Homologs in group_98

Help

11 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14705 FBDBKF_14705 35.3 Morganella morganii S1 fabF beta-ketoacyl-ACP synthase II
EHELCC_15510 EHELCC_15510 35.3 Morganella morganii S2 fabF beta-ketoacyl-ACP synthase II
NLDBIP_16040 NLDBIP_16040 35.3 Morganella morganii S4 fabF beta-ketoacyl-ACP synthase II
LHKJJB_15800 LHKJJB_15800 35.3 Morganella morganii S3 fabF beta-ketoacyl-ACP synthase II
HKOGLL_14920 HKOGLL_14920 35.3 Morganella morganii S5 fabF beta-ketoacyl-ACP synthase II
F4V73_RS07500 F4V73_RS07500 34.8 Morganella psychrotolerans fabF beta-ketoacyl-ACP synthase II
F4V73_RS12000 F4V73_RS12000 31.4 Morganella psychrotolerans - beta-ketoacyl-[acyl-carrier-protein] synthase family protein
F4V73_RS12015 F4V73_RS12015 34.7 Morganella psychrotolerans - beta-ketoacyl-ACP synthase
PMI_RS03710 PMI_RS03710 16.0 Proteus mirabilis HI4320 - 3-oxoacyl-ACP synthase
PMI_RS04235 PMI_RS04235 35.1 Proteus mirabilis HI4320 fabF beta-ketoacyl-ACP synthase II
PMI_RS14370 PMI_RS14370 19.3 Proteus mirabilis HI4320 - beta-ketoacyl synthase N-terminal-like domain-containing protein

Distribution of the homologs in the orthogroup group_98

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_98

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O34340 6.04e-68 234 35 8 415 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Bacillus subtilis (strain 168)
O34340 7.16e-17 87 24 15 449 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Bacillus subtilis (strain 168)
P06230 2.94e-65 227 36 7 395 3 nodE Nodulation protein E Rhizobium meliloti (strain 1021)
P06230 1.5e-12 73 27 8 251 3 nodE Nodulation protein E Rhizobium meliloti (strain 1021)
P06231 3.58e-64 224 36 9 398 3 nodE Nodulation protein E Rhizobium meliloti
P06231 9.56e-11 68 28 9 252 3 nodE Nodulation protein E Rhizobium meliloti
P73283 5.34e-62 218 32 11 428 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P73283 2.61e-16 85 23 11 397 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P72331 1.69e-61 216 35 7 395 3 nodE Nodulation protein E Rhizobium sp. (strain N33)
P72331 5.08e-15 81 25 5 289 3 nodE Nodulation protein E Rhizobium sp. (strain N33)
Q8NXE1 2.04e-60 214 34 8 414 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MW2)
Q8NXE1 2.06e-18 92 25 15 424 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MW2)
Q6GAU2 2.04e-60 214 34 8 414 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MSSA476)
Q6GAU2 2.06e-18 92 25 15 424 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MSSA476)
Q5HHA1 2.04e-60 214 34 8 414 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain COL)
Q5HHA1 2.06e-18 92 25 15 424 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain COL)
Q83E37 2.49e-60 214 33 9 417 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q83E37 1.44e-19 95 22 10 401 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q7A6F8 4.2e-60 213 34 8 414 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain N315)
Q7A6F8 3.19e-18 91 25 15 424 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain N315)
Q99VA6 4.2e-60 213 34 8 414 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99VA6 3.19e-18 91 25 15 424 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GIA3 1.33e-59 212 34 8 414 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MRSA252)
Q6GIA3 8.87e-18 90 25 15 423 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MRSA252)
Q5TKS0 4.93e-58 207 34 8 408 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 (Fragment) Staphylococcus aureus
Q5TKS0 4.1e-17 88 25 15 421 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 (Fragment) Staphylococcus aureus
P04683 7.47e-57 204 34 7 395 3 nodE Nodulation protein E Rhizobium leguminosarum bv. viciae
P04683 1.46e-10 67 26 9 253 3 nodE Nodulation protein E Rhizobium leguminosarum bv. viciae
P04684 3.04e-56 202 34 8 395 3 nodE Nodulation protein E Rhizobium leguminosarum bv. trifolii
P04684 1.63e-13 77 23 12 398 3 nodE Nodulation protein E Rhizobium leguminosarum bv. trifolii
P23155 2.29e-53 194 31 12 423 3 SCO5318 Putative polyketide beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P23155 3.47e-19 94 23 15 461 3 SCO5318 Putative polyketide beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q02578 3.09e-50 186 31 12 418 3 curA Putative polyketide beta-ketoacyl synthase 1 Streptomyces cyaneus
Q02578 2.89e-16 85 25 7 274 3 curA Putative polyketide beta-ketoacyl synthase 1 Streptomyces cyaneus
Q05356 3.47e-50 186 30 10 417 3 sch1 Putative polyketide beta-ketoacyl synthase 1 Streptomyces halstedii
Q05356 4.33e-22 103 23 15 467 3 sch1 Putative polyketide beta-ketoacyl synthase 1 Streptomyces halstedii
Q02059 3.18e-49 184 31 11 419 1 SCO5087 Actinorhodin polyketide putative beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q02059 1.52e-14 80 23 5 272 1 SCO5087 Actinorhodin polyketide putative beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P55338 3.87e-49 182 30 8 423 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio harveyi
P55338 8.82e-16 84 22 12 403 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio harveyi
P16538 7.22e-49 182 30 11 422 1 tcmK Tetracenomycin polyketide synthase ketoacyl synthase alpha subunit Streptomyces glaucescens
P16538 2.96e-17 89 27 7 276 1 tcmK Tetracenomycin polyketide synthase ketoacyl synthase alpha subunit Streptomyces glaucescens
Q9KQH9 1.22e-48 181 31 9 416 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KQH9 1.79e-16 86 22 11 399 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P52410 2.01e-47 179 31 8 416 1 KAS1 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Arabidopsis thaliana
P52410 1.38e-10 68 23 13 415 1 KAS1 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Arabidopsis thaliana
P23902 1.51e-46 176 30 7 422 1 KAS12 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Hordeum vulgare
P23902 6.55e-08 59 23 10 364 1 KAS12 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Hordeum vulgare
Q9NWU1 4.57e-46 175 41 7 259 1 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Homo sapiens
Q9NWU1 1.61e-11 71 25 5 274 1 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Homo sapiens
Q9D404 6.66e-46 174 39 6 259 1 Oxsm 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Mus musculus
Q9D404 4.51e-16 85 23 9 421 1 Oxsm 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Mus musculus
P56902 1.05e-45 173 39 5 261 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Rhizobium meliloti (strain 1021)
P56902 2.26e-15 82 25 9 385 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Rhizobium meliloti (strain 1021)
P0AAI8 8.86e-45 170 31 9 422 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Shigella flexneri
P0AAI8 3.62e-14 79 26 3 225 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Shigella flexneri
P0AAI5 8.86e-45 170 31 9 422 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli (strain K12)
P0AAI5 3.62e-14 79 26 3 225 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli (strain K12)
P0AAI6 8.86e-45 170 31 9 422 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAI6 3.62e-14 79 26 3 225 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAI7 8.86e-45 170 31 9 422 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O157:H7
P0AAI7 3.62e-14 79 26 3 225 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O157:H7
P16540 2.58e-43 166 29 10 415 3 gra-orf1 Granaticin polyketide putative beta-ketoacyl synthase 1 Streptomyces violaceoruber
P16540 2.93e-20 97 24 15 454 3 gra-orf1 Granaticin polyketide putative beta-ketoacyl synthase 1 Streptomyces violaceoruber
P41175 6.72e-43 165 29 12 424 3 None Putative polyketide beta-ketoacyl synthase 1 Streptomyces virginiae
P41175 4.42e-17 88 25 4 262 3 None Putative polyketide beta-ketoacyl synthase 1 Streptomyces virginiae
O94297 8.38e-43 164 29 14 438 3 SPBC887.13c Putative 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94297 6.62e-10 65 24 12 365 3 SPBC887.13c Putative 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8L3X9 7.49e-42 162 30 13 436 1 KAS 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Arabidopsis thaliana
Q8L3X9 1.92e-12 73 27 8 270 1 KAS 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Arabidopsis thaliana
P43710 1.01e-40 158 29 13 415 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P43710 2.98e-13 76 24 14 373 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0VCA7 1.86e-40 159 39 6 258 2 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Bos taurus
Q0VCA7 1.91e-13 77 25 5 270 2 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Bos taurus
P57193 4.11e-40 156 29 10 419 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57193 4.32e-12 72 22 12 450 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9C9P4 2.23e-39 157 29 9 418 1 KAS2 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic Arabidopsis thaliana
Q9C9P4 8.43e-09 62 23 10 375 1 KAS2 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic Arabidopsis thaliana
Q89AY4 7.96e-39 152 28 10 419 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AY4 5.47e-17 87 24 19 407 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q02K94 2.58e-38 151 28 11 411 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02K94 4.97e-11 69 22 13 401 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
P43678 2.98e-38 151 28 7 411 3 None Oxytetracycline polyketide putative beta-ketoacyl synthase 1 Streptomyces rimosus
P43678 7.81e-08 59 21 16 463 3 None Oxytetracycline polyketide putative beta-ketoacyl synthase 1 Streptomyces rimosus
P39525 8.69e-37 147 28 15 443 1 CEM1 3-oxoacyl-[acyl-carrier-protein] synthase homolog Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39525 1.05e-12 74 22 13 439 1 CEM1 3-oxoacyl-[acyl-carrier-protein] synthase homolog Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0A953 1.29e-33 137 27 13 415 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli (strain K12)
P0A953 4.95e-13 75 22 16 451 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli (strain K12)
