Homologs in group_98

Help

11 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14705 FBDBKF_14705 31.5 Morganella morganii S1 fabF beta-ketoacyl-ACP synthase II
EHELCC_15510 EHELCC_15510 31.5 Morganella morganii S2 fabF beta-ketoacyl-ACP synthase II
NLDBIP_16040 NLDBIP_16040 31.5 Morganella morganii S4 fabF beta-ketoacyl-ACP synthase II
LHKJJB_15800 LHKJJB_15800 31.5 Morganella morganii S3 fabF beta-ketoacyl-ACP synthase II
HKOGLL_14920 HKOGLL_14920 31.5 Morganella morganii S5 fabF beta-ketoacyl-ACP synthase II
F4V73_RS07500 F4V73_RS07500 32.0 Morganella psychrotolerans fabF beta-ketoacyl-ACP synthase II
F4V73_RS12015 F4V73_RS12015 30.1 Morganella psychrotolerans - beta-ketoacyl-ACP synthase
PMI_RS03710 PMI_RS03710 17.2 Proteus mirabilis HI4320 - 3-oxoacyl-ACP synthase
PMI_RS04235 PMI_RS04235 31.5 Proteus mirabilis HI4320 fabF beta-ketoacyl-ACP synthase II
PMI_RS14370 PMI_RS14370 19.8 Proteus mirabilis HI4320 - beta-ketoacyl synthase N-terminal-like domain-containing protein
PMI_RS14375 PMI_RS14375 31.4 Proteus mirabilis HI4320 - beta-ketoacyl-[acyl-carrier-protein] synthase family protein

Distribution of the homologs in the orthogroup group_98

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_98

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P73283 6.79e-38 144 29 11 410 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6GIA3 7.41e-38 144 30 17 417 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MRSA252)
Q8NXE1 8.04e-38 144 30 17 417 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MW2)
Q6GAU2 8.04e-38 144 30 17 417 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MSSA476)
Q5HHA1 8.04e-38 144 30 17 417 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain COL)
Q7A6F8 8.38e-38 144 30 17 417 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain N315)
Q99VA6 8.38e-38 144 30 17 417 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5TKS0 2.6e-37 142 30 17 415 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 (Fragment) Staphylococcus aureus
P56902 3.14e-37 142 36 8 265 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Rhizobium meliloti (strain 1021)
Q9D404 1.56e-36 141 37 6 269 1 Oxsm 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Mus musculus
Q9NWU1 2.49e-36 140 37 6 270 1 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Homo sapiens
P06231 2.73e-36 139 35 7 264 3 nodE Nodulation protein E Rhizobium meliloti
P06230 2.81e-36 139 35 7 264 3 nodE Nodulation protein E Rhizobium meliloti (strain 1021)
Q9KQH9 2.92e-36 139 29 13 417 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P04683 2.92e-36 139 35 8 265 3 nodE Nodulation protein E Rhizobium leguminosarum bv. viciae
O34340 3.18e-35 137 35 7 252 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Bacillus subtilis (strain 168)
P72331 1.27e-34 135 33 6 262 3 nodE Nodulation protein E Rhizobium sp. (strain N33)
P55338 7.06e-34 133 28 15 423 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio harveyi
Q8L3X9 1.41e-33 133 34 6 265 1 KAS 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Arabidopsis thaliana
O94297 2.19e-33 132 34 7 275 3 SPBC887.13c Putative 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q83E37 2.46e-33 132 31 9 325 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P04684 4.79e-32 128 35 8 260 3 nodE Nodulation protein E Rhizobium leguminosarum bv. trifolii
Q89AY4 6.14e-31 125 29 16 410 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P23902 2.24e-30 124 30 10 317 1 KAS12 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Hordeum vulgare
