Homologs in group_3653

Help

3 homologs were identified in 2 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
F4V73_RS12000 F4V73_RS12000 31.6 Morganella psychrotolerans - beta-ketoacyl-[acyl-carrier-protein] synthase family protein
PMI_RS14370 PMI_RS14370 22.3 Proteus mirabilis HI4320 - beta-ketoacyl synthase N-terminal-like domain-containing protein
PMI_RS14375 PMI_RS14375 38.9 Proteus mirabilis HI4320 - beta-ketoacyl-[acyl-carrier-protein] synthase family protein

Distribution of the homologs in the orthogroup group_3653

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3653

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P73283 1.69e-71 233 34 6 410 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q02K94 5.64e-68 224 35 6 407 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
O34340 5.89e-67 221 34 10 414 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Bacillus subtilis (strain 168)
P06230 7.05e-66 218 35 10 415 3 nodE Nodulation protein E Rhizobium meliloti (strain 1021)
P55338 6.46e-65 216 33 6 414 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio harveyi
P06231 4.57e-64 213 35 10 415 3 nodE Nodulation protein E Rhizobium meliloti
Q9KQH9 4.71e-64 214 33 8 416 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P04684 1.9e-63 212 35 11 419 3 nodE Nodulation protein E Rhizobium leguminosarum bv. trifolii
Q83E37 7.64e-63 211 33 7 414 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P72331 1.36e-62 209 35 8 413 3 nodE Nodulation protein E Rhizobium sp. (strain N33)
P52410 1.37e-62 211 33 6 410 1 KAS1 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Arabidopsis thaliana
Q7A6F8 1.53e-61 207 33 8 413 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain N315)
Q99VA6 1.53e-61 207 33 8 413 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
P43710 2.19e-61 206 32 7 408 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8NXE1 3.11e-61 206 33 7 412 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MW2)
Q6GAU2 3.11e-61 206 33 7 412 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MSSA476)
Q5HHA1 3.11e-61 206 33 7 412 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain COL)
P0AAI8 3.95e-61 206 35 9 416 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Shigella flexneri
P0AAI5 3.95e-61 206 35 9 416 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli (strain K12)
P0AAI6 3.95e-61 206 35 9 416 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAI7 3.95e-61 206 35 9 416 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O157:H7
Q6GIA3 7.74e-61 205 33 7 412 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MRSA252)
Q9NWU1 9.29e-61 206 34 8 421 1 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Homo sapiens
P23902 2.34e-59 202 33 8 413 1 KAS12 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Hordeum vulgare
Q9D404 4.77e-59 202 33 8 421 1 Oxsm 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Mus musculus
Q02578 5.02e-59 201 33 13 432 3 curA Putative polyketide beta-ketoacyl synthase 1 Streptomyces cyaneus
Q5TKS0 1.52e-58 199 33 7 405 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 (Fragment) Staphylococcus aureus
O94297 1.89e-58 199 31 7 421 3 SPBC887.13c Putative 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0A953 2.36e-57 196 33 9 410 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli (strain K12)
P0A954 2.36e-57 196 33 9 410 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P04683 5.57e-57 195 34 10 417 3 nodE Nodulation protein E Rhizobium leguminosarum bv. viciae
P56902 1.46e-56 194 36 8 419 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Rhizobium meliloti (strain 1021)
P16540 1.64e-56 194 32 10 425 3 gra-orf1 Granaticin polyketide putative beta-ketoacyl synthase 1 Streptomyces violaceoruber
Q89AY4 1.81e-56 194 31 7 408 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q05356 8.72e-56 192 34 11 423 3 sch1 Putative polyketide beta-ketoacyl synthase 1 Streptomyces halstedii
Q02059 6.63e-55 191 31 8 421 1 SCO5087 Actinorhodin polyketide putative beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9C9P4 1.74e-53 189 34 11 422 1 KAS2 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic Arabidopsis thaliana
Q0VCA7 3.85e-53 186 33 9 424 2 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Bos taurus
Q8L3X9 4.84e-53 186 31 7 432 1 KAS 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Arabidopsis thaliana
P23155 1.94e-52 183 33 14 426 3 SCO5318 Putative polyketide beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P16538 2.72e-52 183 33 13 427 1 tcmK Tetracenomycin polyketide synthase ketoacyl synthase alpha subunit Streptomyces glaucescens
P57193 1.44e-51 181 32 9 411 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P9WQD9 1.85e-51 181 33 5 351 1 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD8 1.85e-51 181 33 5 351 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
H8ESN0 1.85e-51 181 33 5 351 2 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
P63455 1.85e-51 181 33 5 351 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQD7 5.23e-51 179 31 9 414 1 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD6 5.23e-51 179 31 9 414 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63457 5.23e-51 179 31 9 414 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P41175 4.01e-50 177 34 8 354 3 None Putative polyketide beta-ketoacyl synthase 1 Streptomyces virginiae
Q9CBS7 6.33e-50 177 30 7 391 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium leprae (strain TN)
P39525 3.06e-48 173 31 14 446 1 CEM1 3-oxoacyl-[acyl-carrier-protein] synthase homolog Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43678 1.03e-46 168 31 13 425 3 None Oxytetracycline polyketide putative beta-ketoacyl synthase 1 Streptomyces rimosus
O69473 1.43e-46 168 30 10 411 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium leprae (strain TN)
Q8KA28 2.54e-34 134 29 7 409 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q54KU3 1.81e-25 112 28 12 345 3 pks25 Probable polyketide synthase 25 Dictyostelium discoideum
P40804 3.24e-25 109 25 8 400 1 pksF Polyketide biosynthesis malonyl-ACP decarboxylase PksF Bacillus subtilis (strain 168)
B6HNK3 5.65e-25 111 31 8 267 3 sorA Highly reducing polyketide synthase sorA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q869W9 2.97e-24 109 33 8 249 2 pks16 Probable polyketide synthase 16 Dictyostelium discoideum
A0A5C1RD96 4.94e-24 108 32 7 268 3 pksAC Non-reducing polyketide synthase AC Didymella fabae
Q54FQ3 1.04e-23 107 26 15 433 3 pks29 Probable polyketide synthase 29 Dictyostelium discoideum
B3FWU0 2.64e-23 106 30 5 272 1 rdc5 Reducing polyketide synthase rdc5 Metacordyceps chlamydosporia
Q54FD2 2.76e-23 106 26 16 431 3 pks38 Probable polyketide synthase 38 Dictyostelium discoideum
G0R6S8 3.79e-23 105 29 6 267 2 sor1 Highly reducing polyketide synthase sor1 Hypocrea jecorina (strain QM6a)
Q54FC8 3.88e-23 105 26 16 431 3 pks39 Probable polyketide synthase 39 Dictyostelium discoideum
P96284 4.15e-23 104 31 6 283 1 pks15 Putative inactive phenolphthiocerol synthesis polyketide synthase type I Pks15 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q559A9 4.47e-23 105 26 15 349 3 pks13 Probable polyketide synthase 13 Dictyostelium discoideum
Q03133 4.84e-23 105 33 7 237 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
Q03133 2.02e-09 63 32 7 194 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
Q54FQ2 5.05e-23 105 26 17 434 3 pks30 Probable polyketide synthase 30 Dictyostelium discoideum
Q7TXK8 5.61e-23 105 33 5 238 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q869X2 6.96e-23 105 32 8 249 3 pks17 Probable polyketide synthase 17 Dictyostelium discoideum
K2QVI8 8.71e-23 104 29 6 269 1 dpmpA Non-reducing polyketide synthase dpmpA Macrophomina phaseolina (strain MS6)
B0G170 9.03e-23 104 27 18 431 3 pks28 Probable polyketide synthase 28 Dictyostelium discoideum