P0A954 1.29e-33 137 27 13 415 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A954 4.95e-13 75 22 16 451 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8KA28 2.39e-31 130 27 11 421 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8KA28 1.49e-09 64 22 16 462 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P9WQD7 3.44e-30 127 23 9 424 1 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD7 3.43e-06 53 27 4 194 1 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD6 3.44e-30 127 23 9 424 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQD6 3.43e-06 53 27 4 194 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63457 3.44e-30 127 23 9 424 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63457 3.43e-06 53 27 4 194 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQD9 5.05e-28 121 25 5 312 1 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD9 1.44e-05 52 23 6 260 1 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD8 5.05e-28 121 25 5 312 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQD8 1.44e-05 52 23 6 260 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
H8ESN0 5.05e-28 121 25 5 312 2 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
H8ESN0 1.44e-05 52 23 6 260 2 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
P63455 5.05e-28 121 25 5 312 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63455 1.44e-05 52 23 6 260 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O69473 8.54e-27 117 28 4 258 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium leprae (strain TN)
O69473 0.000849 46 23 5 200 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium leprae (strain TN)
Q9CBS7 9.8e-26 114 25 5 312 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium leprae (strain TN)
Q9CBS7 7.62e-06 53 25 10 269 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium leprae (strain TN)
P40804 1.54e-24 110 26 11 357 1 pksF Polyketide biosynthesis malonyl-ACP decarboxylase PksF Bacillus subtilis (strain 168)
P40804 4.62e-10 66 30 3 183 1 pksF Polyketide biosynthesis malonyl-ACP decarboxylase PksF Bacillus subtilis (strain 168)
B0G103 3.25e-22 107 28 12 373 3 pks10 Probable polyketide synthase 10 Dictyostelium discoideum
Q54KU3 4.34e-22 106 27 18 452 3 pks25 Probable polyketide synthase 25 Dictyostelium discoideum
Q54KU3 1.32e-06 56 21 10 316 3 pks25 Probable polyketide synthase 25 Dictyostelium discoideum
Q869X2 1.05e-20 102 30 10 285 3 pks17 Probable polyketide synthase 17 Dictyostelium discoideum
Q869X2 2.37e-10 68 26 10 296 3 pks17 Probable polyketide synthase 17 Dictyostelium discoideum
Q869W9 2.21e-20 101 27 11 344 2 pks16 Probable polyketide synthase 16 Dictyostelium discoideum
Q869W9 2.63e-10 68 27 10 279 2 pks16 Probable polyketide synthase 16 Dictyostelium discoideum
K3VA96 2.8e-20 100 25 6 345 3 PKS40 Highly reducing polyketide synthase 40 Fusarium pseudograminearum (strain CS3096)
K3VA96 0.000172 49 23 8 309 3 PKS40 Highly reducing polyketide synthase 40 Fusarium pseudograminearum (strain CS3096)
E9F8M3 3.5e-20 100 25 7 347 1 swnK PKS-NRPS hybrid synthetase swnK Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
Q86JI5 1.55e-19 98 28 13 360 2 pks5 Probable polyketide synthase 5 Dictyostelium discoideum
Q9R9J1 2.21e-19 98 28 5 277 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
D4AU31 2.62e-19 97 26 8 348 3 swnK PKS-NRPS hybrid synthetase swnK Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q54KU5 5.37e-19 96 26 10 326 3 pks24 Probable polyketide synthase 24 Dictyostelium discoideum
Q54KU5 3.62e-07 58 22 9 289 3 pks24 Probable polyketide synthase 24 Dictyostelium discoideum
Q54D44 1e-18 95 27 8 301 3 pks42 Probable polyketide synthase 42 Dictyostelium discoideum
P40872 1.09e-18 95 25 6 324 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 1.43e-12 75 25 7 304 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 1.07e-07 60 24 7 212 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
A0A2I2F262 1.19e-18 95 26 9 350 1 acdB PKS-NRPS hybrid synthetase acdB Aspergillus candidus
Q03133 1.34e-18 95 29 7 238 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
Q03133 9.38e-07 57 27 6 233 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
Q5BBP5 1.42e-18 95 24 9 340 1 pkhB Highly reducing polyketide synthase pkhB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q55E72 1.65e-18 95 28 11 359 1 stlA Probable polyketide synthase 1 Dictyostelium discoideum
Q55E72 1.64e-06 56 26 6 252 1 stlA Probable polyketide synthase 1 Dictyostelium discoideum
Q2T4N1 2.01e-18 95 28 9 280 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 1.18e-14 82 29 5 238 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 2.17e-10 68 25 4 240 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 8.9e-07 57 24 1 146 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A0A084API3 3.02e-18 94 25 9 345 3 SAT13 Highly reducing polyketide synthase SAT13 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
E9F5E7 3.15e-18 94 27 7 281 1 subA Non-reducing polyketide synthase subA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
B0G138 3.36e-18 94 28 9 274 3 pks21 Probable polyketide synthase 21 Dictyostelium discoideum
B0G138 0.000156 49 20 4 239 3 pks21 Probable polyketide synthase 21 Dictyostelium discoideum
Q03131 3.44e-18 94 28 5 244 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03131 8.16e-14 80 26 6 296 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03131 3.05e-05 52 23 5 230 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
I6X8D2 6.79e-18 93 28 5 282 1 pks13 Polyketide synthase Pks13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WEX6 8.89e-18 92 27 7 281 1 dpmaA Non-reducing polyketide synthase dpmaA Metarhizium anisopliae
A2QK66 1.06e-17 92 25 9 323 3 ktnS Kotanin synthase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
B6QK81 1.28e-17 92 28 8 287 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
B6QK81 0.000491 47 22 11 326 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN6 1.28e-17 92 28 8 287 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei
D7RJN6 0.000491 47 22 11 326 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei
B0G100 1.55e-17 92 27 13 342 3 pks7 Probable polyketide synthase 7 Dictyostelium discoideum
Q54QD1 1.69e-17 92 24 11 359 3 pks23 Probable polyketide synthase 23 Dictyostelium discoideum
Q54QD1 5.62e-06 54 22 6 295 3 pks23 Probable polyketide synthase 23 Dictyostelium discoideum
Q54ED6 1.81e-17 91 26 11 333 3 pks41 Probable polyketide synthase 41 Dictyostelium discoideum
B6HN77 1.92e-17 91 28 8 273 3 sorB Non-reducing polyketide synthase sorB Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q54T36 2.56e-17 91 27 9 281 3 pks19 Probable polyketide synthase 19 Dictyostelium discoideum
Q54T36 1.44e-05 52 21 4 239 3 pks19 Probable polyketide synthase 19 Dictyostelium discoideum
A0A097ZPE0 2.68e-17 91 27 5 266 1 andM Non-reducing polyketide synthase andM Emericella variicolor
Q54FN7 3.39e-17 90 27 8 295 3 pks33 Probable polyketide synthase 33 Dictyostelium discoideum
Q54FN7 0.00017 49 22 8 292 3 pks33 Probable polyketide synthase 33 Dictyostelium discoideum
A0A5C1RDA3 3.81e-17 90 24 9 355 3 orf7 Highly reducing polyketide synthase Didymella fabae
Q54IX3 3.85e-17 90 24 12 327 3 pks26 Probable polyketide synthase 26 Dictyostelium discoideum
Q54IX3 2.41e-05 52 21 15 346 3 pks26 Probable polyketide synthase 26 Dictyostelium discoideum
Q559A9 4.46e-17 90 24 9 323 3 pks13 Probable polyketide synthase 13 Dictyostelium discoideum
Q559A9 1.39e-07 59 24 10 315 3 pks13 Probable polyketide synthase 13 Dictyostelium discoideum
A0A8D5M692 4.56e-17 90 29 4 266 1 esdpA Non-reducing polyketide synthase esdpA Penicillium shearii
P96284 5.04e-17 88 26 5 275 1 pks15 Putative inactive phenolphthiocerol synthesis polyketide synthase type I Pks15 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
K2QVI8 5.06e-17 90 26 6 267 1 dpmpA Non-reducing polyketide synthase dpmpA Macrophomina phaseolina (strain MS6)
Q02062 5.09e-17 87 28 9 269 1 SCO5088 Actinorhodin polyketide putative beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q02062 1.13e-10 68 21 11 407 1 SCO5088 Actinorhodin polyketide putative beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q55DM7 5.15e-17 90 29 8 264 3 pks2 Probable polyketide synthase 2 Dictyostelium discoideum
Q54QD3 5.31e-17 90 24 11 359 3 pks22 Probable polyketide synthase 22 Dictyostelium discoideum
Q54QD3 5.21e-06 54 22 6 295 3 pks22 Probable polyketide synthase 22 Dictyostelium discoideum
Q7TXK8 6.74e-17 89 26 5 275 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q54TW0 6.93e-17 90 27 9 303 2 pks18 Probable polyketide synthase 18 Dictyostelium discoideum
Q54TW0 9.86e-05 50 24 4 195 2 pks18 Probable polyketide synthase 18 Dictyostelium discoideum
A0A193PS74 7.48e-17 89 30 10 289 1 stbA Non-reducing polyketide synthase stbA Stachybotrys bisbyi
A0A193PS74 1.06e-07 59 23 12 326 1 stbA Non-reducing polyketide synthase stbA Stachybotrys bisbyi
Q50LG3 8.72e-17 89 25 6 287 3 AFT9-1 Highly reducing polyketide synthase AFT9-1 Alternaria alternata
G0R6S9 9.07e-17 89 27 8 271 2 sor2 Non-reducing polyketide synthase sor2 Hypocrea jecorina (strain QM6a)
G0R6S9 3.2e-06 55 22 7 271 2 sor2 Non-reducing polyketide synthase sor2 Hypocrea jecorina (strain QM6a)
I1RVD8 1.06e-16 89 23 6 345 3 PKS6 Highly reducing polyketide synthase PKS6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RVD8 5.57e-05 50 23 9 288 3 PKS6 Highly reducing polyketide synthase PKS6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A1W5T1T1 1.07e-16 89 22 9 348 2 poxF Highly reducing polyketide synthase poxF Penicillium oxalicum
P9WEX0 1.07e-16 89 28 10 337 1 dpasA Non-reducing polyketide synthase dpasA Apiospora sacchari
G0R6S8 1.91e-16 88 24 10 385 2 sor1 Highly reducing polyketide synthase sor1 Hypocrea jecorina (strain QM6a)
A5ABG0 2.2e-16 88 24 8 359 1 pynA Hybrid PKS-NRPS synthetase pynA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
