strain Paris)
Q4K519 2.58e-140 402 80 1 245 3 tuf1 Elongation factor Tu Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0AF46 2.66e-140 402 80 1 244 3 tuf2 Elongation factor Tu 2 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
C5BQ44 2.72e-140 402 81 1 245 3 tuf Elongation factor Tu Teredinibacter turnerae (strain ATCC 39867 / T7901)
A1KRF9 3.03e-140 401 79 0 243 3 tuf1 Elongation factor Tu Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P64027 3.03e-140 401 79 0 243 1 tufA Elongation factor Tu Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P64026 3.03e-140 401 79 0 243 3 tufA Elongation factor Tu Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5WZL4 3.91e-140 401 81 2 244 3 tuf1 Elongation factor Tu Legionella pneumophila (strain Lens)
Q0AIJ7 1.29e-139 400 80 1 244 3 tuf1 Elongation factor Tu 1 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q6LVC0 1.71e-139 399 83 0 240 3 tuf1 Elongation factor Tu 1 Photobacterium profundum (strain SS9)
Q5F5Q8 3.43e-139 399 78 0 243 3 tuf1 Elongation factor Tu Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q7M7F1 3.52e-139 399 80 1 245 3 tuf1 Elongation factor Tu Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0VSL7 3.71e-139 399 82 1 240 3 tuf1 Elongation factor Tu Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A6W394 1.35e-138 397 79 1 245 3 tuf Elongation factor Tu Marinomonas sp. (strain MWYL1)
Q1R0H7 2.9e-138 396 80 1 242 3 tuf Elongation factor Tu Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q889X3 2.97e-138 396 78 1 246 3 tuf Elongation factor Tu Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q605B0 3.65e-138 396 78 2 248 3 tuf1 Elongation factor Tu Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5P334 5.17e-138 396 80 1 241 3 tuf1 Elongation factor Tu Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q4FQG6 7.18e-138 395 79 1 243 3 tuf1 Elongation factor Tu Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q6FF97 7.84e-138 395 81 1 240 3 tuf1 Elongation factor Tu Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A5WH42 8.01e-138 395 80 1 240 3 tuf2 Elongation factor Tu 2 Psychrobacter sp. (strain PRwf-1)
B0TX03 8.17e-138 395 78 0 239 3 tuf Elongation factor Tu Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q0ABH7 9.54e-138 395 78 1 241 3 tuf1 Elongation factor Tu Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1Q8P2 9.64e-138 395 78 1 245 3 tuf1 Elongation factor Tu Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q2YAZ9 9.86e-138 395 77 1 244 3 tuf1 Elongation factor Tu Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
C3K2X8 1.3e-137 395 79 1 245 3 tuf Elongation factor Tu Pseudomonas fluorescens (strain SBW25)
A5WGK9 1.9e-137 394 80 1 240 3 tuf1 Elongation factor Tu 1 Psychrobacter sp. (strain PRwf-1)
Q47JA5 2.01e-137 394 80 1 237 3 tuf1 Elongation factor Tu Dechloromonas aromatica (strain RCB)
A1KB29 4.04e-137 394 80 1 241 3 tuf1 Elongation factor Tu Azoarcus sp. (strain BH72)
Q3BWY6 4.65e-137 393 76 1 244 3 tuf1 Elongation factor Tu Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8NL22 4.65e-137 393 76 1 244 3 tufA Elongation factor Tu Xanthomonas axonopodis pv. citri (strain 306)
Q83ES6 5.14e-137 393 77 2 245 1 tufA Elongation factor Tu Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NAK7 5.14e-137 393 77 2 245 3 tuf1 Elongation factor Tu Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KD33 5.14e-137 393 77 2 245 3 tuf1 Elongation factor Tu Coxiella burnetii (strain Dugway 5J108-111)
Q2W2H3 6.05e-137 393 79 2 244 3 tuf1 Elongation factor Tu Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q3J8Q0 6.67e-137 393 79 1 244 3 tuf1 Elongation factor Tu Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
P48864 1.27e-136 392 78 0 243 3 tuf Elongation factor Tu Neisseria gonorrhoeae
B0RU96 1.36e-136 392 76 1 244 3 tuf2 Elongation factor Tu 2 Xanthomonas campestris pv. campestris (strain B100)
Q4URC5 1.36e-136 392 76 1 244 3 tuf2 Elongation factor Tu 2 Xanthomonas campestris pv. campestris (strain 8004)
Q8PC59 1.36e-136 392 76 1 244 3 tufA Elongation factor Tu-A Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PC51 1.64e-136 392 76 1 244 3 tufB Elongation factor Tu-B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4URD7 1.64e-136 392 76 1 244 3 tuf1 Elongation factor Tu 1 Xanthomonas campestris pv. campestris (strain 8004)
Q4ZMP2 2.95e-136 391 77 1 246 3 tuf Elongation factor Tu Pseudomonas syringae pv. syringae (strain B728a)
B0RU84 4.19e-136 391 75 1 244 3 tuf1 Elongation factor Tu 1 Xanthomonas campestris pv. campestris (strain B100)
P33167 4.42e-136 391 78 1 244 3 tuf Elongation factor Tu Burkholderia cepacia
Q2L2G6 4.57e-136 391 77 1 244 3 tuf1 Elongation factor Tu Bordetella avium (strain 197N)
Q1BRT3 4.77e-136 391 78 1 244 3 tuf1 Elongation factor Tu Burkholderia orbicola (strain AU 1054)