Q54FN7 1.49e-22 103 25 15 433 3 pks33 Probable polyketide synthase 33 Dictyostelium discoideum
Q9ZGI4 2.43e-22 103 30 7 272 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q9ZGI4 6.7e-21 99 30 7 272 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q54FN2 2.71e-22 103 25 15 432 3 pks34 Probable polyketide synthase 34 Dictyostelium discoideum
Q54G30 4.49e-22 102 27 17 433 3 pks27 Probable polyketide synthase 27 Dictyostelium discoideum
Q55E72 4.74e-22 102 27 11 407 1 stlA Probable polyketide synthase 1 Dictyostelium discoideum
I6X8D2 5.5e-22 102 28 8 323 1 pks13 Polyketide synthase Pks13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q54T36 5.67e-22 102 24 16 433 3 pks19 Probable polyketide synthase 19 Dictyostelium discoideum
B0G138 5.77e-22 102 24 16 433 3 pks21 Probable polyketide synthase 21 Dictyostelium discoideum
Q54FQ1 6.64e-22 102 24 17 436 3 pks31 Probable polyketide synthase 31 Dictyostelium discoideum
A0A0B5KU17 6.71e-22 102 29 6 267 1 mpaC' Non-reducing polyketide synthase mapC' Penicillium brevicompactum
Q5BEJ4 7.72e-22 102 27 5 273 1 afoG Asperfuranone polyketide synthase afoG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A097ZPE0 1.02e-21 101 29 5 269 1 andM Non-reducing polyketide synthase andM Emericella variicolor
Q558Y6 2.89e-21 100 23 11 433 3 pks14 Probable polyketide synthase 14 Dictyostelium discoideum
F1DBA9 3.17e-21 100 29 6 267 1 mpaC Non-reducing polyketide synthase mapC Penicillium brevicompactum
E9F5E7 3.29e-21 100 31 4 233 1 subA Non-reducing polyketide synthase subA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
Q02062 3.66e-21 97 26 11 411 1 SCO5088 Actinorhodin polyketide putative beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
K3VA96 3.83e-21 99 27 5 281 3 PKS40 Highly reducing polyketide synthase 40 Fusarium pseudograminearum (strain CS3096)
P9WQE7 4.1e-21 99 29 7 278 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE6 4.26e-21 99 29 7 278 3 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9ZGI5 4.64e-21 99 29 7 274 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 8.8e-21 99 30 7 277 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 6.58e-17 87 27 9 339 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
A0A5C1RDA3 5.12e-21 99 28 7 291 3 orf7 Highly reducing polyketide synthase Didymella fabae
Q9ZGI3 7.62e-21 99 29 8 274 1 pikAIII Narbonolide/10-deoxymethynolide synthase PikA3, module 5 Streptomyces venezuelae
P16539 8.22e-21 97 27 15 418 1 tcmL Tetracenomycin polyketide synthase ketoacyl synthase beta subunit Streptomyces glaucescens
Q54FP8 8.43e-21 99 25 14 436 3 pks32 Probable polyketide synthase 32 Dictyostelium discoideum
P9WEX6 9.4e-21 98 31 4 233 1 dpmaA Non-reducing polyketide synthase dpmaA Metarhizium anisopliae
Q71SP7 1.01e-20 98 28 10 333 1 FASN Fatty acid synthase Bos taurus
Q54IX3 1.3e-20 98 25 15 389 3 pks26 Probable polyketide synthase 26 Dictyostelium discoideum
Q558W4 1.88e-20 97 24 13 446 3 pks15 Probable polyketide synthase 15 Dictyostelium discoideum
A0R1E8 1.92e-20 97 31 3 237 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B6H999 2.61e-20 97 29 7 290 1 xilA Highly reducing polyketide synthase xilA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q7TXM0 2.71e-20 97 28 7 278 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
S0DZM7 2.85e-20 97 26 12 378 1 bik1 Bikaverin polyketide synthase bik1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
P12276 2.97e-20 97 25 10 352 1 FASN Fatty acid synthase Gallus gallus
Q07017 3.54e-20 97 32 5 237 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
Q07017 3.79e-19 94 31 6 237 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
P9WEX0 3.59e-20 97 30 7 272 1 dpasA Non-reducing polyketide synthase dpasA Apiospora sacchari
Q54KU5 4.35e-20 96 26 9 309 3 pks24 Probable polyketide synthase 24 Dictyostelium discoideum
A0A2I1BSV9 4.66e-20 96 30 6 270 1 nvfA Non-reducing polyketide synthase nvfA Aspergillus novofumigatus (strain IBT 16806)
B0G103 6.09e-20 96 25 17 431 3 pks10 Probable polyketide synthase 10 Dictyostelium discoideum
N4WHE3 7.53e-20 95 27 5 266 3 PKS1 Reducing polyketide synthase PKS1 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
A0A481WQB6 9.56e-20 95 31 7 272 1 claF Clavatol synthase claF Penicillium crustosum
B2HIL7 1.01e-19 95 30 6 270 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium marinum (strain ATCC BAA-535 / M)
A0A9P5GG56 1.01e-19 95 31 5 243 1 xilA Highly reducing polyketide synthase xilA Penicillium crustosum
Q03131 1.02e-19 95 30 6 256 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03131 5.23e-13 74 31 5 193 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03132 1.11e-19 95 27 4 272 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
Q03132 3.93e-17 87 28 4 235 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
P12785 1.25e-19 95 28 12 353 1 Fasn Fatty acid synthase Rattus norvegicus
P49327 1.32e-19 95 28 10 334 1 FASN Fatty acid synthase Homo sapiens
Q86JI5 1.97e-19 94 25 17 425 2 pks5 Probable polyketide synthase 5 Dictyostelium discoideum
B8N8R0 2.31e-19 94 29 7 277 2 afvB Non-reducing polyketide synthase afvB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A6S5ZY48 3.97e-19 93 27 5 264 2 g433 Highly reducing polyketide synthase g433 Fusarium sp.
I1RL11 4.41e-19 93 28 5 272 1 dpfgA Non-reducing polyketide synthase dpfgA Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A1Y0BRF1 5.65e-19 93 27 5 275 3 adrD Non-reducing polyketide synthase adrD Penicillium roqueforti
B0G100 6.36e-19 93 27 14 347 3 pks7 Probable polyketide synthase 7 Dictyostelium discoideum
Q54ED7 6.55e-19 93 29 9 292 3 pks40 Probable polyketide synthase 40 Dictyostelium discoideum
A0A089QRB9 7.49e-19 92 29 3 235 1 msl3 Mycolipanoate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q86AE3 8.35e-19 92 26 15 382 2 pks9 Probable polyketide synthase 9/36 Dictyostelium discoideum
Q55DM7 9.51e-19 92 27 8 281 3 pks2 Probable polyketide synthase 2 Dictyostelium discoideum
P40806 9.64e-19 92 28 9 275 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 1.09e-16 86 27 9 351 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 3.72e-14 78 25 7 275 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
Q0CF75 1.21e-18 92 25 5 273 1 ATEG_07659 Highly reducing polyketide synthase ATEG_07659 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P19096 1.62e-18 92 28 12 353 1 Fasn Fatty acid synthase Mus musculus
A0A0U5GFS8 1.64e-18 91 29 6 268 1 ausA Non-reducing polyketide synthase ausA Aspergillus calidoustus
O53901 2.11e-18 91 30 4 241 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q54TW0 2.67e-18 91 24 13 402 2 pks18 Probable polyketide synthase 18 Dictyostelium discoideum
Q86ZD9 2.67e-18 91 26 7 271 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain C2932)
Q5KTM9 4.01e-18 90 27 6 289 1 alt5 Highly reducing polyketide synthase alt5 Alternaria solani
A0A1B4XBH3 4.17e-18 90 26 10 331 3 sdnO Highly reducing polyketide synthase sdnO Sordaria araneosa
Q5ATJ7 4.74e-18 90 30 7 268 1 ausA Non-reducing polyketide synthase ausA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B8MV59 5.06e-18 90 28 8 288 3 tpeA Partially reducing polyketide synthase tpeA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
Q9ZGI2 5.11e-18 90 28 9 285 1 pikAIV Narbonolide/10-deoxymethynolide synthase PikA4, module 6 Streptomyces venezuelae
W6QL47 5.53e-18 90 31 5 228 3 mpaC Non-reducing polyketide synthase mapC Penicillium roqueforti (strain FM164)
B8MKY6 5.55e-18 90 24 4 276 1 tstA Highly reducing polyketide synthase tstA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
P96202 6.63e-18 90 27 8 276 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7TXL8 6.63e-18 90 27 8 276 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q54D44 7.31e-18 89 26 15 350 3 pks42 Probable polyketide synthase 42 Dictyostelium discoideum