W6QL47 2.49e-16 88 25 7 282 3 mpaC Non-reducing polyketide synthase mapC Penicillium roqueforti (strain FM164)
I6XD69 2.88e-16 87 30 5 242 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
I6XD69 1.29e-15 85 27 7 293 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q54G30 2.94e-16 87 25 7 296 3 pks27 Probable polyketide synthase 27 Dictyostelium discoideum
Q0C8A4 3.2e-16 87 27 9 285 1 trt4 Non-reducing polyketide synthase trt4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q07017 3.29e-16 87 27 3 230 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
Q07017 1.04e-15 86 27 5 247 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
Q07017 9.55e-05 50 22 8 290 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
A0A8F4SKJ7 3.72e-16 87 28 9 286 1 atr1 Non-reducing polyketide synthase atr1 Stereocaulon alpinum
A0A8F4SKJ7 8.58e-06 53 22 9 323 1 atr1 Non-reducing polyketide synthase atr1 Stereocaulon alpinum
A0A0B5KU17 3.95e-16 87 23 14 427 1 mpaC' Non-reducing polyketide synthase mapC' Penicillium brevicompactum
Q86AE3 4.18e-16 87 28 14 342 2 pks9 Probable polyketide synthase 9/36 Dictyostelium discoideum
Q54FQ3 4.25e-16 87 27 8 291 3 pks29 Probable polyketide synthase 29 Dictyostelium discoideum
Q54FQ3 0.000354 48 22 7 292 3 pks29 Probable polyketide synthase 29 Dictyostelium discoideum
B0G170 5.11e-16 87 27 8 286 3 pks28 Probable polyketide synthase 28 Dictyostelium discoideum
W6QDA2 5.2e-16 87 30 4 192 1 anuA Highly reducing polyketide synthase anuA Penicillium roqueforti (strain FM164)
Q5ATJ7 6.28e-16 86 25 16 426 1 ausA Non-reducing polyketide synthase ausA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B6HNK3 6.44e-16 86 25 8 334 3 sorA Highly reducing polyketide synthase sorA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q12053 6.87e-16 86 23 16 445 1 aflC Norsolorinic acid synthase Aspergillus parasiticus (strain ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1)
P16539 7.03e-16 84 24 9 338 1 tcmL Tetracenomycin polyketide synthase ketoacyl synthase beta subunit Streptomyces glaucescens
P16539 3.66e-11 69 25 3 176 1 tcmL Tetracenomycin polyketide synthase ketoacyl synthase beta subunit Streptomyces glaucescens
Q54FC8 7.45e-16 86 25 8 303 3 pks39 Probable polyketide synthase 39 Dictyostelium discoideum
Q54FC8 0.000244 48 21 8 294 3 pks39 Probable polyketide synthase 39 Dictyostelium discoideum
A0A455R5P9 7.67e-16 86 28 10 295 1 ascC Non-reducing polyketide synthase ascC Acremonium egyptiacum
A0A455R5P9 4.55e-05 51 22 12 331 1 ascC Non-reducing polyketide synthase ascC Acremonium egyptiacum
A0A455LXK0 7.97e-16 86 26 10 340 2 ntnG Non-reducing polyketide synthase ntnG Nectria sp.
Q7TXM0 8.21e-16 86 25 5 277 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B0G0Z9 8.46e-16 86 26 13 341 3 pks6 Probable polyketide synthase 6 Dictyostelium discoideum
Q0CF75 9.06e-16 86 25 6 288 1 ATEG_07659 Highly reducing polyketide synthase ATEG_07659 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P9WQE6 1.11e-15 85 25 5 277 3 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A1B3PEI6 1.16e-15 85 29 4 217 1 ORF-A Polyunsaturated fatty acid synthase subunit A Thraustochytrium sp. (strain ATCC 26185 / S-3)
P9WQE7 1.24e-15 85 25 5 277 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q558Y6 1.33e-15 85 26 10 305 3 pks14 Probable polyketide synthase 14 Dictyostelium discoideum
Q558Y6 3.89e-05 51 22 6 237 3 pks14 Probable polyketide synthase 14 Dictyostelium discoideum
B6HV32 1.43e-15 85 24 16 442 1 adrD Non-reducing polyketide synthase adrD Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q54FQ2 1.54e-15 85 27 10 291 3 pks30 Probable polyketide synthase 30 Dictyostelium discoideum
P9WET6 1.6e-15 85 28 7 256 1 Preu3 Non-reducing polyketide synthase Preu3 Preussia isomera
F1DBA9 1.62e-15 85 24 16 433 1 mpaC Non-reducing polyketide synthase mapC Penicillium brevicompactum
B0G101 1.79e-15 85 26 13 360 3 pks8 Probable polyketide synthase 8/35 Dictyostelium discoideum
A0A455M7S4 1.8e-15 85 23 19 529 1 atnG Non-reducing polyketide synthase atnG Arthrinium sp.
A0A0F7U103 1.96e-15 85 27 9 293 3 ausA Non-reducing polyketide synthase ausA Penicillium brasilianum
Q54ED7 2.26e-15 85 28 11 299 3 pks40 Probable polyketide synthase 40 Dictyostelium discoideum
Q84HC6 2.48e-15 84 29 8 244 1 ncsB Neocarzinostatin naphthoate synthase Streptomyces carzinostaticus
G3XNF4 2.51e-15 84 27 7 313 1 ATPKS PKS-NRPS hybrid synthetase ATPKS Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
Q5W262 2.52e-15 84 30 11 254 1 pigJ Beta-ketoacyl synthase PigJ Serratia sp. (strain ATCC 39006)
Q5AUX1 2.63e-15 84 25 12 314 1 orsA Orsellinic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O31782 2.81e-15 84 31 5 234 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 4.04e-15 84 29 7 293 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 1.56e-14 82 26 7 275 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
Q4W944 2.85e-15 84 26 8 299 1 encA Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9ZGI4 3.14e-15 84 29 5 239 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q9ZGI4 2.26e-14 81 27 10 321 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q9ZGI4 5.74e-06 54 20 4 217 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q9ZGI4 0.000103 50 22 7 263 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
A0A1E1FFN8 3.15e-15 84 27 9 272 3 prhL Non-reducing polyketide synthase prhL Penicillium brasilianum
B2HIL7 3.31e-15 84 27 9 314 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium marinum (strain ATCC BAA-535 / M)
Q54FD2 3.58e-15 84 26 8 289 3 pks38 Probable polyketide synthase 38 Dictyostelium discoideum
Q54FN2 3.73e-15 84 26 8 292 3 pks34 Probable polyketide synthase 34 Dictyostelium discoideum
Q54FN2 0.000817 47 21 7 293 3 pks34 Probable polyketide synthase 34 Dictyostelium discoideum
M2XHZ5 4.41e-15 84 25 8 268 2 pksA Norsolorinic acid synthase Dothistroma septosporum (strain NZE10 / CBS 128990)
Q30DW5 4.41e-15 84 25 8 268 2 pksA Norsolorinic acid synthase Dothistroma septosporum
B8N8R0 4.42e-15 84 27 9 285 2 afvB Non-reducing polyketide synthase afvB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8N8R0 1.11e-05 53 24 7 304 2 afvB Non-reducing polyketide synthase afvB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q0CRQ5 4.7e-15 84 26 10 349 1 ATEG_03629 5-methylorsellinic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A3T0ZHJ0 5.33e-15 83 26 6 257 1 cle1 Triacetic acid lactone synthase cle1 Aspergillus versicolor
Q7TXL7 5.43e-15 83 25 7 338 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B8MKY6 5.47e-15 83 25 6 275 1 tstA Highly reducing polyketide synthase tstA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
P9WQE3 5.48e-15 83 25 7 338 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit D Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE2 5.48e-15 83 25 7 338 3 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q54B51 6.31e-15 83 25 12 367 3 pks44 Probable polyketide synthase 44 Dictyostelium discoideum
I1RL11 6.68e-15 83 24 11 354 1 dpfgA Non-reducing polyketide synthase dpfgA Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9Y7D5 7.46e-15 83 25 6 271 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus
Q54FQ1 7.96e-15 83 26 8 290 3 pks31 Probable polyketide synthase 31 Dictyostelium discoideum
Q54FQ1 0.000131 49 22 9 301 3 pks31 Probable polyketide synthase 31 Dictyostelium discoideum
O53901 8.07e-15 83 28 7 280 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q05357 9.69e-15 80 26 2 225 3 sch2 Putative polyketide beta-ketoacyl synthase 2 Streptomyces halstedii
Q05357 3.65e-07 57 23 6 198 3 sch2 Putative polyketide beta-ketoacyl synthase 2 Streptomyces halstedii
Q55CN6 1.01e-14 82 26 9 292 3 pks3 Probable polyketide synthase 3 Dictyostelium discoideum
Q55CN6 5.08e-05 51 23 4 220 3 pks3 Probable polyketide synthase 3 Dictyostelium discoideum
Q9ZGI5 1.02e-14 82 27 5 244 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 1.7e-13 79 26 6 290 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 1.12e-11 73 29 7 232 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 0.000566 47 22 6 258 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q54FP8 1.06e-14 82 25 8 310 3 pks32 Probable polyketide synthase 32 Dictyostelium discoideum
P9WET8 1.07e-14 82 23 6 283 2 Preu1 Highly reducing polyketide synthase Preu1 Preussia isomera
P9WQE1 1.14e-14 82 23 11 363 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE0 1.14e-14 82 23 11 363 3 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TXL6 1.19e-14 82 23 11 363 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q2T4N2 1.19e-14 82 28 6 244 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N2 4.92e-14 80 26 2 250 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N2 3.07e-05 52 20 6 262 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
E9ET39 1.21e-14 82 25 7 301 2 Pks2 Polyketide synthase 2 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
Q03132 1.41e-14 82 25 3 229 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
Q03132 2.7e-13 78 25 6 281 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
A0A1B4XBH3 1.58e-14 82 24 6 289 3 sdnO Highly reducing polyketide synthase sdnO Sordaria araneosa
Q0CZH1 1.74e-14 81 23 6 293 2 pytA Hybrid PKS-NRPS synthetase pytA (Fragment) Aspergillus terreus (strain NIH 2624 / FGSC A1156)
S0DZM7 1.87e-14 82 29 4 206 1 bik1 Bikaverin polyketide synthase bik1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DZM7 5.84e-05 50 23 9 314 1 bik1 Bikaverin polyketide synthase bik1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A1Y0BRF1 1.91e-14 82 23 5 282 3 adrD Non-reducing polyketide synthase adrD Penicillium roqueforti
Q8J0F5 1.92e-14 82 23 8 354 1 mlcB Compactin diketide synthase mlcB Penicillium citrinum
A0R1E8 2.09e-14 81 25 7 326 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WEZ4 2.23e-14 81 23 6 296 2 pytA Hybrid PKS-NRPS synthetase pytA Aspergillus terreus
A0A4P8GHJ1 2.58e-14 81 28 8 273 1 eupA 3-methylorcinaldehyde synthase Phoma sp.