Q39KI2 4.77e-136 391 78 1 244 3 tuf1 Elongation factor Tu Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BJ48 4.77e-136 391 78 1 244 3 tuf1 Elongation factor Tu Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0K3L0 4.77e-136 391 78 1 244 3 tuf1 Elongation factor Tu Burkholderia cenocepacia (strain HI2424)
Q1H4Q1 5.75e-136 390 78 1 244 3 tuf1 Elongation factor Tu 1 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1H4N9 6.48e-136 390 78 1 244 3 tuf2 Elongation factor Tu 2 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q48D34 6.7e-136 390 77 1 246 3 tuf Elongation factor Tu Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A4JAM5 6.84e-136 390 78 1 244 3 tuf1 Elongation factor Tu Burkholderia vietnamiensis (strain G4 / LMG 22486)
A4IW92 8.5e-136 390 76 0 239 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain WY96-3418)
Q0BKB8 8.5e-136 390 76 0 239 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain OSU18)
A0Q874 8.5e-136 390 76 0 239 3 tuf Elongation factor Tu Francisella tularensis subsp. novicida (strain U112)
B2SFC9 8.5e-136 390 76 0 239 3 tuf Elongation factor Tu Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A1M0 8.5e-136 390 76 0 239 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain LVS)
A7NEC7 8.5e-136 390 76 0 239 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A4SUU7 9.09e-136 390 77 1 245 3 tuf1 Elongation factor Tu Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q21RV6 1.36e-135 390 77 1 245 3 tuf2 Elongation factor Tu 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q5NID9 1.47e-135 389 76 0 239 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JU2 1.47e-135 389 76 0 239 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain FSC 198)
P42481 1.73e-135 389 77 1 244 3 tuf Elongation factor Tu Thiomonas delicata
Q13TF5 1.79e-135 389 77 1 244 3 tuf1 Elongation factor Tu Paraburkholderia xenovorans (strain LB400)
A6T3K6 1.98e-135 389 77 1 244 3 tuf1 Elongation factor Tu Janthinobacterium sp. (strain Marseille)
Q21SF0 2.49e-135 389 76 1 245 3 tuf1 Elongation factor Tu 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A1VIP8 2.71e-135 389 76 1 245 3 tuf1 Elongation factor Tu Polaromonas naphthalenivorans (strain CJ2)
Q7TT91 3.49e-135 389 77 1 244 3 tuf1 Elongation factor Tu Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q79GC6 3.49e-135 389 77 1 244 3 tuf1 Elongation factor Tu Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q79G84 3.49e-135 389 77 1 244 3 tuf1 Elongation factor Tu Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A8EZL8 3.68e-135 389 78 0 241 3 tuf Elongation factor Tu Rickettsia canadensis (strain McKiel)
A8GT71 3.76e-135 389 78 0 241 3 tuf Elongation factor Tu Rickettsia rickettsii (strain Sheila Smith)
B0BUR2 3.76e-135 389 78 0 241 3 tuf Elongation factor Tu Rickettsia rickettsii (strain Iowa)
C4K2I2 3.76e-135 389 78 0 241 3 tuf Elongation factor Tu Rickettsia peacockii (strain Rustic)
C3PPA9 3.76e-135 389 78 0 241 3 tuf Elongation factor Tu Rickettsia africae (strain ESF-5)
Q8R603 4.43e-135 388 75 0 238 3 tuf Elongation factor Tu Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8XGZ0 5.11e-135 388 77 1 244 3 tufA Elongation factor Tu Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q2SU25 5.64e-135 388 77 1 244 3 tuf1 Elongation factor Tu Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PZ6 5.64e-135 388 77 1 244 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain K96243)
A3NEI1 5.64e-135 388 77 1 244 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 668)
Q3JMP6 5.64e-135 388 77 1 244 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 1710b)
A3P0B5 5.64e-135 388 77 1 244 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 1106a)
A1V8A5 5.64e-135 388 77 1 244 3 tuf1 Elongation factor Tu Burkholderia mallei (strain SAVP1)
Q62GK3 5.64e-135 388 77 1 244 3 tuf1 Elongation factor Tu Burkholderia mallei (strain ATCC 23344)
A2S7F9 5.64e-135 388 77 1 244 3 tuf1 Elongation factor Tu Burkholderia mallei (strain NCTC 10229)
A3MRT8 5.64e-135 388 77 1 244 3 tuf1 Elongation factor Tu Burkholderia mallei (strain NCTC 10247)
Q07KJ2 9.32e-135 387 76 2 244 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain BisA53)
Q8KTA1 1.04e-134 387 77 0 241 3 tuf Elongation factor Tu Rickettsia montanensis
Q8KTA6 1.12e-134 387 77 0 241 3 tuf Elongation factor Tu Rickettsia parkeri
A8F2E9 1.28e-134 387 77 0 241 3 tuf Elongation factor Tu Rickettsia massiliae (strain Mtu5)
Q5GWR8 2.47e-134 386 75 1 244 3 tuf1 Elongation factor Tu Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NZX1 2.47e-134 386 75 1 244 3 tuf1 Elongation factor Tu Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q0K5Z9 3e-134 386 77 1 244 3 tuf1 Elongation factor Tu Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q92GW4 4.3e-134 386 77 0 241 3 tuf Elongation factor Tu Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q123F6 4.35e-134 386 75 1 245 3 tuf1 Elongation factor Tu Polaromonas sp. (strain JS666 / ATCC BAA-500)