I6XD69 7.56e-18 89 26 10 341 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
I6XD69 1.25e-17 89 28 7 275 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
M2XHZ5 8.34e-18 89 30 8 279 2 pksA Norsolorinic acid synthase Dothistroma septosporum (strain NZE10 / CBS 128990)
Q30DW5 8.34e-18 89 30 8 279 2 pksA Norsolorinic acid synthase Dothistroma septosporum
A0A2I2F262 1.08e-17 89 30 7 276 1 acdB PKS-NRPS hybrid synthetase acdB Aspergillus candidus
Q54ED6 1.13e-17 89 27 9 298 3 pks41 Probable polyketide synthase 41 Dictyostelium discoideum
A0A3G9H990 1.48e-17 89 26 6 274 1 ALT1 Highly reducing polyketide synthase ALT1 Alternaria alternata
B6HV32 1.48e-17 89 30 4 232 1 adrD Non-reducing polyketide synthase adrD Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
O31782 1.85e-17 88 27 16 399 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 6.45e-15 80 27 8 308 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 8.51e-12 71 27 6 228 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
Q54QD1 1.91e-17 88 28 9 276 3 pks23 Probable polyketide synthase 23 Dictyostelium discoideum
Q54QD3 1.91e-17 88 28 9 276 3 pks22 Probable polyketide synthase 22 Dictyostelium discoideum
A0A1E1FFN8 2.26e-17 88 29 7 268 3 prhL Non-reducing polyketide synthase prhL Penicillium brasilianum
Q03149 2.36e-17 88 28 8 309 1 wA Conidial yellow pigment biosynthesis polyketide synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q02251 2.63e-17 88 28 5 238 1 mas Mycocerosic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B0G0Z9 2.69e-17 88 25 15 382 3 pks6 Probable polyketide synthase 6 Dictyostelium discoideum
A0A0N9HNS9 3.07e-17 87 27 7 273 3 desS Desertorin synthase Aspergillus desertorum
W7MT31 3.77e-17 87 29 6 267 1 FUB1 Reducing polyketide synthase FUB1 Gibberella moniliformis (strain M3125 / FGSC 7600)
A0A1B7YCC9 3.9e-17 87 29 8 273 1 dpchA Non-reducing polyketide synthase dpchA Colletotrichum higginsianum (strain IMI 349063)
Q5B7U4 5.73e-17 87 25 8 320 1 pkiA Non-reducing polyketide synthase pkiA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0D2YG10 5.92e-17 87 29 6 267 1 FUB1 Reducing polyketide synthase FUB1 Fusarium oxysporum f. sp. lycopersici (strain 4287 / CBS 123668 / FGSC 9935 / NRRL 34936)
J4UHQ6 6.34e-17 87 23 11 374 1 OpS1 Orsellinic acid synthase Beauveria bassiana (strain ARSEF 2860)
Q5AZ32 6.39e-17 87 34 6 204 1 pkbA Non-reducing polyketide synthase pkbA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
S3D9F1 6.81e-17 87 27 6 265 1 gloL Highly reducing polyketide synthase gloL Glarea lozoyensis (strain ATCC 20868 / MF5171)
A0A455LXK0 7.6e-17 86 31 6 217 2 ntnG Non-reducing polyketide synthase ntnG Nectria sp.
A0A3T0ZHJ0 7.69e-17 86 28 7 275 1 cle1 Triacetic acid lactone synthase cle1 Aspergillus versicolor
A0A0C6E0I7 7.78e-17 86 27 8 307 1 bet1 Highly reducing polyketide synthase bet1 Neocamarosporium betae
Q55CN6 7.9e-17 86 25 6 273 3 pks3 Probable polyketide synthase 3 Dictyostelium discoideum
Q2T4N2 8.67e-17 86 30 5 239 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N2 9.56e-10 64 27 6 236 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A2QK66 8.98e-17 86 29 6 275 3 ktnS Kotanin synthase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
W3X8X8 9.68e-17 86 29 9 276 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
B0G101 1.17e-16 86 25 12 346 3 pks8 Probable polyketide synthase 8/35 Dictyostelium discoideum
A0A2V5GX43 1.42e-16 85 27 7 270 3 pyvA Hybrid PKS-NRPS synthetase pyvA Aspergillus violaceofuscus (strain CBS 115571)
A0A455M7S4 1.54e-16 85 28 8 274 1 atnG Non-reducing polyketide synthase atnG Arthrinium sp.
A0A084API3 1.63e-16 85 26 8 315 3 SAT13 Highly reducing polyketide synthase SAT13 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
G3J453 1.68e-16 85 27 9 322 1 cm3B Highly reducing polyketide synthase cm3B Cordyceps militaris (strain CM01)
A0A8D5M692 1.69e-16 85 30 9 270 1 esdpA Non-reducing polyketide synthase esdpA Penicillium shearii
A0A443HK81 1.83e-16 85 30 5 216 1 VdtA Non-reducing polyketide synthase VdtA Byssochlamys spectabilis
A0A084B9Z6 1.89e-16 85 30 6 221 3 SAT8 Non-reducing polyketide synthase SAT8 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
Q5BG07 1.95e-16 85 29 8 272 1 pkdA Non-reducing polyketide synthase pkdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9R9J1 2.19e-16 85 26 10 345 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
A0A075TRC0 2.3e-16 85 29 4 224 1 patK 6-methylsalicylic acid synthase Penicillium expansum
B8MYS6 2.37e-16 85 26 13 364 1 pks27 Non-reducing polyketide synthase pks27 Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q2T4N1 2.5e-16 85 29 4 217 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 1.12e-13 77 27 7 286 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 2.41e-12 72 29 6 227 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 7.58e-11 68 25 10 358 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B6HN77 2.6e-16 85 29 6 272 3 sorB Non-reducing polyketide synthase sorB Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q5B8A0 2.6e-16 85 29 8 268 1 pkfA Non-reducing polyketide synthase pkfA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0F7U103 2.97e-16 84 29 4 226 3 ausA Non-reducing polyketide synthase ausA Penicillium brasilianum
A0A0K0MCJ4 3.09e-16 84 29 4 217 1 cazM Iterative polyketide synthase CazM Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q3S2U6 3.26e-16 84 30 10 270 1 mokB Lovastatin diketide synthase mokB Monascus pilosus
W7LKX1 3.48e-16 84 26 6 267 2 FUM1 Highly reducing polyketide synthase FUM1 Gibberella moniliformis (strain M3125 / FGSC 7600)
S0DRI1 3.64e-16 84 29 6 267 1 FUB1 Reducing polyketide synthase FUB1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A2I2F2N6 3.87e-16 84 27 9 287 1 cfoA Chalcone synthase cfoA Aspergillus candidus
G3Y419 4.05e-16 84 26 9 325 1 yanA 6-methylsalicylic acid synthase Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
B8MV60 4.63e-16 84 29 6 222 3 tpeB Non-reducing polyketide synthase tpeB Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
G0R6S9 4.65e-16 84 27 6 272 2 sor2 Non-reducing polyketide synthase sor2 Hypocrea jecorina (strain QM6a)
A0A193PS74 5.02e-16 84 33 5 212 1 stbA Non-reducing polyketide synthase stbA Stachybotrys bisbyi
Q5AUX7 7.47e-16 83 28 7 271 1 dbaI Non-reducing polyketide synthase dbaI Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
E5AE40 7.79e-16 83 27 9 326 2 PKS2 Highly reducing polyketide synthase PKS2 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
D7UQ44 7.83e-16 83 28 8 274 1 sol1 Prosolanapyrone synthase Alternaria solani
Q5BBP5 1.13e-15 83 27 9 278 1 pkhB Highly reducing polyketide synthase pkhB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0R8YWJ7 1.13e-15 83 29 6 255 1 mpas Methylphloroacetophenone synthase Cladonia uncialis
G3XLL5 1.33e-15 82 26 11 356 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A0A6F9DYX9 1.34e-15 82 28 6 224 1 men2 Non-reducing polyketide synthase men2 Menisporopsis theobromae
Q0C8A4 1.38e-15 82 27 6 268 1 trt4 Non-reducing polyketide synthase trt4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A2QUI2 1.39e-15 82 26 11 356 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A0S2CHA9 1.39e-15 82 27 7 270 1 pigA Non-reducing polyketide synthase pigA Monascus ruber
P9WET9 1.49e-15 82 27 9 301 1 PvBS090_009107 Non-reducing polyketide synthase PvBS090_009107 Byssochlamys spectabilis
Q2UB00 1.53e-15 82 26 9 282 3 ppsB Reducing polyketide synthase ppsB Aspergillus oryzae (strain ATCC 42149 / RIB 40)
E5A7D9 1.56e-15 82 27 6 275 2 pks5 Highly reducing polyketide synthase pks5 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
B8M9J9 1.58e-15 82 29 8 274 1 tropA 3-methylorcinaldehyde synthase tropA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A1R3RGK0 1.81e-15 82 29 8 283 1 otaA Highly reducing polyketide synthase otaA Aspergillus carbonarius (strain ITEM 5010)