P43710 2.47e-30 123 34 7 264 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AAI8 2.96e-30 123 34 8 266 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Shigella flexneri
P0AAI5 2.96e-30 123 34 8 266 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli (strain K12)
P0AAI6 2.96e-30 123 34 8 266 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAI7 2.96e-30 123 34 8 266 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O157:H7
P9WQD7 1.55e-29 121 34 5 249 1 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD6 1.55e-29 121 34 5 249 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63457 1.55e-29 121 34 5 249 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0VCA7 6.86e-29 120 35 10 274 2 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Bos taurus
O69473 1.28e-27 116 32 5 249 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium leprae (strain TN)
Q02578 3.16e-27 115 30 9 353 3 curA Putative polyketide beta-ketoacyl synthase 1 Streptomyces cyaneus
P52410 1.51e-26 114 31 8 276 1 KAS1 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Arabidopsis thaliana
P16538 1.71e-26 113 30 6 268 1 tcmK Tetracenomycin polyketide synthase ketoacyl synthase alpha subunit Streptomyces glaucescens
P23155 2.24e-26 112 30 8 323 3 SCO5318 Putative polyketide beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P9WQD9 4.8e-26 111 31 10 314 1 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD8 4.8e-26 111 31 10 314 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
H8ESN0 4.8e-26 111 31 10 314 2 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
P63455 4.8e-26 111 31 10 314 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9C9P4 3.35e-25 110 35 9 268 1 KAS2 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic Arabidopsis thaliana
P57193 3.8e-25 108 26 14 409 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q02K94 1.54e-24 107 28 17 416 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02059 2.67e-24 107 32 9 260 1 SCO5087 Actinorhodin polyketide putative beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P0A953 4.12e-24 106 30 6 263 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli (strain K12)
P0A954 4.12e-24 106 30 6 263 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9CBS7 7.31e-24 105 27 13 371 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium leprae (strain TN)
Q05356 1.31e-23 104 31 6 270 3 sch1 Putative polyketide beta-ketoacyl synthase 1 Streptomyces halstedii
P39525 1.25e-22 102 30 9 272 1 CEM1 3-oxoacyl-[acyl-carrier-protein] synthase homolog Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P41175 1.67e-21 99 31 10 262 3 None Putative polyketide beta-ketoacyl synthase 1 Streptomyces virginiae
P16540 2.1e-20 95 30 9 263 3 gra-orf1 Granaticin polyketide putative beta-ketoacyl synthase 1 Streptomyces violaceoruber
Q869X2 1.1e-18 92 30 12 287 3 pks17 Probable polyketide synthase 17 Dictyostelium discoideum
Q869W9 1.71e-18 91 30 12 287 2 pks16 Probable polyketide synthase 16 Dictyostelium discoideum
A0R1E8 4.61e-17 87 32 6 243 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8KA28 4.68e-17 85 29 8 265 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P43678 5.65e-17 85 25 5 257 3 None Oxytetracycline polyketide putative beta-ketoacyl synthase 1 Streptomyces rimosus
P40804 8.27e-17 85 30 6 264 1 pksF Polyketide biosynthesis malonyl-ACP decarboxylase PksF Bacillus subtilis (strain 168)
A0A0A0RM07 1.22e-16 85 33 6 206 1 MLNS Mellein synthase Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q54T36 3.85e-16 84 26 11 287 3 pks19 Probable polyketide synthase 19 Dictyostelium discoideum