P9WET2 2.6e-14 81 29 11 284 1 Preu6 Non-reducing polyketide synthase Preu6 Preussia isomera
A0A1B3PEI8 3.32e-14 81 22 21 575 1 ORF-B Polyunsaturated fatty acid synthase subunit B Thraustochytrium sp. (strain ATCC 26185 / S-3)
Q05470 3.9e-14 80 22 3 278 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 5.61e-14 80 29 5 235 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 8.79e-14 79 25 4 285 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 6.72e-12 73 26 8 301 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 0.000675 47 23 4 178 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q5BEJ4 4.04e-14 80 24 6 288 1 afoG Asperfuranone polyketide synthase afoG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0B4H8J1 4.36e-14 80 25 7 301 2 Pks2 Polyketide synthase 2 Metarhizium brunneum (strain ARSEF 3297)
Q54B49 4.48e-14 80 25 12 364 3 pks45 Probable polyketide synthase 45 Dictyostelium discoideum
P9WET3 4.95e-14 80 28 10 274 1 Preu8 Non-reducing polyketide synthase Preu8 Preussia isomera
Q558W4 5.02e-14 80 28 10 305 3 pks15 Probable polyketide synthase 15 Dictyostelium discoideum
Q558W4 0.000163 49 25 5 183 3 pks15 Probable polyketide synthase 15 Dictyostelium discoideum
A0A348HAX6 5.09e-14 80 26 7 264 1 phiA Highly reducing polyketide synthase phiA Fungal sp. (strain ATCC 74256)
N4WHE3 6.28e-14 80 25 11 308 3 PKS1 Reducing polyketide synthase PKS1 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
Q5BG07 6.7e-14 80 29 10 274 1 pkdA Non-reducing polyketide synthase pkdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0B4FLB2 7.19e-14 80 25 7 301 2 Pks2 Polyketide synthase 2 Metarhizium anisopliae (strain ARSEF 549)
B1GVX7 7.41e-14 80 26 13 364 2 BOA6 Reducing polyketide synthase BOA6 Botryotinia fuckeliana (strain B05.10)
A0A0R8YWJ7 8.04e-14 80 28 8 269 1 mpas Methylphloroacetophenone synthase Cladonia uncialis
A0A2I1BSV9 8.59e-14 79 21 17 503 1 nvfA Non-reducing polyketide synthase nvfA Aspergillus novofumigatus (strain IBT 16806)
Q9ZGI2 1.04e-13 79 24 8 305 1 pikAIV Narbonolide/10-deoxymethynolide synthase PikA4, module 6 Streptomyces venezuelae
Q9ZGI2 0.000159 49 23 4 177 1 pikAIV Narbonolide/10-deoxymethynolide synthase PikA4, module 6 Streptomyces venezuelae
B8MV60 1.17e-13 79 27 9 273 3 tpeB Non-reducing polyketide synthase tpeB Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
P9WET5 1.18e-13 79 25 10 304 1 Preu4 Non-reducing polyketide synthase Preu4 Preussia isomera
A0A0S2CHA9 1.52e-13 79 23 16 436 1 pigA Non-reducing polyketide synthase pigA Monascus ruber
P9WET9 1.68e-13 79 25 8 300 1 PvBS090_009107 Non-reducing polyketide synthase PvBS090_009107 Byssochlamys spectabilis
Q03149 1.71e-13 79 25 8 315 1 wA Conidial yellow pigment biosynthesis polyketide synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B3FWU0 1.86e-13 78 23 6 305 1 rdc5 Reducing polyketide synthase rdc5 Metacordyceps chlamydosporia
Q02251 1.97e-13 78 25 6 299 1 mas Mycocerosic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A2V5GX43 2.31e-13 78 21 7 328 3 pyvA Hybrid PKS-NRPS synthetase pyvA Aspergillus violaceofuscus (strain CBS 115571)
P40806 2.55e-13 78 24 6 277 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 2.62e-13 78 22 7 358 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 2.58e-12 75 29 4 229 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
A0A6F9DYX9 2.58e-13 78 27 8 239 1 men2 Non-reducing polyketide synthase men2 Menisporopsis theobromae
A0A1L7U3D7 2.67e-13 78 25 5 252 2 FPY1 Highly reducing polyketide synthase 40 Fusarium mangiferae
A0A0S6XH49 2.74e-13 78 23 6 342 1 frbB Highly reducing polyketide synthase frbB Fungal sp. (strain No.11243)
A0A0S6XH49 4.81e-07 57 26 10 297 1 frbB Highly reducing polyketide synthase frbB Fungal sp. (strain No.11243)
S3D9F1 3.37e-13 77 25 3 236 1 gloL Highly reducing polyketide synthase gloL Glarea lozoyensis (strain ATCC 20868 / MF5171)
P49327 3.4e-13 77 23 9 318 1 FASN Fatty acid synthase Homo sapiens
O31784 3.43e-13 77 24 7 312 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
O31784 1.06e-08 63 24 9 295 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
Q7TXL9 3.53e-13 77 24 6 328 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQE5 3.65e-13 77 24 6 328 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE4 3.65e-13 77 24 6 328 3 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7SHI6 3.86e-13 77 25 7 286 2 srdA Highly reducing polyketide synthase srdA Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A0A0M4L8I7 3.95e-13 77 24 14 437 1 aurA Highly reducing polyketide synthase aurA Calcarisporium arbuscula
A0A0U5GK88 4.31e-13 77 24 9 353 1 ausV Highly reducing polyketide synthase ausV Aspergillus calidoustus
A0A0B4I1L1 4.54e-13 77 24 6 301 2 Pks2 Polyketide synthase 2 Metarhizium guizhouense (strain ARSEF 977)
A0A0N9HNS9 4.89e-13 77 24 6 285 3 desS Desertorin synthase Aspergillus desertorum
Q5KTM9 5.2e-13 77 25 4 240 1 alt5 Highly reducing polyketide synthase alt5 Alternaria solani
A0A7R7ZK98 5.31e-13 77 22 8 327 3 AcPKS Atrochrysone carboxylic acid synthase Aspergillus chevalieri
Q4WKW9 6.13e-13 77 24 5 274 1 fgnA Fumigermin synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A0D1DNX1 6.66e-13 77 23 8 313 2 fas2 Fatty acid synthase 2 Ustilago maydis (strain 521 / FGSC 9021)
Q12397 6.73e-13 77 24 6 272 2 stcA Norsolorinic acid synthase stcA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
E9EHG2 7.28e-13 76 24 7 301 2 Pks2 Polyketide synthase 2 Metarhizium acridum (strain CQMa 102)
Q86ZD9 7.58e-13 76 23 7 309 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain C2932)
A0A9P5GG56 7.85e-13 76 27 7 269 1 xilA Highly reducing polyketide synthase xilA Penicillium crustosum
P12276 8.49e-13 76 25 12 337 1 FASN Fatty acid synthase Gallus gallus
A0A1L9UCG2 9.09e-13 76 24 7 316 3 albA Non-reducing polyketide synthase albA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1B7YCC9 9.3e-13 76 24 11 352 1 dpchA Non-reducing polyketide synthase dpchA Colletotrichum higginsianum (strain IMI 349063)
F9XMW3 9.92e-13 76 29 8 238 3 PKS1 Non-reducing polyketide synthase PKS1 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q0D1N9 1.01e-12 76 25 10 327 1 terA Non-reducing polyketide synthase terA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A2QUI2 1.04e-12 76 23 7 316 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P96202 1.04e-12 76 28 3 223 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7TXL8 1.04e-12 76 28 3 223 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B8M9J9 1.1e-12 76 25 7 288 1 tropA 3-methylorcinaldehyde synthase tropA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
Q9ZGI3 1.16e-12 75 24 10 321 1 pikAIII Narbonolide/10-deoxymethynolide synthase PikA3, module 5 Streptomyces venezuelae
Q9ZGI3 1.52e-05 52 21 6 214 1 pikAIII Narbonolide/10-deoxymethynolide synthase PikA3, module 5 Streptomyces venezuelae
Q02579 1.17e-12 74 25 5 262 3 curB Putative polyketide beta-ketoacyl synthase 2 Streptomyces cyaneus
Q02579 2.19e-07 57 23 7 238 3 curB Putative polyketide beta-ketoacyl synthase 2 Streptomyces cyaneus
Q6DQW3 1.38e-12 75 23 13 443 1 CTB1 Non-reducing polyketide synthase CTB1 Cercospora nicotianae
A0A0B4I1J8 1.46e-12 75 24 7 301 2 Pks2 Polyketide synthase 2 Metarhizium majus (strain ARSEF 297)
G3XLL5 1.6e-12 75 23 7 316 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A0A161CEU9 1.61e-12 75 22 13 440 1 citS Citrinin polyketide synthase Monascus ruber
Q65Z23 1.61e-12 75 22 13 440 1 pksCT Citrinin polyketide synthase Monascus purpureus
Q3S2U6 1.73e-12 75 21 8 361 1 mokB Lovastatin diketide synthase mokB Monascus pilosus
P23156 1.81e-12 73 26 3 193 3 SCO5317 Putative polyketide beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P23156 4.11e-05 50 24 3 153 3 SCO5317 Putative polyketide beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B6H999 1.82e-12 75 25 7 282 1 xilA Highly reducing polyketide synthase xilA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
G3XMD1 2.09e-12 75 23 12 361 1 azaB Highly reducing polyketide synthase azaB Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A0A0U5GFS8 2.13e-12 75 26 9 270 1 ausA Non-reducing polyketide synthase ausA Aspergillus calidoustus
I1RLA7 2.32e-12 75 26 5 232 2 FGR1 Highly reducing polyketide synthase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q2HBN0 2.43e-12 75 26 12 306 1 cghG Hybrid PKS-NRPS synthetase cghG Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A8F4S8Q3 2.62e-12 75 25 10 296 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
Q5AZ32 2.81e-12 74 29 5 217 1 pkbA Non-reducing polyketide synthase pkbA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0JJU1 3.17e-12 74 25 9 352 1 tenS Tenellin synthetase Beauveria bassiana
A0A2G5IC96 3.77e-12 74 22 13 443 3 CTB1 Non-reducing polyketide synthase CTB1 Cercospora beticola
Q5BH30 3.96e-12 74 22 7 322 3 mdpG Atrochrysone carboxylic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUX7 4.1e-12 74 27 8 272 1 dbaI Non-reducing polyketide synthase dbaI Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A5PHD6 5.18e-12 73 27 10 292 1 aspks1 3-methylorcinaldehyde synthase Sarocladium schorii
A0A084B9Z6 5.8e-12 73 25 8 280 3 SAT8 Non-reducing polyketide synthase SAT8 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
P9WES9 6.66e-12 73 27 5 201 1 PFUR17_0229 Non-reducing polyketide synthase PFUR17_0229 Pseudevernia furfuracea
A0A6S5ZY48 7.01e-12 73 24 8 286 2 g433 Highly reducing polyketide synthase g433 Fusarium sp.