A0A0A2KT65 2.14e-15 82 27 12 353 2 melA Conidial yellow pigment biosynthesis polyketide synthase melA Penicillium expansum
A0A1B3PEI6 2.21e-15 82 29 7 229 1 ORF-A Polyunsaturated fatty acid synthase subunit A Thraustochytrium sp. (strain ATCC 26185 / S-3)
Q4W944 2.41e-15 82 26 6 276 1 encA Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A3G1DJH7 2.65e-15 82 26 6 271 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
Q5BEJ6 2.76e-15 82 27 8 273 1 afoE Iterative polyketide synthase afoE Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P9WET4 2.91e-15 82 27 7 295 1 Preu5 Highly reducing polyketide synthase Preu5 Preussia isomera
A2QTE9 3.17e-15 81 29 8 272 3 epaA Non-reducing polyketide synthase epaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A0U5GK88 3.24e-15 81 27 6 270 1 ausV Highly reducing polyketide synthase ausV Aspergillus calidoustus
A0A1L9WQM9 3.31e-15 81 27 7 281 2 acrA Highly reducing polyketide synthase acrA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A161CEU9 3.46e-15 81 27 7 276 1 citS Citrinin polyketide synthase Monascus ruber
Q65Z23 3.46e-15 81 27 7 276 1 pksCT Citrinin polyketide synthase Monascus purpureus
A7UMW1 3.51e-15 81 28 9 284 2 PKS1 Non-reducing polyketide synthase 1 Elsinoe fawcettii
Q12053 3.58e-15 81 28 7 277 1 aflC Norsolorinic acid synthase Aspergillus parasiticus (strain ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1)
Q7TXL7 3.76e-15 81 28 6 240 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQE3 4.04e-15 81 28 6 240 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit D Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE2 4.04e-15 81 28 6 240 3 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
M1WG96 4.11e-15 81 30 5 218 2 CPUR_05437 Non-reducing polyketide synthase CPUR_05437 Claviceps purpurea (strain 20.1)
Q2ABP6 4.33e-15 81 27 7 291 1 pksF Reducing polyketide synthase pksF Alternaria solani
A0A6F9DXA0 4.4e-15 81 27 8 284 1 men1 Partially reducing polyketide synthase men1 Menisporopsis theobromae
F9XMW3 4.46e-15 81 28 8 284 3 PKS1 Non-reducing polyketide synthase PKS1 Zymoseptoria tritici (strain CBS 115943 / IPO323)
W6QDA2 4.82e-15 81 28 4 199 1 anuA Highly reducing polyketide synthase anuA Penicillium roqueforti (strain FM164)
A0A067XNI2 5.02e-15 80 29 8 279 2 ptaA Non-reducing polyketide synthase ptaA Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
A0A6H0YV38 5.08e-15 80 29 5 213 2 crz7 Non-reducing polyketide synthase crz7 Cladonia metacorallifera
Q05470 5.43e-15 81 27 8 311 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 3.04e-14 78 27 5 272 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 4.46e-13 75 26 7 292 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 1.18e-12 73 31 6 209 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
A0A1W5T1T1 5.85e-15 80 24 7 269 2 poxF Highly reducing polyketide synthase poxF Penicillium oxalicum
P9WES9 5.87e-15 80 26 7 281 1 PFUR17_0229 Non-reducing polyketide synthase PFUR17_0229 Pseudevernia furfuracea
P9WET5 5.88e-15 80 28 9 275 1 Preu4 Non-reducing polyketide synthase Preu4 Preussia isomera
R4WH05 5.95e-15 80 26 10 326 3 ACRTS2 Highly reducing polyketide synthase ACRTS2 Alternaria alternata
P40872 6.24e-15 80 26 14 369 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 8.44e-14 77 30 5 226 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 4.81e-11 68 28 4 231 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
M3A326 6.51e-15 80 30 5 217 2 PKS8-1 Non-reducing polyketide synthase PKS8-1 Pseudocercospora fijiensis (strain CIRAD86)
Q4WZA8 6.84e-15 80 27 7 277 1 alb1 Conidial pigment polyketide synthase alb1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A1L9UCG2 7.55e-15 80 27 9 312 3 albA Non-reducing polyketide synthase albA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
Q50LG3 8.44e-15 80 26 6 270 3 AFT9-1 Highly reducing polyketide synthase AFT9-1 Alternaria alternata
Q0CRQ5 8.46e-15 80 29 4 234 1 ATEG_03629 5-methylorsellinic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A443HK66 9.14e-15 80 26 7 309 3 VdtX Highly reducing polyketide synthase VdtX Byssochlamys spectabilis
E9KMQ2 9.49e-15 80 29 5 213 2 PKS16 Non-reducing polyketide synthase PKS16 Cladonia grayi
Q12397 9.65e-15 80 28 9 278 2 stcA Norsolorinic acid synthase stcA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
G3XMC4 1e-14 80 28 8 272 1 azaA Non-reducing polyketide synthase azaA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A2R6H1 1.07e-14 80 29 9 284 2 otaA Highly reducing polyketide synthase otaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A179H0J7 1.12e-14 80 28 9 281 2 lcsC Highly reducing polyketide synthase lcsC Purpureocillium lilacinum
D4AU31 1.13e-14 80 28 6 271 3 swnK PKS-NRPS hybrid synthetase swnK Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
B6QK76 1.2e-14 80 29 5 212 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN5 1.2e-14 80 29 5 212 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei
D2E9X0 1.21e-14 80 26 6 288 2 DEP5 Reducing polyketide synthase DEP5 Alternaria brassicicola
A0A2P1DP91 1.25e-14 79 27 5 247 1 macA 6-methylsalicylic acid synthase Penicillium terrestre
A0A0A0RM07 1.32e-14 79 27 8 290 1 MLNS Mellein synthase Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0CJ59 1.34e-14 79 29 4 224 1 atX 6-methylsalicylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A0Y0M151 1.37e-14 79 25 5 270 1 cla2 Highly reducing polyketide synthase cla2 Cladosporium cladosporioides
A0A1P8NTI3 1.43e-14 79 28 10 282 2 pks8 Non-reducing polyketide synthase 8 Pestalotiopsis microspora
Q0CCY3 1.57e-14 79 26 9 282 1 gedC Atrochrysone carboxylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A5PHD6 1.8e-14 79 27 4 232 1 aspks1 3-methylorcinaldehyde synthase Sarocladium schorii
A0A348HAX6 1.81e-14 79 23 5 276 1 phiA Highly reducing polyketide synthase phiA Fungal sp. (strain ATCC 74256)
Q0D1N9 1.89e-14 79 29 6 218 1 terA Non-reducing polyketide synthase terA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A5ABG0 2.02e-14 79 29 5 197 1 pynA Hybrid PKS-NRPS synthetase pynA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P9WET3 2.04e-14 79 28 9 283 1 Preu8 Non-reducing polyketide synthase Preu8 Preussia isomera
A0A0D1DNX1 3.11e-14 78 25 11 347 2 fas2 Fatty acid synthase 2 Ustilago maydis (strain 521 / FGSC 9021)
A0A0B4FTU6 3.27e-14 78 28 9 311 1 Pks1 Polyketide synthase 1 Metarhizium anisopliae (strain ARSEF 549)
A0A0B4H4F0 3.27e-14 78 28 9 311 1 Pks1 Polyketide synthase 1 Metarhizium majus (strain ARSEF 297)
S0DTP6 3.35e-14 78 25 7 283 2 FSR1 Non-reducing polyketide synthase fsr1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A0B4G9F9 3.36e-14 78 28 9 311 1 Pks1 Polyketide synthase 1 Metarhizium guizhouense (strain ARSEF 977)
E9F646 3.51e-14 78 28 9 311 1 Pks1 Polyketide synthase 1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A0B4ESU9 3.6e-14 78 28 9 311 1 Pks1 Polyketide synthase 1 Metarhizium brunneum (strain ARSEF 3297)
I1RLA7 3.72e-14 78 29 5 218 2 FGR1 Highly reducing polyketide synthase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P9WET2 3.85e-14 78 29 4 213 1 Preu6 Non-reducing polyketide synthase Preu6 Preussia isomera
A0A4P8DJV2 4.07e-14 78 25 8 308 3 dmxL2 Highly reducing polyketide synthase dmxL2 Cryptosporiopsis sp. (strain 8999)
Q5BBP8 4.18e-14 78 26 4 226 1 pkhA Non-reducing polyketide synthase pkhA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4WQZ5 4.22e-14 78 33 5 178 2 tpcC Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q0CF73 4.32e-14 78 29 4 215 1 ATEG_07661 Non-reducing polyketide synthase ATEG_07661 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A411KUP8 4.54e-14 78 27 6 278 1 ucsA Hybrid PKS-NRPS synthetase ucsA Acremonium sp.