Q558Y6 1.35e-15 82 27 9 280 3 pks14 Probable polyketide synthase 14 Dictyostelium discoideum
P9WET6 2.35e-15 82 29 12 286 1 Preu3 Non-reducing polyketide synthase Preu3 Preussia isomera
Q84HC6 2.85e-15 81 28 9 274 1 ncsB Neocarzinostatin naphthoate synthase Streptomyces carzinostaticus
Q03133 4.86e-15 80 28 8 273 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
Q03133 1.38e-08 60 29 4 174 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
A0A348HAX6 4.93e-15 80 28 8 277 1 phiA Highly reducing polyketide synthase phiA Fungal sp. (strain ATCC 74256)
B0G138 5.34e-15 80 26 10 280 3 pks21 Probable polyketide synthase 21 Dictyostelium discoideum
B3FWT6 5.96e-15 80 25 7 281 1 rdc1 Non-reducing polyketide synthase rdc1 Metacordyceps chlamydosporia
B0G103 9.46e-15 80 27 11 281 3 pks10 Probable polyketide synthase 10 Dictyostelium discoideum
O53901 9.95e-15 80 31 4 198 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P96284 1e-14 79 27 7 267 1 pks15 Putative inactive phenolphthiocerol synthesis polyketide synthase type I Pks15 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q0CF73 1.02e-14 80 27 7 264 1 ATEG_07661 Non-reducing polyketide synthase ATEG_07661 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
F2PWS5 1.08e-14 79 28 9 273 3 nscA Non-reducing polyketide synthase nscA Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2S6Z9 1.17e-14 79 28 9 273 3 nscA Non-reducing polyketide synthase nscA Trichophyton tonsurans (strain CBS 112818)
I6X8D2 1.18e-14 79 27 5 265 1 pks13 Polyketide synthase Pks13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q55E72 1.27e-14 79 28 9 286 1 stlA Probable polyketide synthase 1 Dictyostelium discoideum
Q5W262 1.34e-14 79 31 6 201 1 pigJ Beta-ketoacyl synthase PigJ Serratia sp. (strain ATCC 39006)
Q54IX3 1.96e-14 79 29 10 268 3 pks26 Probable polyketide synthase 26 Dictyostelium discoideum
F2T0M0 2.05e-14 79 28 9 273 3 nscA Non-reducing polyketide synthase nscA Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
D4AWH3 2.05e-14 79 28 9 273 3 nscA Non-reducing polyketide synthase nscA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
E9F8M3 2.43e-14 79 29 9 273 1 swnK PKS-NRPS hybrid synthetase swnK Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A089QRB9 2.5e-14 78 34 7 197 1 msl3 Mycolipanoate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7TXK8 3.53e-14 78 27 7 267 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
D4CZZ2 3.77e-14 78 28 9 273 3 nscA Non-reducing polyketide synthase nscA Trichophyton verrucosum (strain HKI 0517)
Q5BEJ6 6.18e-14 77 27 7 269 1 afoE Iterative polyketide synthase afoE Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54TW0 6.34e-14 77 26 9 281 2 pks18 Probable polyketide synthase 18 Dictyostelium discoideum
B0G101 6.99e-14 77 29 11 277 3 pks8 Probable polyketide synthase 8/35 Dictyostelium discoideum
A0A5C1RDA3 8.27e-14 77 28 12 339 3 orf7 Highly reducing polyketide synthase Didymella fabae
B8N8R0 8.54e-14 77 25 10 328 2 afvB Non-reducing polyketide synthase afvB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
C5FM57 8.58e-14 77 28 9 273 3 nscA Non-reducing polyketide synthase nscA Arthroderma otae (strain ATCC MYA-4605 / CBS 113480)
P9WET3 8.98e-14 77 26 13 330 1 Preu8 Non-reducing polyketide synthase Preu8 Preussia isomera
A0A0B4I1J8 1.09e-13 76 25 9 325 2 Pks2 Polyketide synthase 2 Metarhizium majus (strain ARSEF 297)
Q4WA61 1.1e-13 76 27 9 273 3 nscA Non-reducing polyketide synthase nscA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