P0A3B0 4.74e-134 385 77 0 241 3 tuf Elongation factor Tu Rickettsia sibirica
P0A3A9 4.74e-134 385 77 0 241 3 tuf Elongation factor Tu Rickettsia rickettsii
Q1LI13 5.18e-134 385 76 1 244 3 tuf1 Elongation factor Tu Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A1AVJ8 5.97e-134 385 78 1 241 3 tuf1 Elongation factor Tu 1 Ruthia magnifica subsp. Calyptogena magnifica
Q8KT99 6.73e-134 385 77 0 241 3 tuf Elongation factor Tu Rickettsia helvetica
A1TJ05 8.85e-134 385 77 1 242 3 tuf1 Elongation factor Tu Paracidovorax citrulli (strain AAC00-1)
Q134S7 9.05e-134 385 76 1 244 3 tuf1 Elongation factor Tu 1 Rhodopseudomonas palustris (strain BisB5)
Q134R0 9.25e-134 385 76 1 244 3 tuf2 Elongation factor Tu 2 Rhodopseudomonas palustris (strain BisB5)
Q2IXR2 9.45e-134 385 75 1 244 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain HaA2)
P48865 1.34e-133 384 76 0 241 3 tuf Elongation factor Tu Rickettsia prowazekii (strain Madrid E)
Q46WC7 1.5e-133 384 76 1 244 3 tuf1 Elongation factor Tu Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1WHC3 3.28e-133 384 76 1 242 3 tuf1 Elongation factor Tu Verminephrobacter eiseniae (strain EF01-2)
Q8KT97 4.26e-133 383 77 0 241 3 tuf Elongation factor Tu Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q3K5X4 7.71e-133 383 79 1 245 3 tuf1 Elongation factor Tu Pseudomonas fluorescens (strain Pf0-1)
Q8KT95 9.36e-133 382 76 0 241 3 tuf Elongation factor Tu Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A0LRL8 1.48e-132 382 75 1 243 3 tuf Elongation factor Tu Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A1ALS6 2.4e-132 381 78 1 237 3 tuf1 Elongation factor Tu Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q6N4Q4 2.77e-132 381 75 1 244 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A1WVD6 2.8e-132 381 75 1 244 3 tuf2 Elongation factor Tu 2 Halorhodospira halophila (strain DSM 244 / SL1)
A1AX82 2.89e-132 381 77 1 241 3 tuf2 Elongation factor Tu 2 Ruthia magnifica subsp. Calyptogena magnifica
C6C171 3.19e-132 381 77 2 242 3 tuf Elongation factor Tu Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A7HWP7 4.1e-132 381 75 1 244 3 tuf1 Elongation factor Tu Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A1WVC4 4.28e-132 381 75 1 244 3 tuf1 Elongation factor Tu 1 Halorhodospira halophila (strain DSM 244 / SL1)
Q6AP73 4.57e-132 380 75 2 245 3 tuf2 Elongation factor Tu 2 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A1WCN6 1.18e-131 380 76 1 242 3 tuf2 Elongation factor Tu 2 Acidovorax sp. (strain JS42)
A1W2Q5 1.29e-131 379 76 1 242 3 tuf1 Elongation factor Tu 1 Acidovorax sp. (strain JS42)
A5V604 1.85e-131 379 75 1 243 3 tuf Elongation factor Tu Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q211E6 2.57e-131 379 75 2 244 3 tuf Elongation factor Tu Rhodopseudomonas palustris (strain BisB18)
Q9P9Q9 2.71e-131 379 75 1 245 1 tufA Elongation factor Tu Xylella fastidiosa (strain 9a5c)
Q6AP86 4.02e-131 378 74 2 246 3 tuf1 Elongation factor Tu 1 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B1JDW6 8.83e-131 377 78 1 245 3 tuf1 Elongation factor Tu Pseudomonas putida (strain W619)
B0KK53 8.83e-131 377 78 1 245 3 tuf1 Elongation factor Tu Pseudomonas putida (strain GB-1)
A5VXN3 8.83e-131 377 78 1 245 3 tuf Elongation factor Tu Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88QP8 8.83e-131 377 78 1 245 1 tufA Elongation factor Tu-A Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q01SX2 1.06e-130 377 73 0 242 3 tuf1 Elongation factor Tu Solibacter usitatus (strain Ellin6076)
B1HMZ0 1.68e-130 377 74 1 242 3 tuf Elongation factor Tu Lysinibacillus sphaericus (strain C3-41)
A5CW32 1.7e-130 377 75 1 241 3 tuf1 Elongation factor Tu Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A2SLF9 1.78e-130 377 74 1 244 3 tuf1 Elongation factor Tu Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q1IFW8 1.86e-130 377 77 1 245 3 tuf1 Elongation factor Tu Pseudomonas entomophila (strain L48)
Q88QN7 1.86e-130 377 77 1 245 3 tufB Elongation factor Tu-B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A8LLG2 1.93e-130 376 75 2 244 3 tuf1 Elongation factor Tu Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q2RQV8 2.05e-130 377 77 2 237 3 tuf1 Elongation factor Tu 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q877P8 2.33e-130 376 74 1 245 3 tufA Elongation factor Tu Xylella fastidiosa (strain Temecula1 / ATCC 700964)
A0L5V8 2.41e-130 376 76 2 242 3 tuf1 Elongation factor Tu Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q2RQU6 2.97e-130 376 76 1 237 3 tuf2 Elongation factor Tu 2 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q8KTA3 4.02e-130 375 75 0 241 3 tuf Elongation factor Tu Rickettsia rhipicephali