A0A8F4SKJ7 4.98e-14 78 27 3 232 1 atr1 Non-reducing polyketide synthase atr1 Stereocaulon alpinum
E9F8M3 5.02e-14 78 29 7 276 1 swnK PKS-NRPS hybrid synthetase swnK Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
P0DUT7 5.31e-14 77 28 8 272 1 Ba17a Highly reducing polyketide synthase 17 Metarhizium anisopliae
A0A6F8RNP4 6.32e-14 77 26 6 280 1 grgA Reducing polyketide synthase grgA Penicillium sp.
A0A167LUQ4 6.74e-14 77 25 8 307 3 fumoS Fumosorinone synthetase Cordyceps fumosorosea (strain ARSEF 2679)
P9WEV0 6.74e-14 77 27 6 271 3 valA Highly reducing polyketide synthase valA Aspergillus terreus
P9WET8 6.76e-14 77 27 6 270 2 Preu1 Highly reducing polyketide synthase Preu1 Preussia isomera
A0A0B4I1J8 6.91e-14 77 29 5 233 2 Pks2 Polyketide synthase 2 Metarhizium majus (strain ARSEF 297)
A0A455R5P9 7.08e-14 77 30 10 273 1 ascC Non-reducing polyketide synthase ascC Acremonium egyptiacum
C8VJR7 7.82e-14 77 27 6 270 1 alnA Highly reducing polyketide synthase alnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A1KQG0 8.02e-14 77 30 5 225 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q4WA61 8.17e-14 77 28 4 204 3 nscA Non-reducing polyketide synthase nscA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P9WQE9 8.54e-14 77 30 5 225 1 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE8 8.54e-14 77 30 5 225 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U9F4 8.54e-14 77 30 5 225 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q7TVK8 8.54e-14 77 30 5 225 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
F2T0M0 8.7e-14 77 30 5 209 3 nscA Non-reducing polyketide synthase nscA Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
B3FWT6 8.99e-14 77 24 15 451 1 rdc1 Non-reducing polyketide synthase rdc1 Metacordyceps chlamydosporia
A0A0B4I1L1 9.52e-14 77 29 5 233 2 Pks2 Polyketide synthase 2 Metarhizium guizhouense (strain ARSEF 977)
I1RF58 9.55e-14 77 28 5 236 1 PKS12 Non-reducing polyketide synthase PKS12 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A2I1C3X5 1e-13 77 29 9 269 1 nsrB Atrochrysone carboxylic acid synthase nsrB Aspergillus novofumigatus (strain IBT 16806)
G3JUI8 1e-13 77 29 11 279 1 milA Highly reducing polyketide synthase milA Cordyceps militaris (strain CM01)
Q5ATG8 1.04e-13 77 25 10 307 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
D4CZZ2 1.15e-13 76 30 5 209 3 nscA Non-reducing polyketide synthase nscA Trichophyton verrucosum (strain HKI 0517)
A0A6J4B487 1.17e-13 77 27 9 285 3 LUC5 Hybrid PKS-NRPS synthetase LUC5 Fusarium sp.
F2S6Z9 1.17e-13 76 30 5 209 3 nscA Non-reducing polyketide synthase nscA Trichophyton tonsurans (strain CBS 112818)
A0A1L7U3D7 1.17e-13 77 25 6 299 2 FPY1 Highly reducing polyketide synthase 40 Fusarium mangiferae
E9ET39 1.18e-13 76 29 5 233 2 Pks2 Polyketide synthase 2 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9EHG2 1.21e-13 76 29 5 233 2 Pks2 Polyketide synthase 2 Metarhizium acridum (strain CQMa 102)
C5FM57 1.23e-13 76 29 5 209 3 nscA Non-reducing polyketide synthase nscA Arthroderma otae (strain ATCC MYA-4605 / CBS 113480)
F2PWS5 1.24e-13 76 30 5 209 3 nscA Non-reducing polyketide synthase nscA Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
A0A0G0AID6 1.3e-13 76 26 9 309 1 thnA Hybrid PKS-NRPS synthetase thnA Trichoderma harzianum
B6F209 1.38e-13 76 25 9 282 1 cpaA Cyclo-acetoacetyl-L-tryptophan synthase Aspergillus oryzae
Q5BA83 1.4e-13 76 25 7 314 3 easB Highly reducing polyketide synthase easB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0B4FLB2 1.54e-13 76 29 5 233 2 Pks2 Polyketide synthase 2 Metarhizium anisopliae (strain ARSEF 549)
D4AWH3 1.55e-13 76 30 5 209 3 nscA Non-reducing polyketide synthase nscA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q54B51 1.75e-13 76 25 6 235 3 pks44 Probable polyketide synthase 44 Dictyostelium discoideum
A0A1L9WN37 1.83e-13 76 28 4 222 1 acuA 6-methylsalicylic acid synthase acuA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
P9WET6 1.91e-13 76 26 7 273 1 Preu3 Non-reducing polyketide synthase Preu3 Preussia isomera
Q4WLD4 1.92e-13 76 26 10 300 1 pyr2 Non-reducing polyketide synthase pyr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A1B5L6A0 2.13e-13 75 26 7 279 1 UVI_02036160 Non-reducing polyketide synthase ustP Ustilaginoidea virens
S0EEY3 2.21e-13 75 26 9 289 1 FUS1 Fusarin C synthetase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A0N0DCA3 2.22e-13 75 24 5 287 2 DEP5 Reducing polyketide synthase DEP5 Fusarium langsethiae
Q4WAY3 2.29e-13 75 27 7 276 1 af370 Fumagillin dodecapentaenoate synthase af370 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
E4V2N2 2.3e-13 75 30 5 209 3 nscA Non-reducing polyketide synthase nscA Arthroderma gypseum (strain ATCC MYA-4604 / CBS 118893)
A0A2U8NEV6 2.65e-13 75 27 9 311 1 Pks1 Polyketide synthase 1 Metarhizium acridum (strain CQMa 102)
Q0CZH1 2.76e-13 75 23 8 337 2 pytA Hybrid PKS-NRPS synthetase pytA (Fragment) Aspergillus terreus (strain NIH 2624 / FGSC A1156)
L7XAV2 2.81e-13 75 27 7 276 1 curS2 Non-reducing polyketide synthase curS2 Aspergillus terreus
Q54B49 2.91e-13 75 25 6 235 3 pks45 Probable polyketide synthase 45 Dictyostelium discoideum
B4XYB8 3.05e-13 75 29 7 247 1 aziB 5-methyl-1-naphthoate synthase Streptomyces sahachiroi
D7PHZ2 3.14e-13 75 29 4 204 1 vrtA Non-reducing polyketide synthase vrtA Penicillium aethiopicum
A0A1L9WLD9 3.22e-13 75 29 6 220 1 AacuL Atrochrysone carboxylic acid synthase AacuL Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
C5H885 3.57e-13 75 27 6 276 3 rads1 Reducing polyketide synthase rads1 Floropilus chiversii
P0CU67 3.64e-13 75 28 6 218 1 claG Atrochrysone carboxylic acid synthase Passalora fulva
B6QK81 4.28e-13 75 28 6 240 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN6 4.28e-13 75 28 6 240 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei
G3XMD1 4.37e-13 75 25 5 270 1 azaB Highly reducing polyketide synthase azaB Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A0A384XH94 4.66e-13 75 26 3 238 1 stpks1 Highly reducing polyketide synthase stpks1 Strobilurus tenacellus