E4V2N2 1.22e-13 76 27 9 273 3 nscA Non-reducing polyketide synthase nscA Arthroderma gypseum (strain ATCC MYA-4604 / CBS 118893)
B2HIL7 1.23e-13 76 30 8 227 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium marinum (strain ATCC BAA-535 / M)
A2QK66 1.88e-13 75 25 10 328 3 ktnS Kotanin synthase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A2G5IC96 1.94e-13 75 27 9 273 3 CTB1 Non-reducing polyketide synthase CTB1 Cercospora beticola
Q03132 2.17e-13 75 29 12 293 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
Q03132 9.68e-11 67 26 8 319 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
Q07017 2.21e-13 75 28 9 273 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
Q07017 1.38e-12 73 28 9 280 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
A0A2I2F262 2.92e-13 75 30 11 278 1 acdB PKS-NRPS hybrid synthetase acdB Aspergillus candidus
Q86JI5 2.92e-13 75 28 10 271 2 pks5 Probable polyketide synthase 5 Dictyostelium discoideum
P9WET8 3.04e-13 75 28 9 266 2 Preu1 Highly reducing polyketide synthase Preu1 Preussia isomera
Q5ATG8 3.18e-13 75 29 12 284 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B3FWU0 3.63e-13 75 27 12 322 1 rdc5 Reducing polyketide synthase rdc5 Metacordyceps chlamydosporia
I6XD69 4.17e-13 75 29 6 227 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
I6XD69 5.16e-13 74 29 6 227 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A5C1RD96 4.67e-13 74 27 8 268 3 pksAC Non-reducing polyketide synthase AC Didymella fabae
Q6DQW3 4.91e-13 74 27 9 273 1 CTB1 Non-reducing polyketide synthase CTB1 Cercospora nicotianae
A0A8D5M692 5.14e-13 74 30 5 238 1 esdpA Non-reducing polyketide synthase esdpA Penicillium shearii
Q54FQ1 5.2e-13 74 26 7 271 3 pks31 Probable polyketide synthase 31 Dictyostelium discoideum
Q9ZGI5 9.27e-13 73 28 12 276 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 1.91e-12 72 28 8 271 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 8.83e-10 64 28 10 278 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q0CJ59 9.75e-13 73 29 7 231 1 atX 6-methylsalicylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A0N9HNS9 9.77e-13 73 25 10 321 3 desS Desertorin synthase Aspergillus desertorum
Q54FN7 9.95e-13 73 25 7 275 3 pks33 Probable polyketide synthase 33 Dictyostelium discoideum
A1D8I9 1.08e-12 73 27 9 273 3 nscA Non-reducing polyketide synthase nscA Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A0A098D6U0 1.13e-12 73 26 13 321 1 ZEA1 Non-reducing polyketide synthase ZEA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A075TRC0 1.17e-12 73 31 9 230 1 patK 6-methylsalicylic acid synthase Penicillium expansum
A0A3G9H990 1.28e-12 73 27 10 279 1 ALT1 Highly reducing polyketide synthase ALT1 Alternaria alternata
Q02251 1.4e-12 73 29 7 270 1 mas Mycocerosic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q03131 1.54e-12 73 30 6 211 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03131 3.06e-11 69 31 4 173 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
P12276 1.55e-12 73 25 8 264 1 FASN Fatty acid synthase Gallus gallus
A7UMW1 1.82e-12 72 25 13 346 2 PKS1 Non-reducing polyketide synthase 1 Elsinoe fawcettii
Q54FD2 1.89e-12 72 26 8 279 3 pks38 Probable polyketide synthase 38 Dictyostelium discoideum
G0R6S9 1.91e-12 72 29 7 265 2 sor2 Non-reducing polyketide synthase sor2 Hypocrea jecorina (strain QM6a)
Q54ED7 1.95e-12 72 27 10 280 3 pks40 Probable polyketide synthase 40 Dictyostelium discoideum
D4AU31 1.97e-12 72 29 7 230 3 swnK PKS-NRPS hybrid synthetase swnK Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