C1A6Q3 4.04e-130 376 73 0 240 3 tuf Elongation factor Tu Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
A6Q1L5 4.6e-130 376 73 1 247 3 tuf Elongation factor Tu Nitratiruptor sp. (strain SB155-2)
Q5FTY1 1.02e-129 375 74 2 243 3 tuf Elongation factor Tu Gluconobacter oxydans (strain 621H)
A7HBL7 1.4e-129 374 75 1 244 3 tuf1 Elongation factor Tu Anaeromyxobacter sp. (strain Fw109-5)
A0RQJ3 2.53e-129 374 72 1 248 3 tuf Elongation factor Tu Campylobacter fetus subsp. fetus (strain 82-40)
Q748X8 2.72e-129 374 75 1 237 3 tuf1 Elongation factor Tu Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q30X13 3.87e-129 373 75 1 238 3 tuf Elongation factor Tu Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q7VJ74 4.66e-129 373 73 1 247 3 tuf Elongation factor Tu Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q3SSW8 5.42e-129 373 73 1 244 3 tuf Elongation factor Tu Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A5GAW4 5.42e-129 373 77 1 237 3 tuf1 Elongation factor Tu Geotalea uraniireducens (strain Rf4)
Q2JFH8 5.66e-129 373 76 1 240 3 tuf Elongation factor Tu Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A9H3R7 1.24e-128 372 74 2 243 3 tuf Elongation factor Tu Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A4G9U0 1.46e-128 372 77 1 244 3 tuf1 Elongation factor Tu Herminiimonas arsenicoxydans
Q1QN32 2.08e-128 371 73 2 244 3 tuf Elongation factor Tu Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q5NQ65 2.19e-128 371 76 2 244 3 tuf Elongation factor Tu Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q0BUQ2 2.53e-128 371 75 2 243 3 tuf Elongation factor Tu Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
P42482 3.18e-128 371 73 1 246 3 tuf Elongation factor Tu Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A9ETD1 3.51e-128 371 70 0 243 3 tuf1 Elongation factor Tu Sorangium cellulosum (strain So ce56)
Q99QM0 6.61e-128 370 75 2 241 3 tufA Elongation factor Tu Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q160Y4 6.97e-128 370 73 2 243 3 tuf1 Elongation factor Tu Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q2G8Y2 9.07e-128 370 74 1 240 3 tuf Elongation factor Tu Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q1RHL9 9.27e-128 370 74 0 243 3 tuf Elongation factor Tu Rickettsia bellii (strain RML369-C)
A8GVB2 9.27e-128 370 74 0 243 3 tuf Elongation factor Tu Rickettsia bellii (strain OSU 85-389)
Q4L3K9 1.53e-127 369 71 0 239 3 tuf Elongation factor Tu Staphylococcus haemolyticus (strain JCSC1435)
Q28UW7 1.55e-127 369 72 1 244 3 tuf1 Elongation factor Tu Jannaschia sp. (strain CCS1)
P33168 1.75e-127 369 72 1 249 3 tuf Elongation factor Tu Deinonema sp.
A5FZW7 1.97e-127 369 74 2 244 3 tuf Elongation factor Tu Acidiphilium cryptum (strain JF-5)
P64029 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain MW2)
A8YZP5 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBT9 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain MSSA476)
Q6GJC0 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain MRSA252)
P99152 3.59e-127 368 71 0 239 1 tuf Elongation factor Tu Staphylococcus aureus (strain N315)
P64028 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QEK0 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain Newman)
Q5HIC7 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain COL)
Q2YSB3 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQA2 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain JH9)
Q2G0N0 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ92 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain USA300)
A6TZ25 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain JH1)
A7WYX6 3.59e-127 368 71 0 239 3 tuf Elongation factor Tu Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7GK18 4.42e-127 368 71 1 240 3 tuf Elongation factor Tu Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q839G8 4.77e-127 368 72 1 240 3 tuf Elongation factor Tu Enterococcus faecalis (strain ATCC 700802 / V583)
A1B002 5.14e-127 368 74 1 244 3 tuf1 Elongation factor Tu Paracoccus denitrificans (strain Pd 1222)
Q3AMT6 7.39e-127 367 72 1 247 3 tuf Elongation factor Tu Synechococcus sp. (strain CC9605)
A8GPF2 7.88e-127 367 74 1 242 3 tuf Elongation factor Tu Rickettsia akari (strain Hartford)
Q1GDV0 8.59e-127 367 75 2 245 3 tuf1 Elongation factor Tu Ruegeria sp. (strain TM1040)
A4FPM7 9.39e-127 367 73 1 242 3 tuf Elongation factor Tu Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q0ANN1 9.49e-127 367 74 1 241 3 tuf1 Elongation factor Tu Maricaulis maris (strain MCS10)