A0A481WR96 5.45e-13 74 30 6 193 3 claI Highly reducing polyketide synthase claI Penicillium crustosum
A0JJU1 7.05e-13 74 26 11 352 1 tenS Tenellin synthetase Beauveria bassiana
A1D8I9 7.09e-13 74 27 4 204 3 nscA Non-reducing polyketide synthase nscA Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A0A411PQP9 7.56e-13 74 27 9 281 3 Agnpks1 Atrochrysone carboxylic acid synthase Agnpks1 Paecilomyces divaricatus
A0A4P8DJU2 7.74e-13 74 29 10 285 3 dmx-nrPKS Atrochrysone carboxylic acid synthase Cryptosporiopsis sp. (strain 8999)
P9WEZ4 8.07e-13 74 26 3 197 2 pytA Hybrid PKS-NRPS synthetase pytA Aspergillus terreus
Q4WKW9 9.07e-13 73 24 7 272 1 fgnA Fumigermin synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A2U8NET4 9.86e-13 73 28 6 235 1 Pks1 Polyketide synthase 1 Metarhizium album (strain ARSEF 1941)
Q0D159 1.04e-12 73 25 8 291 2 ATEG_00325 Hybrid PKS-NRPS synthetase ATEG_00325 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P9WEQ0 1.07e-12 73 27 11 301 3 olcA Non-reducing polyketide synthase olcA Penicillium canescens
S7Z800 1.19e-12 73 26 10 287 3 opdA Hybrid PKS-NRPs synthetase opdA Penicillium oxalicum (strain 114-2 / CGMCC 5302)
I1RVD8 1.24e-12 73 27 9 270 3 PKS6 Highly reducing polyketide synthase PKS6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q0UI00 1.51e-12 73 26 7 279 1 elcA Non-reducing polyketide synthase elcA (Fragment) Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A345BJP0 1.51e-12 73 27 4 179 3 clz2 Squalestatin tetraketide synthase clz2 Cochliobolus lunatus
P0CU84 1.52e-12 73 26 7 273 1 apmlA Highly reducing polyketide synthase apmlA Arthrinium phaeospermum
P41176 1.76e-12 72 27 14 388 3 None Putative polyketide beta-ketoacyl synthase 2 Streptomyces virginiae
A0A1W5T1U1 1.85e-12 73 28 9 284 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
Q4WAZ9 1.88e-12 73 29 7 257 2 NRPS14 PKS-NRPS hybrid synthetase psoA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9Y7D5 1.89e-12 73 26 9 271 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus
S7ZFK6 1.9e-12 73 28 9 284 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
Q2HBN0 3.03e-12 72 27 8 282 1 cghG Hybrid PKS-NRPS synthetase cghG Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A1CFL8 3.44e-12 72 28 5 224 1 patK 6-methylcalicylic acide synthase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
P36189 3.45e-12 70 27 9 285 1 FASN Fatty acid synthase (Fragment) Anser anser anser
G3XNF4 3.48e-12 72 27 11 339 1 ATPKS PKS-NRPS hybrid synthetase ATPKS Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G9N4B2 3.54e-12 72 26 8 272 1 virA Highly reducing polyketide synthase virA Hypocrea virens (strain Gv29-8 / FGSC 10586)
Q54FI3 3.82e-12 72 26 6 232 1 StlB Polyketide synthase 37 Dictyostelium discoideum
A0A0B4H8J1 4.14e-12 72 28 5 233 2 Pks2 Polyketide synthase 2 Metarhizium brunneum (strain ARSEF 3297)
G0LET7 4.4e-12 72 28 6 198 2 BOA9 Reducing polyketide synthase BOA9 Botryotinia fuckeliana (strain B05.10)
A0A0H4ADX3 4.59e-12 71 25 9 282 2 None Non-reducing polyketide synthase PKS19 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A125R003 4.7e-12 71 28 6 206 1 cla3 Non-reducing polyketide synthase cla3 Cladosporium cladosporioides
J4KMC1 4.85e-12 72 25 11 353 1 tenS Tenellin synthetase Beauveria bassiana (strain ARSEF 2860)
W7MLD7 5.05e-12 71 30 4 210 1 FUS1 Fusarin C synthetase Gibberella moniliformis (strain M3125 / FGSC 7600)
Q5AXA9 5.38e-12 71 27 4 216 1 pkgA Non-reducing polyketide synthase pkgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1L7U4V5 5.63e-12 71 25 6 278 2 FMN1 Reducing polyketide synthase 8 Fusarium mangiferae
P9WET1 5.75e-12 71 28 4 218 1 Preu7 Non-reducing polyketide synthase Preu7 Preussia isomera
A0A4P8GHJ1 5.78e-12 71 26 8 271 1 eupA 3-methylorcinaldehyde synthase Phoma sp.
Q8J0F7 6.01e-12 71 26 7 288 1 mlcA Compactin nonaketide synthase, polyketide synthase component Penicillium citrinum
C5H882 6.27e-12 71 28 5 207 3 radS2 Non-reducing polyketide synthase rads2 Floropilus chiversii
Q0C8L6 6.66e-12 71 27 4 201 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A7R7ZK98 6.66e-12 71 26 5 217 3 AcPKS Atrochrysone carboxylic acid synthase Aspergillus chevalieri
D9N1A1 7.74e-12 71 27 12 304 2 ACTTS3 Highly reducing polyketide synthase ACTTS3 Alternaria alternata
P22367 8.09e-12 70 28 4 224 1 None 6-methylsalicylic acid synthase Penicillium patulum
Q5AUX1 8.9e-12 70 24 6 278 1 orsA Orsellinic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A7L9EYL1 9.63e-12 70 27 9 281 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
G4NEB1 1.02e-11 70 27 11 290 1 NEC1 Highly reducing polyketide synthase NEC1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A0A179H2I8 1.05e-11 70 26 4 211 2 lcsB Highly reducing polyketide synthase lcsB Purpureocillium lilacinum
A0A1W7M1U5 1.08e-11 70 28 7 238 1 pgmA Non-reducing polyketide synthase pgmA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q6DQW3 1.18e-11 70 29 10 279 1 CTB1 Non-reducing polyketide synthase CTB1 Cercospora nicotianae
A0A2G5IC96 1.24e-11 70 29 10 279 3 CTB1 Non-reducing polyketide synthase CTB1 Cercospora beticola
P9WQE1 1.25e-11 70 25 13 347 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE0 1.25e-11 70 25 13 347 3 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O31784 1.31e-11 70 28 5 224 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
O31784 1.38e-05 51 28 3 157 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
Q7TXL6 1.32e-11 70 25 13 347 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
I3ZNU9 1.43e-11 70 30 3 189 1 armB Orsellinic acid synthase armB Armillaria mellea
A0A142C799 1.47e-11 70 29 10 239 1 phnA Non-reducing polyketide synthase phnA Penicillium herquei
Q0CSA2 1.58e-11 70 27 3 200 1 tazA Non-reducing polyketide synthase tazA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A1V6NYI6 1.63e-11 70 26 7 281 3 verA Highly reducing polyketide synthase verA Penicillium polonicum
A0A455LLX1 1.65e-11 70 25 8 270 1 atnH Highly reducing polyketide synthase atnH Arthrinium sp.