A0A6S5ZY48 0.000229 48 23 13 384 2 g433 Highly reducing polyketide synthase g433 Fusarium sp.
Q9HU15 7.27e-12 72 23 11 351 1 fabY Beta-ketoacyl-[acyl-carrier-protein] synthase FabY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A443HK66 7.3e-12 73 26 3 243 3 VdtX Highly reducing polyketide synthase VdtX Byssochlamys spectabilis
A0A0B4H4F0 7.65e-12 73 23 12 368 1 Pks1 Polyketide synthase 1 Metarhizium majus (strain ARSEF 297)
A0A0Y0M151 8.03e-12 73 24 8 282 1 cla2 Highly reducing polyketide synthase cla2 Cladosporium cladosporioides
A0A0C6E0I7 8.32e-12 73 23 11 408 1 bet1 Highly reducing polyketide synthase bet1 Neocamarosporium betae
A0A142C799 8.64e-12 73 25 7 267 1 phnA Non-reducing polyketide synthase phnA Penicillium herquei
S0DTP6 9.71e-12 73 21 19 590 2 FSR1 Non-reducing polyketide synthase fsr1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A6H0YV38 1.01e-11 73 26 4 205 2 crz7 Non-reducing polyketide synthase crz7 Cladonia metacorallifera
Q71SP7 1.08e-11 72 23 9 318 1 FASN Fatty acid synthase Bos taurus
A0A0A2KT65 1.15e-11 72 24 6 302 2 melA Conidial yellow pigment biosynthesis polyketide synthase melA Penicillium expansum
D7PHZ2 1.33e-11 72 24 5 269 1 vrtA Non-reducing polyketide synthase vrtA Penicillium aethiopicum
G4NEB1 1.4e-11 72 27 8 239 1 NEC1 Highly reducing polyketide synthase NEC1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A0A455M2Y3 1.47e-11 72 22 5 284 2 ntnH Highly reducing polyketide synthase ntnH Nectria sp.
Q4WZA8 1.47e-11 72 24 8 302 1 alb1 Conidial pigment polyketide synthase alb1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
J4KMC1 1.48e-11 72 24 7 309 1 tenS Tenellin synthetase Beauveria bassiana (strain ARSEF 2860)
A7UMW1 1.49e-11 72 25 9 297 2 PKS1 Non-reducing polyketide synthase 1 Elsinoe fawcettii
A0A0B4G9F9 1.55e-11 72 23 11 368 1 Pks1 Polyketide synthase 1 Metarhizium guizhouense (strain ARSEF 977)
B3FWT6 1.66e-11 72 28 9 219 1 rdc1 Non-reducing polyketide synthase rdc1 Metacordyceps chlamydosporia
D7UQ44 2.07e-11 72 27 7 276 1 sol1 Prosolanapyrone synthase Alternaria solani
A0A0B4FTU6 2.15e-11 72 22 10 375 1 Pks1 Polyketide synthase 1 Metarhizium anisopliae (strain ARSEF 549)
Q5B7U4 2.16e-11 72 26 8 272 1 pkiA Non-reducing polyketide synthase pkiA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
G4N296 2.27e-11 72 23 9 316 2 PKS19 Highly reducing polyketide synthase 19 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
R4WH05 2.36e-11 72 23 17 428 3 ACRTS2 Highly reducing polyketide synthase ACRTS2 Alternaria alternata
A0A125R003 2.49e-11 71 30 8 190 1 cla3 Non-reducing polyketide synthase cla3 Cladosporium cladosporioides
P0CU67 2.69e-11 71 23 4 239 1 claG Atrochrysone carboxylic acid synthase Passalora fulva
A0A5C1RD96 2.72e-11 71 23 7 301 3 pksAC Non-reducing polyketide synthase AC Didymella fabae
A0A5C1RD96 0.000436 48 21 9 273 3 pksAC Non-reducing polyketide synthase AC Didymella fabae
A0A481WQB6 2.9e-11 71 26 6 268 1 claF Clavatol synthase claF Penicillium crustosum
E9KMQ2 3.45e-11 71 23 6 299 2 PKS16 Non-reducing polyketide synthase PKS16 Cladonia grayi
A0A481WR96 3.57e-11 71 22 6 281 3 claI Highly reducing polyketide synthase claI Penicillium crustosum
A0A482N9V7 3.62e-11 71 23 5 274 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
A0A482N9V7 0.000504 47 26 9 230 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
P19096 4.09e-11 71 23 12 354 1 Fasn Fatty acid synthase Mus musculus
Q2HEW5 4.41e-11 70 25 9 275 2 cheA PKS-NRPS hybrid synthetase cheA Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A443HK81 5.29e-11 70 26 7 267 1 VdtA Non-reducing polyketide synthase VdtA Byssochlamys spectabilis
A0A0B4ESU9 6.11e-11 70 22 9 358 1 Pks1 Polyketide synthase 1 Metarhizium brunneum (strain ARSEF 3297)
G0REX6 6.52e-11 70 24 8 341 1 iliA Hybrid PKS-NRPS synthetase iliA Hypocrea jecorina (strain QM6a)
D2E9X0 6.93e-11 70 24 11 359 2 DEP5 Reducing polyketide synthase DEP5 Alternaria brassicicola
A0A0K0MCJ4 7.11e-11 70 26 8 283 1 cazM Iterative polyketide synthase CazM Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A3G9H990 7.14e-11 70 22 12 383 1 ALT1 Highly reducing polyketide synthase ALT1 Alternaria alternata
Q0CF73 7.29e-11 70 26 6 266 1 ATEG_07661 Non-reducing polyketide synthase ATEG_07661 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
G3JUI8 7.7e-11 70 24 12 364 1 milA Highly reducing polyketide synthase milA Cordyceps militaris (strain CM01)
Q5ATG8 7.75e-11 70 23 9 289 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5ATG8 0.000821 47 23 13 347 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
E9F646 8.51e-11 70 22 10 375 1 Pks1 Polyketide synthase 1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A0H4ADX3 8.8e-11 70 26 9 250 2 None Non-reducing polyketide synthase PKS19 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q5B8A0 9.29e-11 69 26 8 268 1 pkfA Non-reducing polyketide synthase pkfA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
E5AE40 1.13e-10 69 24 9 301 2 PKS2 Highly reducing polyketide synthase PKS2 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
Q4WAZ9 1.28e-10 69 22 11 367 2 NRPS14 PKS-NRPS hybrid synthetase psoA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A167LUQ4 1.34e-10 69 24 11 358 3 fumoS Fumosorinone synthetase Cordyceps fumosorosea (strain ARSEF 2679)
E5A7D9 1.38e-10 69 23 9 298 2 pks5 Highly reducing polyketide synthase pks5 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
L7XAV2 1.43e-10 69 24 4 208 1 curS2 Non-reducing polyketide synthase curS2 Aspergillus terreus
B8MYS6 1.45e-10 69 25 5 240 1 pks27 Non-reducing polyketide synthase pks27 Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
C8VJR7 1.52e-10 69 25 7 269 1 alnA Highly reducing polyketide synthase alnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
S0EMV0 1.54e-10 69 23 7 276 1 GPY1 Highly reducing polyketide synthase GPY1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
I1RF58 1.81e-10 68 27 5 209 1 PKS12 Non-reducing polyketide synthase PKS12 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q4WQZ5 1.83e-10 68 24 6 262 2 tpcC Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
W3X8X8 1.84e-10 68 23 4 272 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
W3X8X8 6.6e-07 57 25 5 213 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
Q54FI3 1.84e-10 68 28 7 229 1 StlB Polyketide synthase 37 Dictyostelium discoideum
Q54FI3 0.001 47 25 10 263 1 StlB Polyketide synthase 37 Dictyostelium discoideum
A0A481WNP4 1.85e-10 68 25 9 288 3 traA Hybrid PKS-NRPS synthetase traA Penicillium crustosum
A2QTE9 1.87e-10 68 26 10 273 3 epaA Non-reducing polyketide synthase epaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A179H2I8 2.08e-10 68 26 5 188 2 lcsB Highly reducing polyketide synthase lcsB Purpureocillium lilacinum
A0A1P8NTI3 2.27e-10 68 26 8 268 2 pks8 Non-reducing polyketide synthase 8 Pestalotiopsis microspora
C5H882 2.33e-10 68 28 8 187 3 radS2 Non-reducing polyketide synthase rads2 Floropilus chiversii
A0A1L9WLD9 2.68e-10 68 23 6 300 1 AacuL Atrochrysone carboxylic acid synthase AacuL Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A2I2F2N6 2.69e-10 68 25 6 274 1 cfoA Chalcone synthase cfoA Aspergillus candidus
A0A2I2F2N6 0.000297 48 24 3 168 1 cfoA Chalcone synthase cfoA Aspergillus candidus
A0A411L027 3.06e-10 68 22 10 374 3 buaA Hybrid PKS-NRPS synthetase buaA Petromyces alliaceus
A0A068ABB7 3.38e-10 68 25 7 286 1 Bref-PKS Highly reducing polyketide synthase Eupenicillium brefeldianum
G9N4B2 3.41e-10 68 25 6 281 1 virA Highly reducing polyketide synthase virA Hypocrea virens (strain Gv29-8 / FGSC 10586)
G3XMC4 3.42e-10 68 26 10 273 1 azaA Non-reducing polyketide synthase azaA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A0A1L9WQM9 3.57e-10 68 24 11 342 2 acrA Highly reducing polyketide synthase acrA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
W7MT31 3.59e-10 68 24 6 307 1 FUB1 Reducing polyketide synthase FUB1 Gibberella moniliformis (strain M3125 / FGSC 7600)
P0DUT7 3.63e-10 68 22 9 291 1 Ba17a Highly reducing polyketide synthase 17 Metarhizium anisopliae
P9WES1 3.91e-10 67 24 11 351 1 None Atrochrysone carboxylic acid synthase PKS1 Calonarius odorifer
Q0CSA2 4.01e-10 67 25 7 254 1 tazA Non-reducing polyketide synthase tazA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
B6QK76 4.04e-10 67 25 8 277 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
B6QK76 0.000637 47 22 9 277 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN5 4.04e-10 67 25 8 277 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei
D7RJN5 0.000637 47 22 9 277 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei
Q2ABP6 4.67e-10 67 24 6 280 1 pksF Reducing polyketide synthase pksF Alternaria solani
P0DO30 5.12e-10 67 23 7 306 1 iliA Hybrid PKS-NRPS synthetase iliA Neonectria sp. (strain DH2)
Q0CCY3 5.37e-10 67 25 7 235 1 gedC Atrochrysone carboxylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P12785 6.05e-10 67 22 9 318 1 Fasn Fatty acid synthase Rattus norvegicus
Q5BBP8 6.6e-10 67 25 7 271 1 pkhA Non-reducing polyketide synthase pkhA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A411PQP9 6.61e-10 67 22 6 305 3 Agnpks1 Atrochrysone carboxylic acid synthase Agnpks1 Paecilomyces divaricatus
A0A0N0DCA3 6.71e-10 67 24 10 355 2 DEP5 Reducing polyketide synthase DEP5 Fusarium langsethiae
A0A1R3RGK0 6.77e-10 67 25 10 268 1 otaA Highly reducing polyketide synthase otaA Aspergillus carbonarius (strain ITEM 5010)
A0A2L0P0K3 6.95e-10 67 23 8 345 1 TwmB Polyketide synthase-nonribosomal peptide synthetase TwmB Talaromyces wortmannii
P9WEQ0 7.78e-10 67 25 9 268 3 olcA Non-reducing polyketide synthase olcA Penicillium canescens
A0A2U8NEV6 8.54e-10 66 22 8 306 1 Pks1 Polyketide synthase 1 Metarhizium acridum (strain CQMa 102)
I1S166 8.55e-10 66 24 8 297 2 FSL1 Fusarielin synthase FSL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
W7LKX1 8.6e-10 66 20 10 346 2 FUM1 Highly reducing polyketide synthase FUM1 Gibberella moniliformis (strain M3125 / FGSC 7600)
W3X7U2 8.99e-10 66 31 8 165 2 PfmaE Conidial pigment polyketide synthase PfmaE Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
A0A3G1DJH7 9.06e-10 66 22 8 294 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A0A6F8RNP4 1.05e-09 66 23 8 289 1 grgA Reducing polyketide synthase grgA Penicillium sp.
A0A1W7M1U5 1.07e-09 66 21 14 456 1 pgmA Non-reducing polyketide synthase pgmA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
G3Y419 1.1e-09 66 24 6 301 1 yanA 6-methylsalicylic acid synthase Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3Y419 1.73e-05 52 22 11 345 1 yanA 6-methylsalicylic acid synthase Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A0A8F4S6Z6 1.13e-09 66 22 7 284 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
G0LET7 1.26e-09 66 27 5 199 2 BOA9 Reducing polyketide synthase BOA9 Botryotinia fuckeliana (strain B05.10)
P9WES2 1.29e-09 66 24 11 351 1 None Atrochrysone carboxylic acid synthase PKS4 Calonarius odorifer
Q5B0D0 1.32e-09 66 23 8 301 1 aptA Non-reducing polyketide synthase aptA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P0DUK1 1.41e-09 65 26 4 187 3 pspA Highly reducing polyketide synthase pspA Penicillium soppii
Q5BA83 1.49e-09 65 24 8 266 3 easB Highly reducing polyketide synthase easB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
G2Q9A5 1.55e-09 65 22 8 332 1 mycA Hybrid PKS-NRPS synthetase mycA Thermothelomyces thermophilus (strain ATCC 42464 / BCRC 31852 / DSM 1799)
P0CU84 1.61e-09 65 25 8 285 1 apmlA Highly reducing polyketide synthase apmlA Arthrinium phaeospermum
A0A0A0RM07 1.62e-09 65 24 12 378 1 MLNS Mellein synthase Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
B8MV59 1.69e-09 65 22 6 271 3 tpeA Partially reducing polyketide synthase tpeA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A0N7D745 1.9e-09 65 28 7 187 2 Dhc5 Non-reducing polyketide synthase Dhc5 Alternaria cinerariae
Q2T4P1 2.16e-09 65 26 6 230 3 thaQ Polyketide synthase ThaQ Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
G1XU04 2.25e-09 65 23 7 333 1 AOL_s00215g283 6-methylsalicylic acid synthase AOL_s00215g283 Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491)
Q0CS88 2.4e-09 65 24 8 306 2 tazB Highly reducing polyketide synthase tazB Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A2P1DP91 2.86e-09 65 24 7 302 1 macA 6-methylsalicylic acid synthase Penicillium terrestre
A0A2P1DP91 0.000557 47 20 12 391 1 macA 6-methylsalicylic acid synthase Penicillium terrestre
D7PI15 2.86e-09 65 25 7 244 1 gsfA Non-reducing polyketide synthase gsfA Penicillium aethiopicum
Q0UI00 2.92e-09 65 27 6 213 1 elcA Non-reducing polyketide synthase elcA (Fragment) Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A067XNI2 3e-09 65 24 3 209 2 ptaA Non-reducing polyketide synthase ptaA Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
Q4WA61 3.2e-09 64 22 17 396 3 nscA Non-reducing polyketide synthase nscA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A3T0QHT6 3.74e-09 64 25 10 295 1 pvhA Hybrid PKS-NRPS synthetase pvhA Talaromyces variabilis
A0A0A2JW91 3.94e-09 64 23 9 279 1 cnsI Highly reducing polyketide synthase cnsI Penicillium expansum
B8NYX0 4e-09 64 25 6 302 2 fluP Cluster 41 polyketide synthase Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
C5H885 4.73e-09 64 21 9 325 3 rads1 Reducing polyketide synthase rads1 Floropilus chiversii
A0A0D2YG10 4.84e-09 64 23 6 311 1 FUB1 Reducing polyketide synthase FUB1 Fusarium oxysporum f. sp. lycopersici (strain 4287 / CBS 123668 / FGSC 9935 / NRRL 34936)
A0A2U8NET4 5.03e-09 64 22 7 304 1 Pks1 Polyketide synthase 1 Metarhizium album (strain ARSEF 1941)
P41176 5.83e-09 62 25 8 268 3 None Putative polyketide beta-ketoacyl synthase 2 Streptomyces virginiae
P41176 1.72e-08 61 25 4 167 3 None Putative polyketide beta-ketoacyl synthase 2 Streptomyces virginiae
A2R6H1 5.97e-09 63 24 7 265 2 otaA Highly reducing polyketide synthase otaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A179H0J7 7e-09 63 26 5 225 2 lcsC Highly reducing polyketide synthase lcsC Purpureocillium lilacinum
A0A6F9DXA0 7.09e-09 63 24 3 192 1 men1 Partially reducing polyketide synthase men1 Menisporopsis theobromae
Q0UK48 7.16e-09 63 23 10 355 1 sthA Highly reducing polyketide synthase sthA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A017SEX7 7.98e-09 63 24 9 298 1 fogA Highly reducing polyketide synthase fogA Aspergillus ruber (strain CBS 135680)
A0A4P8DJV2 8.12e-09 63 23 6 322 3 dmxL2 Highly reducing polyketide synthase dmxL2 Cryptosporiopsis sp. (strain 8999)
Q5SBL6 8.29e-09 63 23 7 291 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
A0A7L9EYL1 9.02e-09 63 22 7 287 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
A0A0N7D4P6 9.69e-09 63 22 10 352 2 Dhc3 Highly reducing polyketide synthase Dhc3 Alternaria cinerariae
A2QX22 1.12e-08 63 25 3 204 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P9WET0 1.13e-08 63 27 5 192 1 Preu9 Polyketide synthase-like protein Preu9 Preussia isomera
S0DRI1 1.23e-08 62 23 4 264 1 FUB1 Reducing polyketide synthase FUB1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
B6F209 1.26e-08 63 22 11 350 1 cpaA Cyclo-acetoacetyl-L-tryptophan synthase Aspergillus oryzae
P36189 1.27e-08 61 27 5 199 1 FASN Fatty acid synthase (Fragment) Anser anser anser
G3KLH6 1.33e-08 62 25 3 204 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger
A0A345BJP0 1.5e-08 62 21 8 291 3 clz2 Squalestatin tetraketide synthase clz2 Cochliobolus lunatus
Q4WLD4 1.64e-08 62 24 11 314 1 pyr2 Non-reducing polyketide synthase pyr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q0CJ59 1.72e-08 62 24 4 301 1 atX 6-methylsalicylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
M3A326 1.75e-08 62 22 8 328 2 PKS8-1 Non-reducing polyketide synthase PKS8-1 Pseudocercospora fijiensis (strain CIRAD86)
A0A089QRB9 1.97e-08 62 25 3 233 1 msl3 Mycolipanoate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
D9N1A1 2.05e-08 62 22 10 345 2 ACTTS3 Highly reducing polyketide synthase ACTTS3 Alternaria alternata
D9N1A1 0.000257 48 22 12 345 2 ACTTS3 Highly reducing polyketide synthase ACTTS3 Alternaria alternata
B3FWS8 2.2e-08 62 22 8 247 1 hpm3 Non-reducing polyketide synthase hmp3 Hypomyces subiculosus
Q2UB00 2.26e-08 62 22 6 272 3 ppsB Reducing polyketide synthase ppsB Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A0A1V6NYI6 2.46e-08 62 25 9 305 3 verA Highly reducing polyketide synthase verA Penicillium polonicum
F2S6Z9 2.67e-08 61 25 6 179 3 nscA Non-reducing polyketide synthase nscA Trichophyton tonsurans (strain CBS 112818)
A0A075TRC0 2.85e-08 61 24 5 300 1 patK 6-methylsalicylic acid synthase Penicillium expansum
G4MVZ2 2.87e-08 62 23 14 325 1 ACE1 Polyketide synthase-nonribosomal peptide synthetase ACE1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
M1WG96 3.05e-08 61 24 8 266 2 CPUR_05437 Non-reducing polyketide synthase CPUR_05437 Claviceps purpurea (strain 20.1)
Q5BEJ6 3.12e-08 61 24 7 270 1 afoE Iterative polyketide synthase afoE Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AXA9 3.15e-08 61 24 5 209 1 pkgA Non-reducing polyketide synthase pkgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A411KUP8 3.29e-08 61 23 7 285 1 ucsA Hybrid PKS-NRPS synthetase ucsA Acremonium sp.