Q5LMR5 1.01e-126 367 72 2 244 3 tuf1 Elongation factor Tu Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q3A6R2 1.18e-126 367 75 2 244 3 tuf1 Elongation factor Tu 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q8CQ81 1.19e-126 367 71 0 239 3 tuf Elongation factor Tu Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRK4 1.19e-126 367 71 0 239 3 tuf Elongation factor Tu Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B2UQY9 1.23e-126 367 69 0 242 3 tuf Elongation factor Tu Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q3A6P9 1.23e-126 367 75 2 244 3 tuf2 Elongation factor Tu 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A4WVL0 1.52e-126 367 71 1 245 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
B7GJ65 1.87e-126 366 69 1 240 3 tuf Elongation factor Tu Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q47LJ1 2.25e-126 366 71 1 243 3 tuf Elongation factor Tu Thermobifida fusca (strain YX)
B8J1A0 2.32e-126 366 75 2 237 3 tuf Elongation factor Tu Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
C5D3R5 2.8e-126 366 70 1 240 3 tuf Elongation factor Tu Geobacillus sp. (strain WCH70)
Q8R7V2 3.41e-126 366 72 2 248 3 tufA Elongation factor Tu-A Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q3J5S4 3.83e-126 365 71 1 245 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PGI1 3.83e-126 365 71 1 245 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q1D7V1 4.94e-126 365 72 1 244 3 tuf1 Elongation factor Tu 1 Myxococcus xanthus (strain DK1622)
B9KFF9 5.33e-126 365 70 1 247 3 tuf Elongation factor Tu Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A8HTW6 5.39e-126 365 75 2 237 3 tuf1 Elongation factor Tu Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q1D776 5.51e-126 365 72 1 244 3 tuf2 Elongation factor Tu 2 Myxococcus xanthus (strain DK1622)
A7ZCN0 7.01e-126 365 71 1 248 3 tuf Elongation factor Tu Campylobacter concisus (strain 13826)
A1SNN5 8.16e-126 365 71 1 242 3 tuf Elongation factor Tu Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q5L3Z9 1.14e-125 364 70 1 240 3 tuf Elongation factor Tu Geobacillus kaustophilus (strain HTA426)
Q0C1F4 1.18e-125 364 73 2 240 3 tuf1 Elongation factor Tu 1 Hyphomonas neptunium (strain ATCC 15444)
Q8R7T8 1.64e-125 364 71 2 248 3 tufB Elongation factor Tu-B Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A9ISD9 1.66e-125 364 72 1 244 3 tuf1 Elongation factor Tu Bartonella tribocorum (strain CIP 105476 / IBS 506)
B8DLL9 1.73e-125 364 74 1 238 3 tuf Elongation factor Tu Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
O50306 1.79e-125 364 70 1 240 3 tuf Elongation factor Tu Geobacillus stearothermophilus
Q1JCT6 2.33e-125 364 71 1 242 3 tuf Elongation factor Tu Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DA83 2.38e-125 363 71 1 242 3 tuf Elongation factor Tu Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48UK5 2.38e-125 363 71 1 242 3 tuf Elongation factor Tu Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RFQ4 2.38e-125 363 71 1 242 3 tuf Elongation factor Tu Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J7N4 2.38e-125 363 71 1 242 3 tuf Elongation factor Tu Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JHV6 2.38e-125 363 71 1 242 3 tuf Elongation factor Tu Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JMR3 2.38e-125 363 71 1 242 3 tuf Elongation factor Tu Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q5XD49 2.38e-125 363 71 1 242 1 tuf Elongation factor Tu Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DA82 2.38e-125 363 71 1 242 3 tuf Elongation factor Tu Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q1IX70 2.49e-125 364 71 1 249 3 tuf1 Elongation factor Tu Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A5GIP0 2.51e-125 363 72 1 247 3 tuf Elongation factor Tu Synechococcus sp. (strain WH7803)
Q5HVZ7 2.77e-125 363 70 1 247 3 tuf Elongation factor Tu Campylobacter jejuni (strain RM1221)
A1VYI6 2.77e-125 363 70 1 247 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
O69303 2.77e-125 363 70 1 247 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7H4R3 2.77e-125 363 70 1 247 3 tuf Elongation factor Tu Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FKQ5 2.77e-125 363 70 1 247 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
B0T2B5 3.6e-125 363 74 2 241 3 tuf2 Elongation factor Tu 2 Caulobacter sp. (strain K31)
Q0BYB2 3.93e-125 363 73 2 240 3 tuf2 Elongation factor Tu 2 Hyphomonas neptunium (strain ATCC 15444)
B5XKI1 4.73e-125 363 70 1 242 3 tuf Elongation factor Tu Streptococcus pyogenes serotype M49 (strain NZ131)
Q8P1W4 4.73e-125 363 70 1 242 3 tuf Elongation factor Tu Streptococcus pyogenes serotype M18 (strain MGAS8232)
B4U3U1 5.64e-125 363 70 1 242 3 tuf Elongation factor Tu Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q9Z9L6 5.76e-125 363 70 1 239 3 tuf Elongation factor Tu Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B8ELG5 5.82e-125 363 74 2 236 3 tuf Elongation factor Tu Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q8E645 7.32e-125 362 71 1 242 3 tuf Elongation factor Tu Streptococcus agalactiae serotype III (strain NEM316)