F9XMW3 2.04e-12 72 24 11 338 3 PKS1 Non-reducing polyketide synthase PKS1 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q54FC8 2.16e-12 72 26 8 279 3 pks39 Probable polyketide synthase 39 Dictyostelium discoideum
S3D9F1 2.17e-12 72 25 10 298 1 gloL Highly reducing polyketide synthase gloL Glarea lozoyensis (strain ATCC 20868 / MF5171)
B0G170 2.35e-12 72 24 7 276 3 pks28 Probable polyketide synthase 28 Dictyostelium discoideum
Q54FN2 2.79e-12 72 25 7 271 3 pks34 Probable polyketide synthase 34 Dictyostelium discoideum
C8VJR7 3.09e-12 72 27 8 282 1 alnA Highly reducing polyketide synthase alnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0K0MCJ4 3.18e-12 72 26 5 265 1 cazM Iterative polyketide synthase CazM Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
B0G100 3.27e-12 72 28 12 275 3 pks7 Probable polyketide synthase 7 Dictyostelium discoideum
N4WHE3 3.48e-12 72 27 9 279 3 PKS1 Reducing polyketide synthase PKS1 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
Q54FP8 3.71e-12 72 26 7 275 3 pks32 Probable polyketide synthase 32 Dictyostelium discoideum
A0A3T0ZHJ0 3.81e-12 72 26 6 270 1 cle1 Triacetic acid lactone synthase cle1 Aspergillus versicolor
E9KMQ2 4.1e-12 71 24 12 330 2 PKS16 Non-reducing polyketide synthase PKS16 Cladonia grayi
Q0UI00 4.5e-12 71 26 12 327 1 elcA Non-reducing polyketide synthase elcA (Fragment) Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q55CN6 4.64e-12 71 25 8 264 3 pks3 Probable polyketide synthase 3 Dictyostelium discoideum
Q9ZGI3 4.64e-12 71 28 11 300 1 pikAIII Narbonolide/10-deoxymethynolide synthase PikA3, module 5 Streptomyces venezuelae
Q86AE3 4.73e-12 71 28 12 276 2 pks9 Probable polyketide synthase 9/36 Dictyostelium discoideum
B8MKY6 4.76e-12 71 27 7 269 1 tstA Highly reducing polyketide synthase tstA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A0Y0M151 4.8e-12 71 28 10 255 1 cla2 Highly reducing polyketide synthase cla2 Cladosporium cladosporioides
P9WES9 5.7e-12 71 25 8 266 1 PFUR17_0229 Non-reducing polyketide synthase PFUR17_0229 Pseudevernia furfuracea
Q2ABP6 6.46e-12 71 25 8 274 1 pksF Reducing polyketide synthase pksF Alternaria solani
I1RLA7 7.22e-12 71 25 9 295 2 FGR1 Highly reducing polyketide synthase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
W7LKX1 7.29e-12 71 27 9 269 2 FUM1 Highly reducing polyketide synthase FUM1 Gibberella moniliformis (strain M3125 / FGSC 7600)
A0A6H0YV38 7.5e-12 70 24 12 322 2 crz7 Non-reducing polyketide synthase crz7 Cladonia metacorallifera
Q9ZGI4 7.59e-12 71 28 10 275 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q9ZGI4 4.08e-11 68 28 10 272 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
A1KQG0 7.65e-12 70 27 8 302 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q54FQ3 7.82e-12 70 26 8 270 3 pks29 Probable polyketide synthase 29 Dictyostelium discoideum
E9ET39 8.01e-12 70 24 9 325 2 Pks2 Polyketide synthase 2 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A0B4H8J1 8.01e-12 70 24 9 325 2 Pks2 Polyketide synthase 2 Metarhizium brunneum (strain ARSEF 3297)
Q54KU3 8.04e-12 70 27 9 270 3 pks25 Probable polyketide synthase 25 Dictyostelium discoideum
P9WQE9 8.22e-12 70 27 8 302 1 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE8 8.22e-12 70 27 8 302 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U9F4 8.22e-12 70 27 8 302 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q7TVK8 8.22e-12 70 27 8 302 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A0B4I1L1 8.38e-12 70 24 9 325 2 Pks2 Polyketide synthase 2 Metarhizium guizhouense (strain ARSEF 977)
A0A193PS74 8.41e-12 70 27 10 279 1 stbA Non-reducing polyketide synthase stbA Stachybotrys bisbyi