Q3S2T9 3.31e-08 61 23 10 314 1 mokA Lovastatin nonaketide synthase mokA Monascus pilosus
P9WET1 3.5e-08 61 21 10 331 1 Preu7 Non-reducing polyketide synthase Preu7 Preussia isomera
A0A2I1C3X5 3.52e-08 61 24 4 215 1 nsrB Atrochrysone carboxylic acid synthase nsrB Aspergillus novofumigatus (strain IBT 16806)
S0EET5 3.65e-08 61 22 7 300 2 PKS19 Polyketide synthase 19 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
F2PWS5 3.9e-08 61 25 6 179 3 nscA Non-reducing polyketide synthase nscA Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2T0M0 4.21e-08 61 25 6 179 3 nscA Non-reducing polyketide synthase nscA Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P9WET4 4.52e-08 61 25 4 192 1 Preu5 Highly reducing polyketide synthase Preu5 Preussia isomera
A0A098D8A0 4.52e-08 61 22 8 357 2 ZEA2 Highly reducing polyketide synthase ZEA2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A089FSA4 4.54e-08 61 24 8 247 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
Q0C8L6 4.58e-08 61 26 4 190 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus (strain NIH 2624 / FGSC A1156)
G3J453 4.83e-08 60 22 5 265 1 cm3B Highly reducing polyketide synthase cm3B Cordyceps militaris (strain CM01)
D4CZZ2 4.92e-08 60 28 4 145 3 nscA Non-reducing polyketide synthase nscA Trichophyton verrucosum (strain HKI 0517)
A0A7L8UVC9 4.98e-08 60 23 12 369 3 ffsA Polyketide synthase-nonribosomal peptide synthetase ffsA Aspergillus flavipes
A1D8I9 5.07e-08 60 26 7 209 3 nscA Non-reducing polyketide synthase nscA Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
P9WQE9 5.47e-08 60 26 3 230 1 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE8 5.47e-08 60 26 3 230 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U9F4 5.47e-08 60 26 3 230 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q7TVK8 5.47e-08 60 26 3 230 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A1KQG0 5.66e-08 60 26 3 230 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
E4V2N2 5.96e-08 60 25 6 179 3 nscA Non-reducing polyketide synthase nscA Arthroderma gypseum (strain ATCC MYA-4604 / CBS 118893)
S7Z800 6.1e-08 60 20 11 382 3 opdA Hybrid PKS-NRPs synthetase opdA Penicillium oxalicum (strain 114-2 / CGMCC 5302)
A0A3G9GQ29 6.57e-08 60 22 6 285 1 cdmE 6-hydroxymellein synthase cdmE Talaromyces verruculosus
Q0C9L7 6.7e-08 60 23 7 272 1 ctvA Highly reducing polyketide synthase ctvA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
D4AWH3 6.83e-08 60 25 6 179 3 nscA Non-reducing polyketide synthase nscA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
A0A1L7U4V5 7.23e-08 60 22 7 284 2 FMN1 Reducing polyketide synthase 8 Fusarium mangiferae
C5FM57 7.31e-08 60 28 4 145 3 nscA Non-reducing polyketide synthase nscA Arthroderma otae (strain ATCC MYA-4605 / CBS 113480)
A0A3G9K3K9 1.09e-07 59 22 7 367 1 hisps Hispidin synthase Neonothopanus nambi
A1CLY8 1.15e-07 59 23 10 345 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A0A0F7GFS4 1.41e-07 59 24 7 262 1 tasS Hybrid PKS-NRPS synthetase tasS Hapsidospora irregularis
B3FWT3 1.75e-07 59 22 7 301 1 hpm8 Reducing polyketide synthase hmp8 Hypomyces subiculosus
L7X8J4 2.19e-07 58 23 8 309 1 curS1 Highly reducing polyketide synthase curS1 Aspergillus terreus
Q4WAY3 2.36e-07 58 24 3 195 1 af370 Fumagillin dodecapentaenoate synthase af370 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A067MTM1 2.42e-07 58 26 10 212 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Botryobasidium botryosum (strain FD-172 SS1)
A0A067MTM1 8.52e-05 50 23 11 328 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Botryobasidium botryosum (strain FD-172 SS1)
P9WET7 2.58e-07 58 23 5 207 2 Preu2 Reducing polyketide synthase Preu2 Preussia isomera
N4WHA7 2.69e-07 58 23 10 277 3 PKS2 Reducing polyketide synthase PKS2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
A0A2Z5XAL7 2.77e-07 58 23 12 334 1 phm1 Hybrid PKS-NRPS synthetase phm1 Pyrenochaetopsis sp.
A0A455LLX1 3.35e-07 58 22 7 268 1 atnH Highly reducing polyketide synthase atnH Arthrinium sp.
B8NJG3 3.88e-07 58 22 5 276 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A4P8DJU2 4.05e-07 57 24 3 198 3 dmx-nrPKS Atrochrysone carboxylic acid synthase Cryptosporiopsis sp. (strain 8999)
M2YKT6 4.41e-07 57 23 8 290 2 hps1 Hybrid PKS-NRPS synthetase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
A0A6J4B487 6.23e-07 57 23 10 333 3 LUC5 Hybrid PKS-NRPS synthetase LUC5 Fusarium sp.