Q3K1U4 7.32e-125 362 71 1 242 3 tuf Elongation factor Tu Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B9DKV8 7.4e-125 362 70 1 239 3 tuf Elongation factor Tu Staphylococcus carnosus (strain TM300)
Q1WU83 7.4e-125 362 70 1 242 3 tuf Elongation factor Tu Ligilactobacillus salivarius (strain UCC118)
B0SUQ7 7.48e-125 362 74 2 241 3 tuf1 Elongation factor Tu 1 Caulobacter sp. (strain K31)
Q31IY4 7.82e-125 362 74 1 241 3 tuf1 Elongation factor Tu Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A7I3U7 7.99e-125 362 71 1 245 3 tuf Elongation factor Tu Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B3QY22 8.53e-125 362 70 0 242 3 tuf Elongation factor Tu Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
C0ZIH6 1.1e-124 362 70 2 243 3 tuf Elongation factor Tu Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
C0Q9Y7 1.26e-124 362 71 2 246 3 tuf Elongation factor Tu Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
B9DRL9 1.26e-124 362 70 1 242 3 tuf Elongation factor Tu Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q0RRS3 1.44e-124 362 75 1 240 3 tuf Elongation factor Tu Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
P69952 1.44e-124 362 70 1 242 3 tuf Elongation factor Tu Streptococcus pyogenes serotype M1
P33166 1.49e-124 362 71 1 239 1 tuf Elongation factor Tu Bacillus subtilis (strain 168)
A5GW14 1.75e-124 362 72 1 247 3 tuf Elongation factor Tu Synechococcus sp. (strain RCC307)
A4IJI7 1.87e-124 361 69 1 240 3 tuf Elongation factor Tu Geobacillus thermodenitrificans (strain NG80-2)
Q8E0H1 1.96e-124 361 71 1 242 3 tuf Elongation factor Tu Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
C1CSB0 2.25e-124 361 70 1 242 3 tuf Elongation factor Tu Streptococcus pneumoniae (strain Taiwan19F-14)
C1CLI6 2.25e-124 361 70 1 242 3 tuf Elongation factor Tu Streptococcus pneumoniae (strain P1031)
C1CF71 2.25e-124 361 70 1 242 3 tuf Elongation factor Tu Streptococcus pneumoniae (strain JJA)
P64031 2.25e-124 361 70 1 242 3 tuf Elongation factor Tu Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P64030 2.25e-124 361 70 1 242 3 tuf Elongation factor Tu Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZL95 2.25e-124 361 70 1 242 3 tuf Elongation factor Tu Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1ICR4 2.25e-124 361 70 1 242 3 tuf Elongation factor Tu Streptococcus pneumoniae (strain Hungary19A-6)
C1C881 2.25e-124 361 70 1 242 3 tuf Elongation factor Tu Streptococcus pneumoniae (strain 70585)
B5E653 2.25e-124 361 70 1 242 3 tuf Elongation factor Tu Streptococcus pneumoniae serotype 19F (strain G54)
Q04N79 2.25e-124 361 70 1 242 3 tuf Elongation factor Tu Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A3CP09 2.6e-124 361 71 1 242 3 tuf Elongation factor Tu Streptococcus sanguinis (strain SK36)
A7Z0N5 2.83e-124 361 71 1 239 3 tuf Elongation factor Tu Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q2RFP5 3.13e-124 361 71 2 248 3 tuf Elongation factor Tu Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A8AWA0 5.11e-124 360 70 1 242 3 tuf Elongation factor Tu Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q6A6L7 5.7e-124 360 71 1 243 3 tuf Elongation factor Tu Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q5WLR4 6.36e-124 360 71 1 239 3 tuf Elongation factor Tu Shouchella clausii (strain KSM-K16)
A1VAK4 6.64e-124 360 74 2 238 3 tuf Elongation factor Tu Nitratidesulfovibrio vulgaris (strain DP4)
Q727D5 6.64e-124 360 74 2 238 3 tuf Elongation factor Tu Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8ETY4 7.74e-124 360 71 1 239 3 tuf Elongation factor Tu Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9ZK19 8.54e-124 360 71 1 247 3 tuf Elongation factor Tu Helicobacter pylori (strain J99 / ATCC 700824)
A7GZK6 1.29e-123 359 69 1 248 3 tuf Elongation factor Tu Campylobacter curvus (strain 525.92)
A4J0Z5 1.43e-123 359 72 2 247 3 tuf Elongation factor Tu Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
P72483 1.64e-123 359 71 1 242 3 tuf Elongation factor Tu Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B6JET1 1.7e-123 359 72 1 237 3 tuf Elongation factor Tu Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q65PA9 2.07e-123 358 70 1 240 3 tuf Elongation factor Tu Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B2UUW8 2.84e-123 358 70 1 247 3 tuf Elongation factor Tu Helicobacter pylori (strain Shi470)
O21245 2.87e-123 358 65 0 242 3 TUFA Elongation factor Tu, mitochondrial Reclinomonas americana
Q7U4D1 2.96e-123 358 71 1 247 3 tuf Elongation factor Tu Parasynechococcus marenigrum (strain WH8102)
B9E8Q0 3.38e-123 358 72 1 237 3 tuf Elongation factor Tu Macrococcus caseolyticus (strain JCSC5402)