G3Y419 8.45e-12 70 28 9 242 1 yanA 6-methylsalicylic acid synthase Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
B0G0Z9 8.89e-12 70 27 11 276 3 pks6 Probable polyketide synthase 6 Dictyostelium discoideum
D7UQ44 9.53e-12 70 29 12 276 1 sol1 Prosolanapyrone synthase Alternaria solani
B8NYX0 1.05e-11 70 29 5 203 2 fluP Cluster 41 polyketide synthase Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
C5H882 1.15e-11 70 26 12 304 3 radS2 Non-reducing polyketide synthase rads2 Floropilus chiversii
B8MYS6 1.18e-11 70 25 13 330 1 pks27 Non-reducing polyketide synthase pks27 Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q54FQ2 1.19e-11 70 26 7 269 3 pks30 Probable polyketide synthase 30 Dictyostelium discoideum
A0A0B4FLB2 1.24e-11 70 24 9 325 2 Pks2 Polyketide synthase 2 Metarhizium anisopliae (strain ARSEF 549)
A0A0U5GK88 1.43e-11 70 28 8 293 1 ausV Highly reducing polyketide synthase ausV Aspergillus calidoustus
Q50LG3 1.44e-11 70 26 7 271 3 AFT9-1 Highly reducing polyketide synthase AFT9-1 Alternaria alternata
K2QVI8 1.44e-11 70 27 8 266 1 dpmpA Non-reducing polyketide synthase dpmpA Macrophomina phaseolina (strain MS6)
A0A455R5P9 1.76e-11 69 28 9 280 1 ascC Non-reducing polyketide synthase ascC Acremonium egyptiacum
Q7TXM0 1.86e-11 69 31 13 284 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0CU84 1.94e-11 69 28 12 280 1 apmlA Highly reducing polyketide synthase apmlA Arthrinium phaeospermum
A0A482N9V7 2.15e-11 69 28 11 273 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
Q9R9J1 2.25e-11 69 31 5 197 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
P9WQE6 2.47e-11 69 31 13 284 3 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A0S6XH49 2.5e-11 69 26 12 357 1 frbB Highly reducing polyketide synthase frbB Fungal sp. (strain No.11243)
A0A2P1DP91 2.52e-11 69 29 8 222 1 macA 6-methylsalicylic acid synthase Penicillium terrestre
Q2T4N1 2.52e-11 69 29 7 231 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 6.83e-09 61 26 10 282 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 9.5e-08 58 29 9 219 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 1.63e-05 51 26 7 241 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P9WQE7 2.54e-11 69 31 13 284 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
G9N4B2 2.93e-11 69 26 7 267 1 virA Highly reducing polyketide synthase virA Hypocrea virens (strain Gv29-8 / FGSC 10586)
A0A481WR96 3.12e-11 68 27 11 258 3 claI Highly reducing polyketide synthase claI Penicillium crustosum
A0A6F9DYX9 3.79e-11 68 23 10 329 1 men2 Non-reducing polyketide synthase men2 Menisporopsis theobromae
Q9ZGI2 3.79e-11 68 28 9 273 1 pikAIV Narbonolide/10-deoxymethynolide synthase PikA4, module 6 Streptomyces venezuelae
Q54G30 4.08e-11 68 25 7 268 3 pks27 Probable polyketide synthase 27 Dictyostelium discoideum
Q559A9 4.36e-11 68 27 10 270 3 pks13 Probable polyketide synthase 13 Dictyostelium discoideum
A0A1B4XBH3 5.07e-11 68 27 8 291 3 sdnO Highly reducing polyketide synthase sdnO Sordaria araneosa
A0A1R3RGK0 5.99e-11 68 30 11 268 1 otaA Highly reducing polyketide synthase otaA Aspergillus carbonarius (strain ITEM 5010)
P96202 7.35e-11 67 31 7 219 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7TXL8 7.35e-11 67 31 7 219 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A6F9DXA0 7.69e-11 67 28 9 271 1 men1 Partially reducing polyketide synthase men1 Menisporopsis theobromae
A0A084B9Z6 8.12e-11 67 27 9 272 3 SAT8 Non-reducing polyketide synthase SAT8 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