P9WES2 1.87e-11 69 26 4 213 1 None Atrochrysone carboxylic acid synthase PKS4 Calonarius odorifer
A0A067MTM1 2.09e-11 69 26 9 277 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Botryobasidium botryosum (strain FD-172 SS1)
A0A0U4ZX08 2.28e-11 69 28 5 198 1 drtA Low-reducing polyketide synthase drtA Aspergillus calidoustus
W3X7U2 2.49e-11 69 27 5 215 2 PfmaE Conidial pigment polyketide synthase PfmaE Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
D7PI15 2.58e-11 69 24 7 277 1 gsfA Non-reducing polyketide synthase gsfA Penicillium aethiopicum
Q0CS88 2.61e-11 69 26 5 230 2 tazB Highly reducing polyketide synthase tazB Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q7SHI6 2.63e-11 69 29 8 228 2 srdA Highly reducing polyketide synthase srdA Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A0A3G9GQ29 2.63e-11 69 24 8 335 1 cdmE 6-hydroxymellein synthase cdmE Talaromyces verruculosus
A0A2H3CTK0 2.77e-11 69 31 4 182 1 armB Orsellinic acid synthase armB Armillaria gallica
A0A482N9V7 2.8e-11 69 26 9 272 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
P9WES1 3.04e-11 69 26 4 213 1 None Atrochrysone carboxylic acid synthase PKS1 Calonarius odorifer
Q5SBL6 3.31e-11 69 27 10 283 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
A0A284RE13 3.34e-11 69 31 4 182 1 armB Orsellinic acid synthase ArmB Armillaria ostoyae
Q84HC6 3.72e-11 68 25 7 288 1 ncsB Neocarzinostatin naphthoate synthase Streptomyces carzinostaticus
A0A8F4S6Z6 3.79e-11 68 30 5 208 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
Q5W262 4.22e-11 68 26 11 287 1 pigJ Beta-ketoacyl synthase PigJ Serratia sp. (strain ATCC 39006)
A0A0N7D745 4.47e-11 68 25 9 327 2 Dhc5 Non-reducing polyketide synthase Dhc5 Alternaria cinerariae
A0A481WNP4 4.53e-11 68 27 10 272 3 traA Hybrid PKS-NRPS synthetase traA Penicillium crustosum
Q5B0D0 4.78e-11 68 25 5 217 1 aptA Non-reducing polyketide synthase aptA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q3S2T9 5.13e-11 68 25 8 288 1 mokA Lovastatin nonaketide synthase mokA Monascus pilosus
Q8J0F5 5.46e-11 68 28 8 271 1 mlcB Compactin diketide synthase mlcB Penicillium citrinum
G4MVZ2 5.52e-11 68 27 10 285 1 ACE1 Polyketide synthase-nonribosomal peptide synthetase ACE1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A0A0M4L8I7 6.22e-11 68 25 10 282 1 aurA Highly reducing polyketide synthase aurA Calcarisporium arbuscula
Q0C9L7 7.33e-11 68 25 10 282 1 ctvA Highly reducing polyketide synthase ctvA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q5BH30 8.41e-11 67 28 4 187 3 mdpG Atrochrysone carboxylic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2T4P1 9.28e-11 67 27 5 233 3 thaQ Polyketide synthase ThaQ Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A0A0A2JW91 9.34e-11 67 29 11 288 1 cnsI Highly reducing polyketide synthase cnsI Penicillium expansum
A0A089FSA4 1.04e-10 67 25 8 292 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
A0A2L0P0K3 1.06e-10 67 25 9 286 1 TwmB Polyketide synthase-nonribosomal peptide synthetase TwmB Talaromyces wortmannii
Q02579 1.12e-10 66 26 9 254 3 curB Putative polyketide beta-ketoacyl synthase 2 Streptomyces cyaneus
Q2HEW5 2.1e-10 66 26 11 284 2 cheA PKS-NRPS hybrid synthetase cheA Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
G4N137 2.44e-10 66 27 7 274 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G2Q9A5 2.59e-10 66 25 8 290 1 mycA Hybrid PKS-NRPS synthetase mycA Thermothelomyces thermophilus (strain ATCC 42464 / BCRC 31852 / DSM 1799)
A0A1B3PEI8 2.59e-10 66 27 4 200 1 ORF-B Polyunsaturated fatty acid synthase subunit B Thraustochytrium sp. (strain ATCC 26185 / S-3)
A0A1V6PAF7 2.64e-10 66 25 7 280 1 calA Highly reducing polyketide synthase calA Penicillium decumbens
P9WET0 2.72e-10 66 30 8 206 1 Preu9 Polyketide synthase-like protein Preu9 Preussia isomera
A0A8F4S8Q3 2.73e-10 66 26 7 281 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
A0A3G9K3K9 2.92e-10 66 27 7 244 1 hisps Hispidin synthase Neonothopanus nambi
A0A2Z5TM64 3.88e-10 65 25 7 280 3 himA Polyketide synthase-nonribosomal peptide synthetase hybrid himA Aspergillus japonicus
S7RK07 4.44e-10 65 27 9 286 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Gloeophyllum trabeum (strain ATCC 11539 / FP-39264 / Madison 617)
G3KLH6 4.54e-10 65 27 5 217 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger
B8NYX0 4.6e-10 65 30 6 211 2 fluP Cluster 41 polyketide synthase Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A2QX22 4.63e-10 65 27 5 217 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
G1XU04 4.91e-10 65 25 5 228 1 AOL_s00215g283 6-methylsalicylic acid synthase AOL_s00215g283 Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491)
A1CLY8 6.29e-10 65 26 10 285 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
P9WQE5 6.7e-10 65 30 3 197 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE4 6.7e-10 65 30 3 197 3 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TXL9 6.7e-10 65 30 3 197 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
G0REX6 6.96e-10 65 29 10 282 1 iliA Hybrid PKS-NRPS synthetase iliA Hypocrea jecorina (strain QM6a)
A0A345BJN0 7.23e-10 65 23 5 267 1 clz14 Squalestatin hexaketide synthase clz14 Cochliobolus lunatus
P0DO30 7.56e-10 65 25 9 302 1 iliA Hybrid PKS-NRPS synthetase iliA Neonectria sp. (strain DH2)
Q0UK48 7.97e-10 64 25 6 270 1 sthA Highly reducing polyketide synthase sthA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A3G1DJF3 8.18e-10 64 23 5 267 2 pks2 Squalestatin hexaketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A0A017SEX7 8.41e-10 64 23 10 327 1 fogA Highly reducing polyketide synthase fogA Aspergillus ruber (strain CBS 135680)
A0A098D8A0 8.62e-10 64 25 5 270 2 ZEA2 Highly reducing polyketide synthase ZEA2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A411L027 1.02e-09 64 28 14 295 3 buaA Hybrid PKS-NRPS synthetase buaA Petromyces alliaceus
Q0C8M3 1.31e-09 64 25 8 288 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9Y8A5 1.42e-09 63 25 8 288 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus
A0A3T0QHT6 1.59e-09 63 24 7 277 1 pvhA Hybrid PKS-NRPS synthetase pvhA Talaromyces variabilis
L7X8J4 1.67e-09 63 25 6 270 1 curS1 Highly reducing polyketide synthase curS1 Aspergillus terreus
Q00681 2.88e-09 63 27 9 285 2 stcJ Fatty acid synthase alpha subunit stcJ Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q05357 3.21e-09 62 24 11 419 3 sch2 Putative polyketide beta-ketoacyl synthase 2 Streptomyces halstedii
M2YKT6 3.85e-09 62 26 9 286 2 hps1 Hybrid PKS-NRPS synthetase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
K2QYX5 5.13e-09 62 28 4 205 1 mpsA Hybrid PKS-NRPS synthetase mpsA Macrophomina phaseolina (strain MS6)
A0A0S6XH49 5.67e-09 62 24 6 279 1 frbB Highly reducing polyketide synthase frbB Fungal sp. (strain No.11243)
I1S166 5.88e-09 62 24 7 291 2 FSL1 Fusarielin synthase FSL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
V5Y0F7 6.68e-09 62 28 6 247 3 AFT16-1 Reducing polyketide synthase AFT16-1 Alternaria alternata
A0A455M2Y3 8.62e-09 61 22 6 266 2 ntnH Highly reducing polyketide synthase ntnH Nectria sp.