Q6HPR0 4.39e-123 358 69 1 240 3 tuf Elongation factor Tu Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63H92 4.39e-123 358 69 1 240 3 tuf Elongation factor Tu Bacillus cereus (strain ZK / E33L)
Q814C4 4.39e-123 358 69 1 240 3 tuf Elongation factor Tu Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HJ46 4.39e-123 358 69 1 240 3 tuf Elongation factor Tu Bacillus cereus (strain B4264)
C1ET37 4.39e-123 358 69 1 240 3 tuf Elongation factor Tu Bacillus cereus (strain 03BB102)
B7JKB7 4.39e-123 358 69 1 240 3 tuf Elongation factor Tu Bacillus cereus (strain AH820)
Q81VT2 4.39e-123 358 69 1 240 3 tuf Elongation factor Tu Bacillus anthracis
A0R8H8 4.39e-123 358 69 1 240 3 tuf Elongation factor Tu Bacillus thuringiensis (strain Al Hakam)
C3LJ80 4.39e-123 358 69 1 240 3 tuf Elongation factor Tu Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9Q3 4.39e-123 358 69 1 240 3 tuf Elongation factor Tu Bacillus anthracis (strain A0248)
Q89J82 4.44e-123 358 73 1 237 3 tuf Elongation factor Tu Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P56003 4.59e-123 358 70 1 247 3 tuf Elongation factor Tu Helicobacter pylori (strain ATCC 700392 / 26695)
B5Z8K3 4.95e-123 358 70 1 247 3 tuf Elongation factor Tu Helicobacter pylori (strain G27)
Q03LX0 5.17e-123 358 69 1 242 3 tuf Elongation factor Tu Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5I8 5.17e-123 358 69 1 242 3 tuf Elongation factor Tu Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M101 5.17e-123 358 69 1 242 3 tuf Elongation factor Tu Streptococcus thermophilus (strain CNRZ 1066)
B0TC54 5.77e-123 358 72 2 248 3 tuf Elongation factor Tu Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A6W5T5 5.9e-123 357 70 1 240 3 tuf Elongation factor Tu Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q9R342 6.02e-123 358 71 1 249 3 tufA Elongation factor Tu Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A8LC58 6.5e-123 357 74 1 240 3 tuf Elongation factor Tu Parafrankia sp. (strain EAN1pec)
A6X0A2 6.64e-123 357 72 1 237 3 tuf1 Elongation factor Tu Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q0AUG3 7.02e-123 357 72 2 247 3 tuf2 Elongation factor Tu 2 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q0AUH8 7.02e-123 357 72 2 247 3 tuf1 Elongation factor Tu 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B9IZJ2 8e-123 357 69 1 240 3 tuf Elongation factor Tu Bacillus cereus (strain Q1)
B7HQU2 8e-123 357 69 1 240 3 tuf Elongation factor Tu Bacillus cereus (strain AH187)
Q73F98 8e-123 357 69 1 240 3 tuf Elongation factor Tu Bacillus cereus (strain ATCC 10987 / NRS 248)
B7IT17 8.09e-123 357 70 1 240 3 tuf Elongation factor Tu Bacillus cereus (strain G9842)
Q3B6G3 9.32e-123 357 72 0 234 3 tuf Elongation factor Tu Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
P33170 9.74e-123 357 69 1 242 3 tuf Elongation factor Tu Streptococcus oralis
Q1IHG6 1.25e-122 357 71 0 243 3 tuf1 Elongation factor Tu Koribacter versatilis (strain Ellin345)
Q9XD38 1.83e-122 357 69 2 244 3 tuf Elongation factor Tu Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NF9 1.83e-122 357 69 2 244 3 tuf Elongation factor Tu Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A9KRZ4 2.33e-122 356 69 2 245 3 tuf Elongation factor Tu Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A4YSJ0 2.63e-122 356 72 1 237 3 tuf Elongation factor Tu Bradyrhizobium sp. (strain ORS 278)
A5ELM9 2.63e-122 356 72 1 237 3 tuf Elongation factor Tu Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A9VP75 2.93e-122 356 69 1 241 3 tuf Elongation factor Tu Bacillus mycoides (strain KBAB4)
Q2II78 3.1e-122 356 76 1 244 3 tuf1 Elongation factor Tu Anaeromyxobacter dehalogenans (strain 2CP-C)
Q039K9 3.27e-122 355 69 1 243 3 tuf Elongation factor Tu Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WE38 3.27e-122 355 69 1 243 3 tuf Elongation factor Tu Lacticaseibacillus casei (strain BL23)
A8MLC4 3.45e-122 355 71 3 242 3 tuf1 Elongation factor Tu Alkaliphilus oremlandii (strain OhILAs)
P64025 3.98e-122 355 72 1 237 3 tufA Elongation factor Tu Brucella suis biovar 1 (strain 1330)
A5VR08 3.98e-122 355 72 1 237 3 tuf1 Elongation factor Tu Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P64024 3.98e-122 355 72 1 237 3 tufA Elongation factor Tu Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M5Q2 3.98e-122 355 72 1 237 3 tuf1 Elongation factor Tu Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q2YM08 3.98e-122 355 72 1 237 3 tuf1 Elongation factor Tu Brucella abortus (strain 2308)
C4Z2R9 4.69e-122 355 68 2 244 3 tuf Elongation factor Tu Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q6FZL2 5.29e-122 355 72 1 237 3 tuf2 Elongation factor Tu 2 Bartonella quintana (strain Toulouse)
P29542 5.29e-122 355 69 1 243 3 tuf1 Elongation factor Tu-1 Streptomyces ramocissimus