A0A443HK81 8.59e-11 67 25 14 327 1 VdtA Non-reducing polyketide synthase VdtA Byssochlamys spectabilis
P40872 9.62e-11 67 29 10 215 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 2.35e-10 66 28 7 220 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 1.06e-05 51 28 8 206 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
Q4WKW9 1.01e-10 67 26 9 277 1 fgnA Fumigermin synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
E9EHG2 1.23e-10 67 25 6 274 2 Pks2 Polyketide synthase 2 Metarhizium acridum (strain CQMa 102)
P49327 1.26e-10 67 29 9 268 1 FASN Fatty acid synthase Homo sapiens
O31782 1.46e-10 67 30 7 213 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 5.11e-09 62 25 7 274 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 7.97e-08 58 27 5 214 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
G3JUI8 1.51e-10 67 27 14 359 1 milA Highly reducing polyketide synthase milA Cordyceps militaris (strain CM01)
A0A0R8YWJ7 1.64e-10 67 26 10 301 1 mpas Methylphloroacetophenone synthase Cladonia uncialis
W7MT31 1.83e-10 66 29 13 273 1 FUB1 Reducing polyketide synthase FUB1 Gibberella moniliformis (strain M3125 / FGSC 7600)
Q0CF75 1.86e-10 66 29 10 272 1 ATEG_07659 Highly reducing polyketide synthase ATEG_07659 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A179H0J7 2.12e-10 66 27 5 222 2 lcsC Highly reducing polyketide synthase lcsC Purpureocillium lilacinum
Q05470 2.16e-10 66 24 9 279 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 1.04e-07 58 29 10 213 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 3.22e-07 56 26 10 274 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 3.35e-05 50 28 8 195 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
A0A0D2YG10 2.2e-10 66 29 13 273 1 FUB1 Reducing polyketide synthase FUB1 Fusarium oxysporum f. sp. lycopersici (strain 4287 / CBS 123668 / FGSC 9935 / NRRL 34936)
A0A125R003 2.26e-10 66 27 8 278 1 cla3 Non-reducing polyketide synthase cla3 Cladosporium cladosporioides
Q54ED6 2.42e-10 66 26 10 279 3 pks41 Probable polyketide synthase 41 Dictyostelium discoideum
P9WEX6 2.42e-10 66 29 2 168 1 dpmaA Non-reducing polyketide synthase dpmaA Metarhizium anisopliae
Q5AZ32 2.76e-10 66 30 8 213 1 pkbA Non-reducing polyketide synthase pkbA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P0DUT7 2.96e-10 66 27 8 285 1 Ba17a Highly reducing polyketide synthase 17 Metarhizium anisopliae
K3VA96 3.07e-10 65 27 8 270 3 PKS40 Highly reducing polyketide synthase 40 Fusarium pseudograminearum (strain CS3096)
D7PHZ2 3.17e-10 65 27 11 276 1 vrtA Non-reducing polyketide synthase vrtA Penicillium aethiopicum
A0A084API3 3.3e-10 65 26 8 283 3 SAT13 Highly reducing polyketide synthase SAT13 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
Q7TXL7 3.43e-10 65 30 5 200 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A443HK66 3.48e-10 65 26 9 276 3 VdtX Highly reducing polyketide synthase VdtX Byssochlamys spectabilis
P9WQE3 3.49e-10 65 30 5 200 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit D Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE2 3.49e-10 65 30 5 200 3 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B8MV59 3.86e-10 65 27 9 274 3 tpeA Partially reducing polyketide synthase tpeA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A0B5KU17 4.3e-10 65 27 11 279 1 mpaC' Non-reducing polyketide synthase mapC' Penicillium brevicompactum
Q7SHI6 4.3e-10 65 28 5 194 2 srdA Highly reducing polyketide synthase srdA Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q54KU5 4.51e-10 65 26 9 270 3 pks24 Probable polyketide synthase 24 Dictyostelium discoideum