G4N296 9.08e-09 61 26 9 269 2 PKS19 Highly reducing polyketide synthase 19 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
P16541 1.48e-08 60 25 12 417 3 gra-orf2 Granaticin polyketide putative beta-ketoacyl synthase 2 Streptomyces violaceoruber
N4WHA7 1.66e-08 60 21 6 270 3 PKS2 Reducing polyketide synthase PKS2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
B3FWS8 2.14e-08 60 23 16 439 1 hpm3 Non-reducing polyketide synthase hmp3 Hypomyces subiculosus
A0A4P8WAE5 2.33e-08 60 28 9 213 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
P0DUK1 2.41e-08 60 24 7 291 3 pspA Highly reducing polyketide synthase pspA Penicillium soppii
B1GVX7 3.65e-08 59 27 5 207 2 BOA6 Reducing polyketide synthase BOA6 Botryotinia fuckeliana (strain B05.10)
A0A2Z5XAL7 6e-08 58 25 7 276 1 phm1 Hybrid PKS-NRPS synthetase phm1 Pyrenochaetopsis sp.
B3FWT3 6.35e-08 58 26 6 271 1 hpm8 Reducing polyketide synthase hmp8 Hypomyces subiculosus
A0A0F7GFS4 7.73e-08 58 26 8 267 1 tasS Hybrid PKS-NRPS synthetase tasS Hapsidospora irregularis
S0EET5 9.53e-08 58 25 7 283 2 PKS19 Polyketide synthase 19 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
B8NJG3 1.24e-07 57 24 7 275 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
P9WET7 1.41e-07 57 26 9 270 2 Preu2 Reducing polyketide synthase Preu2 Preussia isomera
A0A098D6U0 2.19e-07 57 25 11 281 1 ZEA1 Non-reducing polyketide synthase ZEA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A0N7D4P6 2.47e-07 57 25 5 270 2 Dhc3 Highly reducing polyketide synthase Dhc3 Alternaria cinerariae
A0A1U8QN18 2.96e-07 56 24 10 306 1 sdgA Highly reducing polyketide synthase sdgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A7L8UVC9 4.71e-07 56 26 11 282 3 ffsA Polyketide synthase-nonribosomal peptide synthetase ffsA Aspergillus flavipes
S0EMV0 7.24e-07 55 25 4 228 1 GPY1 Highly reducing polyketide synthase GPY1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
P23156 1.29e-06 53 24 3 232 3 SCO5317 Putative polyketide beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A0A068ABB7 4.3e-06 53 31 3 129 1 Bref-PKS Highly reducing polyketide synthase Eupenicillium brefeldianum
S4W172 8.58e-06 52 23 7 286 1 eqxS Equisetin synthetase eqxS Fusarium heterosporum
A0A0E4AZP0 9.69e-06 52 23 7 286 3 fsa1 Hybrid PKS-NRPS synthetase fsa1 Fusarium sp. (strain FN080326)
S0DS59 1.84e-05 50 24 9 281 2 PKS-NRPS1 Trichosetin synthetase PKS-NRPS1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
G3J9P0 2.68e-05 50 28 4 184 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Cordyceps militaris (strain CM01)
M2YJJ3 5.78e-05 49 24 14 407 2 hexA Fatty acid synthase alpha subunit hexA Dothistroma septosporum (strain NZE10 / CBS 128990)
A0A084R1H6 0.000217 47 24 6 215 3 ATR6 Highly reducing polyketide synthase ATR6 Stachybotrys chlorohalonata (strain IBT 40285)
I1R9A6 0.000851 45 22 9 263 3 FG00036 Fatty acid synthase subunit alpha Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
G8BAW7 0.001 45 24 10 262 2 FAS2 Fatty acid synthase subunit alpha Candida parapsilosis (strain CDC 317 / ATCC MYA-4646)
Q0V6Q6 0.001 45 27 12 262 1 phmA Polyketide synthase-nonribosomal peptide synthetase phmA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS12015
Feature type CDS
Gene -
Product beta-ketoacyl-ACP synthase
Location 556693 - 557919 (strand: 1)
Length 1227 (nucleotides) / 408 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3653
Orthogroup size 4
N. genomes 2

Actions

Genomic region

Domains

PF00109 Beta-ketoacyl synthase, N-terminal domain
PF02801 Beta-ketoacyl synthase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0304 Lipid transport and metabolism (I)
Secondary metabolites biosynthesis, transport and catabolism (Q)
IQ 3-oxoacyl-(acyl-carrier-protein) synthase

Protein Sequence

MNHRVVITGMGGVCAFGENWDAVKARILKGENAVQVMPEWAEFDGLNTQLAAPIPEFILPEHYTRKKIRSMGRVSLLATRASELALTDAGLIDDPVLTSGETGIAYGSSTGSTKPVSEFATMLTEKHTHNITGTTYVQMMPHTTAVNAGLFFGLRGRVIPTSSACTSGSQAIGYAYEAIRHGYQTVMVAGGGEELCPSESAVFDTLFATSQKNDAPKTTPAPFDAARDGLVIGEGAGTLILENYEHALARGATIYGEILGFATNCDAAHITQPKIETIQICIEKALKNAGLQPQDIGYISAHGTGTERGDIAESQATANIFGKNTPVSSLKSYFGHTLGACGALEAWMSLAMMREGWFAQTLNLNNPDPQCGELDYIMGAPRKIDTGIIQTNNFAFGGINTSIVISRV

Flanking regions ( +/- flanking 50bp)

ATCGCGGGCTATGTCACCCGGCAGGTTATTTCAGTCAACGGAGGTATGTTATGAATCATCGGGTCGTTATCACCGGAATGGGTGGCGTCTGTGCCTTCGGCGAAAACTGGGATGCGGTTAAAGCACGGATACTGAAAGGCGAAAATGCCGTTCAGGTGATGCCTGAATGGGCTGAATTTGACGGGTTGAATACTCAGTTGGCAGCACCAATTCCGGAATTTATTCTGCCGGAGCACTATACCCGTAAAAAAATCCGCTCAATGGGACGGGTTTCCCTGCTGGCGACCCGTGCCAGTGAACTGGCGCTGACAGATGCGGGGCTGATTGACGACCCGGTGTTAACCAGCGGAGAAACGGGGATAGCTTACGGCTCTTCAACCGGCAGCACCAAACCGGTCAGTGAATTTGCCACTATGCTGACGGAAAAACACACGCACAATATTACCGGTACAACTTATGTTCAGATGATGCCGCATACCACAGCCGTTAACGCCGGGTTATTTTTCGGTTTACGGGGGCGCGTTATCCCGACTTCCAGCGCCTGTACTTCCGGCAGTCAGGCGATTGGCTATGCTTATGAAGCCATCCGTCATGGTTACCAGACGGTGATGGTTGCCGGCGGTGGCGAAGAACTGTGTCCGTCTGAATCCGCAGTATTTGATACCTTGTTTGCCACCAGCCAGAAAAACGACGCGCCGAAAACCACACCGGCGCCGTTTGACGCAGCCCGTGACGGGCTGGTTATCGGCGAAGGCGCAGGCACGTTAATCCTGGAAAATTACGAGCACGCCCTTGCACGCGGAGCTACTATTTACGGGGAAATTCTCGGCTTTGCCACTAACTGTGACGCGGCACATATCACGCAGCCTAAAATCGAAACTATCCAGATTTGTATCGAAAAAGCCCTGAAAAATGCCGGGTTGCAACCGCAGGATATCGGCTATATCAGTGCGCACGGTACAGGAACGGAGCGGGGCGATATTGCAGAAAGTCAGGCGACGGCGAATATTTTCGGCAAGAATACCCCGGTTTCTTCCCTGAAAAGCTATTTTGGTCATACGCTCGGCGCCTGTGGTGCGCTGGAAGCCTGGATGAGCCTGGCGATGATGCGTGAGGGCTGGTTTGCACAAACCCTGAACCTGAATAATCCTGATCCTCAGTGCGGAGAGCTTGATTACATCATGGGTGCGCCGCGTAAAATTGATACCGGGATTATTCAGACCAATAACTTTGCATTCGGGGGTATTAATACCTCGATTGTGATAAGCCGCGTCTGACCTGATGCACTGCACAGACCGTGTTGTTATCTGGCTGGCGGATATTGCGG