S7RK07 6.26e-07 57 25 10 300 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Gloeophyllum trabeum (strain ATCC 11539 / FP-39264 / Madison 617)
S7ZFK6 6.86e-07 57 22 8 286 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
A0A1W5T1U1 7.27e-07 57 22 8 286 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
A0A4P8WAE5 8.05e-07 57 23 13 371 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
A0A284RE13 8.26e-07 57 24 12 379 1 armB Orsellinic acid synthase ArmB Armillaria ostoyae
A0A384XH94 8.46e-07 57 24 3 220 1 stpks1 Highly reducing polyketide synthase stpks1 Strobilurus tenacellus
K2QYX5 8.68e-07 57 23 8 295 1 mpsA Hybrid PKS-NRPS synthetase mpsA Macrophomina phaseolina (strain MS6)
W7MLD7 1.14e-06 56 24 15 362 1 FUS1 Fusarin C synthetase Gibberella moniliformis (strain M3125 / FGSC 7600)
A0A3G1DJF3 1.32e-06 56 23 9 255 2 pks2 Squalestatin hexaketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A0A098D6U0 1.42e-06 56 27 5 143 1 ZEA1 Non-reducing polyketide synthase ZEA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
S0EEY3 1.45e-06 56 23 14 359 1 FUS1 Fusarin C synthetase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q0C8M3 1.65e-06 55 21 7 299 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A0U4ZX08 1.77e-06 55 22 7 267 1 drtA Low-reducing polyketide synthase drtA Aspergillus calidoustus
Q9Y8A5 1.81e-06 55 21 7 299 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus
J4UHQ6 1.89e-06 55 24 10 226 1 OpS1 Orsellinic acid synthase Beauveria bassiana (strain ARSEF 2860)
S0DS59 2.11e-06 55 21 8 293 2 PKS-NRPS1 Trichosetin synthetase PKS-NRPS1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q0D159 2.41e-06 55 21 6 273 2 ATEG_00325 Hybrid PKS-NRPS synthetase ATEG_00325 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A2H3CTK0 3.17e-06 55 26 9 276 1 armB Orsellinic acid synthase armB Armillaria gallica
I3ZNU9 3.7e-06 54 26 9 276 1 armB Orsellinic acid synthase armB Armillaria mellea
Q8J0F7 3.87e-06 54 22 8 299 1 mlcA Compactin nonaketide synthase, polyketide synthase component Penicillium citrinum
G4N137 4e-06 54 24 6 210 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A0A1U8QN18 4.11e-06 54 23 9 328 1 sdgA Highly reducing polyketide synthase sdgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
S4W172 1.03e-05 53 21 7 287 1 eqxS Equisetin synthetase eqxS Fusarium heterosporum
P22367 1.07e-05 53 24 5 301 1 None 6-methylsalicylic acid synthase Penicillium patulum
A0A1L9WN37 1.17e-05 53 23 7 341 1 acuA 6-methylsalicylic acid synthase acuA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
B4XYB8 1.31e-05 53 24 1 129 1 aziB 5-methyl-1-naphthoate synthase Streptomyces sahachiroi
A0A0G0AID6 1.62e-05 52 23 8 285 1 thnA Hybrid PKS-NRPS synthetase thnA Trichoderma harzianum
A0A0E4AZP0 1.7e-05 52 21 7 292 3 fsa1 Hybrid PKS-NRPS synthetase fsa1 Fusarium sp. (strain FN080326)
A0A2Z5TM64 2.82e-05 52 22 9 270 3 himA Polyketide synthase-nonribosomal peptide synthetase hybrid himA Aspergillus japonicus
A0A1B5L6A0 4.5e-05 51 23 6 204 1 UVI_02036160 Non-reducing polyketide synthase ustP Ustilaginoidea virens
A1CFL8 4.79e-05 51 23 6 311 1 patK 6-methylcalicylic acide synthase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
P78615 8.11e-05 50 24 8 253 3 fasA Fatty acid synthase subunit alpha Emericella nidulans
P9WEV0 0.000355 48 22 5 184 3 valA Highly reducing polyketide synthase valA Aspergillus terreus

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14375
Feature type CDS
Gene -
Product beta-ketoacyl-[acyl-carrier-protein] synthase family protein
Location 3188388 - 3190949 (strand: -1)
Length 2562 (nucleotides) / 853 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_98
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF00109 Beta-ketoacyl synthase, N-terminal domain
PF02801 Beta-ketoacyl synthase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0304 Lipid transport and metabolism (I)
Secondary metabolites biosynthesis, transport and catabolism (Q)		 IQ 3-oxoacyl-(acyl-carrier-protein) synthase

Protein Sequence

MNSRRRRVVITGMGVLSSLAKDVPQFKQVLFNRQCNIKPSQRYLKWFKNANASEIEMALDYSDIPQHIARSLDNAALWAYRVCNEALQQANLIDNQSILDNTAMIVGVSSAGTEAFLPLFEQHIDDFSIKKAILSGGFSSCCSSVSSLLGLRGGLELVATACTASPNAIGMGYDYIQNGKNPVVLAVGTEPIYLPTFAGFYALNVMKTTPTSPFSGTPGMSIGEGAGALVLEDYQHAVERGATIYGEIVSYATSCDAYHETSPDPRGNGAVQVMYKALDNAGITPNDIDYINVHGTGTEANDRIETMSMKKVFPNIYHIPLSSTKSYVGHNIGAAGIVEIIACFICLAEDKLPPTLNFTQPRHSCDLNYVPNFFQDKKVKFFMKNNYAFGGNNCSIIASPYITDKTPTEYKAKKVVITGVGAITSIGNNIMEIITAILAGDKTGTLKPIVFASDVQKDIDNLMSVVIKDNDFEQSLGHPYFDLDIDHRLKNNACYHAITDVNPKKTLRYYDPRKAIPSGTYALFALNEALANAGRKIKRDGDNLGFIVGMSKGPQSTVNRYLKSLIPDPQKVRTSEFPGTLMNAVPTFCAITEGIKGYTTTLATGVNAALGALTYGYEIIRQDLQPQVIVGGADEHFSSISLYFQAMSKKVNLTKNATDYQVYSNASAGYIPGEGAGMLFLEDKEYAKQRGAKIYAEIIGYGKANDNTFLEDENITDRVAALCKAIQQALSEAQLSCQDIDIICGTSDGNKENDEVEIRAIRQLFYQAANHVPVVNYNAFFGLVESCAGILAISLVIHMMESNTIIPIPYTKSFIADDIHFVTQPINKQIETALVLGSSEGCNHYAIIIRKPL

Flanking regions ( +/- flanking 50bp)

TTATAGCAAAGATATTTATTAAACATAATAAATATTATATAGGAATTAACATGAATAGTAGACGCCGTCGGGTTGTAATAACCGGAATGGGGGTTTTATCATCTTTAGCTAAAGATGTGCCTCAATTTAAACAGGTTCTTTTTAATAGACAATGTAATATTAAGCCAAGCCAACGCTATTTAAAATGGTTTAAAAATGCCAATGCATCTGAGATTGAGATGGCATTAGATTATTCAGATATACCGCAGCATATCGCTCGATCACTAGACAATGCGGCATTATGGGCATATCGAGTCTGCAATGAGGCATTACAACAAGCAAACTTAATAGATAATCAGTCTATTTTAGATAATACCGCGATGATCGTGGGCGTCTCTTCGGCAGGAACGGAAGCCTTTCTGCCATTATTTGAACAACATATTGATGATTTTTCGATAAAAAAAGCCATTTTATCCGGTGGATTTTCATCATGTTGTTCGAGTGTATCAAGTCTACTTGGCTTACGTGGTGGTCTTGAATTAGTGGCGACGGCCTGTACCGCAAGCCCTAACGCGATAGGTATGGGGTATGATTATATCCAAAATGGCAAAAATCCTGTTGTGCTAGCGGTCGGAACAGAACCCATTTATCTTCCTACCTTTGCGGGTTTTTATGCCCTTAATGTGATGAAAACAACACCAACTTCCCCATTTTCAGGTACTCCTGGTATGTCTATTGGTGAAGGTGCTGGGGCGTTAGTATTAGAAGATTATCAACATGCGGTTGAACGTGGTGCGACAATATATGGTGAAATTGTCTCTTATGCGACATCTTGTGATGCTTACCATGAAACTAGCCCTGATCCTCGAGGAAATGGTGCAGTGCAAGTTATGTATAAAGCACTGGATAATGCGGGTATTACCCCTAATGATATTGATTACATAAATGTGCATGGTACAGGTACTGAAGCAAATGATCGCATTGAAACCATGTCGATGAAAAAAGTGTTTCCTAATATTTATCATATCCCATTAAGTTCAACAAAATCTTATGTTGGTCATAATATTGGTGCTGCGGGTATTGTTGAAATCATCGCGTGTTTTATTTGTTTAGCAGAAGACAAACTTCCCCCTACATTAAATTTCACTCAGCCAAGGCATAGCTGTGATTTAAATTATGTACCGAATTTCTTTCAAGATAAAAAAGTAAAATTTTTTATGAAAAATAATTATGCTTTTGGAGGAAATAACTGCTCTATTATCGCAAGCCCTTATATTACAGATAAAACACCGACGGAATATAAAGCTAAAAAAGTGGTTATTACCGGGGTGGGGGCGATTACGTCTATTGGCAATAATATAATGGAGATAATAACAGCGATTTTGGCAGGAGATAAAACAGGTACATTAAAACCTATTGTATTTGCGAGTGATGTGCAGAAAGATATCGACAACTTGATGTCTGTTGTCATAAAAGATAATGATTTTGAGCAATCGTTAGGACATCCTTATTTTGATCTCGACATTGATCATCGCTTAAAAAATAACGCCTGTTATCATGCTATCACTGACGTTAATCCGAAAAAAACATTACGTTATTATGATCCAAGAAAAGCTATTCCTAGCGGGACTTATGCCTTATTCGCTTTAAATGAAGCACTTGCTAATGCTGGACGCAAAATTAAACGTGATGGTGATAACTTAGGTTTTATTGTTGGAATGTCAAAAGGGCCACAAAGTACCGTTAATCGTTATTTAAAAAGTTTAATTCCTGATCCGCAAAAAGTAAGAACATCAGAATTTCCTGGTACTTTAATGAATGCAGTACCGACATTTTGTGCCATCACAGAGGGAATAAAAGGTTATACCACGACATTGGCAACAGGGGTTAATGCTGCATTAGGAGCGTTAACTTATGGTTATGAAATTATCAGGCAAGATCTACAACCTCAGGTAATTGTCGGAGGGGCAGATGAGCACTTCAGTTCTATTTCACTCTATTTTCAAGCGATGAGTAAGAAAGTTAATCTGACCAAGAATGCGACAGATTATCAGGTTTATTCTAATGCAAGTGCCGGCTATATCCCCGGAGAAGGGGCAGGGATGTTATTTCTTGAAGATAAAGAGTATGCCAAGCAACGAGGCGCTAAAATTTATGCTGAAATTATTGGCTACGGTAAAGCTAATGATAATACTTTTTTAGAAGACGAAAATATTACTGATAGAGTGGCCGCCTTATGTAAGGCTATCCAACAAGCATTATCTGAGGCGCAACTCAGTTGCCAAGATATTGATATTATCTGTGGTACCAGTGATGGTAATAAAGAGAATGATGAAGTTGAAATCCGTGCGATTCGGCAACTATTTTATCAAGCGGCAAATCATGTACCAGTAGTTAATTACAATGCCTTTTTTGGTTTAGTTGAATCATGCGCTGGGATATTGGCGATCTCTTTAGTGATTCATATGATGGAAAGCAACACGATAATACCTATTCCTTATACAAAAAGTTTTATAGCTGATGATATTCATTTTGTTACCCAACCGATTAATAAGCAGATAGAAACTGCTTTAGTTCTTGGTTCATCAGAAGGATGTAACCACTATGCAATTATCATCAGGAAACCGTTATGAAAAATGTTGCGATAAGTGGATGGGAACTTAATTTACCTTCAATAGTAAAT