B6JN44 5.4e-122 355 69 1 247 3 tuf Elongation factor Tu Helicobacter pylori (strain P12)
B0SSH9 5.83e-122 355 66 1 243 3 tuf Elongation factor Tu Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SAF6 5.83e-122 355 66 1 243 3 tuf Elongation factor Tu Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
P42479 6.51e-122 355 71 1 245 3 tuf Elongation factor Tu Stigmatella aurantiaca
C4KZP9 6.72e-122 355 67 1 243 3 tuf Elongation factor Tu Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
A8EW02 9.53e-122 355 69 1 246 3 tuf Elongation factor Tu Aliarcobacter butzleri (strain RM4018)
B0CH34 9.53e-122 354 72 1 237 3 tuf1 Elongation factor Tu Brucella suis (strain ATCC 23445 / NCTC 10510)
Q6FZC0 9.96e-122 354 72 1 237 3 tuf1 Elongation factor Tu 1 Bartonella quintana (strain Toulouse)
Q49V58 1.02e-121 354 69 1 236 3 tuf Elongation factor Tu Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q1GP97 1.11e-121 354 74 1 236 3 tuf Elongation factor Tu Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A9BCK0 1.19e-121 354 70 1 247 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9211)
P50068 1.2e-121 354 70 0 240 3 tuf Elongation factor Tu Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJG3 1.2e-121 354 70 0 240 3 tuf Elongation factor Tu Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
A4XBP8 1.24e-121 354 70 1 236 3 tuf Elongation factor Tu Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A5N4N1 1.29e-121 354 71 2 244 3 tuf1 Elongation factor Tu Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
A5D5K0 1.41e-121 354 70 2 247 3 tuf1 Elongation factor Tu 1 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B4SBU5 1.54e-121 354 71 0 235 3 tuf Elongation factor Tu Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B3EH93 1.58e-121 354 72 0 233 3 tuf Elongation factor Tu Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
A5D5I8 1.61e-121 354 70 2 247 3 tuf2 Elongation factor Tu 2 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A5CCL4 1.66e-121 354 67 0 242 3 tuf2 Elongation factor Tu 2 Orientia tsutsugamushi (strain Boryong)
A5CCA0 1.7e-121 354 67 0 242 3 tuf1 Elongation factor Tu 1 Orientia tsutsugamushi (strain Boryong)
P26184 1.88e-121 353 72 2 242 3 tuf Elongation factor Tu Flexistipes sinusarabici
P29543 2.11e-121 353 67 1 240 3 tuf2 Elongation factor Tu-2 Streptomyces ramocissimus
Q8KAH0 2.23e-121 353 71 0 235 3 tuf Elongation factor Tu Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B9MQH1 2.46e-121 353 70 3 249 3 tuf Elongation factor Tu Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A4XI37 3.03e-121 353 69 3 249 3 tuf Elongation factor Tu Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A2CC87 3.17e-121 353 70 1 247 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9303)
Q30TQ5 3.73e-121 353 67 1 248 3 tuf Elongation factor Tu Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_17540
Feature type CDS
Gene tuf
Product elongation factor Tu
Location 18 - 749 (strand: 1)
Length 732 (nucleotides) / 243 (amino acids)
In genomic island -

Contig

Accession contig_29
Length 39360 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_154
Orthogroup size 10
N. genomes 7

Actions

Genomic region

Domains

PF03143 Elongation factor Tu C-terminal domain
PF03144 Elongation factor Tu domain 2

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0050 Translation, ribosomal structure and biogenesis (J) J Translation elongation factor EF-Tu, a GTPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02358 elongation factor Tu Plant-pathogen interaction -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG046474 elongation factor Tu VF0460 Adherence

Protein Sequence

MEVRELLSQYDFPGDDTPIVRGSALKALEGEPEWEAKIVELAGFLDSYIPEPERAIDKPFLLPIEDVFSISGRGTVVTGRVERGIVKVGEEVEIVGIKDTIKTTCTGVEMFRKLLDEGRAGENVGVLLRGTKREEIERGQVLAKPGSIKPHTKFESEVYILSKDEGGRHTPFFKGYRPQFYFRTTDVTGTIELPEGVEMVMPGDNIKMIVTLIHPIAMDDGLRFAIREGGRTVGAGVVAKVMG

Flanking regions ( +/- flanking 50bp)

TGCTGGAACTGGTTGAAATGGAAGTTCGTGAACTTCTGTCTCAGTACGATTTCCCTGGCGACGACACGCCAATCGTTCGCGGTTCAGCGCTGAAAGCACTGGAAGGCGAGCCAGAGTGGGAAGCTAAGATCGTTGAACTGGCAGGTTTCTTGGATTCTTACATCCCGGAGCCAGAGCGTGCAATTGACAAGCCGTTCCTGCTGCCAATCGAAGACGTATTCTCAATCTCCGGCCGTGGTACCGTTGTTACCGGTCGTGTTGAGCGCGGTATCGTTAAAGTCGGTGAAGAAGTTGAAATCGTGGGTATCAAAGACACGATCAAAACTACCTGTACCGGTGTTGAAATGTTCCGCAAACTGCTGGACGAAGGCCGTGCAGGTGAGAACGTCGGTGTTCTGCTGCGTGGTACCAAGCGTGAAGAAATCGAACGTGGTCAGGTTCTGGCTAAACCAGGTTCAATCAAACCACACACCAAATTTGAATCAGAAGTTTATATTCTGAGCAAAGATGAAGGTGGTCGTCATACTCCATTCTTCAAAGGCTACCGTCCACAGTTCTACTTCCGTACCACAGACGTAACAGGTACTATCGAACTGCCGGAAGGCGTTGAAATGGTAATGCCGGGCGACAACATCAAAATGATCGTCACCCTGATCCACCCAATCGCAATGGACGATGGTCTGCGTTTCGCAATCCGTGAAGGCGGCCGTACCGTTGGCGCGGGTGTTGTAGCGAAAGTGATGGGTTAATTACGGATGTAATAATCCTAAAAAGGGCATCATTTGATGCCCTTTTTCTG