Q8J0F5 5.65e-10 65 26 10 304 1 mlcB Compactin diketide synthase mlcB Penicillium citrinum
G0REX6 6.09e-10 65 30 10 266 1 iliA Hybrid PKS-NRPS synthetase iliA Hypocrea jecorina (strain QM6a)
B8MV60 6.63e-10 65 26 15 331 3 tpeB Non-reducing polyketide synthase tpeB Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A1W5T1T1 6.67e-10 65 26 11 268 2 poxF Highly reducing polyketide synthase poxF Penicillium oxalicum
E9F5E7 7.49e-10 64 29 2 168 1 subA Non-reducing polyketide synthase subA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
P0DUK1 7.88e-10 64 24 7 310 3 pspA Highly reducing polyketide synthase pspA Penicillium soppii
Q3S2U6 9.24e-10 64 27 12 306 1 mokB Lovastatin diketide synthase mokB Monascus pilosus
P40806 9.51e-10 64 25 9 277 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 3.07e-07 56 25 9 280 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 5.75e-06 52 28 4 160 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
Q5B0D0 1.05e-09 64 26 10 274 1 aptA Non-reducing polyketide synthase aptA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54FI3 1.12e-09 64 26 13 309 1 StlB Polyketide synthase 37 Dictyostelium discoideum
Q2HBN0 1.19e-09 64 29 9 267 1 cghG Hybrid PKS-NRPS synthetase cghG Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A161CEU9 1.46e-09 63 26 9 280 1 citS Citrinin polyketide synthase Monascus ruber
Q65Z23 1.46e-09 63 26 9 280 1 pksCT Citrinin polyketide synthase Monascus purpureus
S7Z800 1.61e-09 63 29 14 293 3 opdA Hybrid PKS-NRPs synthetase opdA Penicillium oxalicum (strain 114-2 / CGMCC 5302)
S0DRI1 1.66e-09 63 28 12 273 1 FUB1 Reducing polyketide synthase FUB1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A0N7D745 1.76e-09 63 25 11 285 2 Dhc5 Non-reducing polyketide synthase Dhc5 Alternaria cinerariae
A0A4P8DJU2 1.78e-09 63 26 12 276 3 dmx-nrPKS Atrochrysone carboxylic acid synthase Cryptosporiopsis sp. (strain 8999)
A0A2L0P0K3 1.86e-09 63 29 11 274 1 TwmB Polyketide synthase-nonribosomal peptide synthetase TwmB Talaromyces wortmannii
Q55DM7 2.01e-09 63 27 11 270 3 pks2 Probable polyketide synthase 2 Dictyostelium discoideum
A0A1W7M1U5 2.07e-09 63 25 12 330 1 pgmA Non-reducing polyketide synthase pgmA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
F1DBA9 2.09e-09 63 27 11 279 1 mpaC Non-reducing polyketide synthase mapC Penicillium brevicompactum
L7XAV2 2.3e-09 63 24 10 290 1 curS2 Non-reducing polyketide synthase curS2 Aspergillus terreus
B6HN77 2.38e-09 63 27 10 265 3 sorB Non-reducing polyketide synthase sorB Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
S7RK07 2.85e-09 62 28 9 225 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Gloeophyllum trabeum (strain ATCC 11539 / FP-39264 / Madison 617)
Q5KTM9 2.9e-09 62 24 10 356 1 alt5 Highly reducing polyketide synthase alt5 Alternaria solani
A2QTE9 2.91e-09 62 27 8 256 3 epaA Non-reducing polyketide synthase epaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
G1XU04 2.93e-09 62 28 9 232 1 AOL_s00215g283 6-methylsalicylic acid synthase AOL_s00215g283 Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491)
G3XMC4 3.01e-09 62 27 8 256 1 azaA Non-reducing polyketide synthase azaA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
P12785 3.48e-09 62 28 8 264 1 Fasn Fatty acid synthase Rattus norvegicus
A0A1L9WN37 3.52e-09 62 29 7 210 1 acuA 6-methylsalicylic acid synthase acuA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A017SEX7 3.53e-09 62 29 3 168 1 fogA Highly reducing polyketide synthase fogA Aspergillus ruber (strain CBS 135680)
B6HNK3 3.61e-09 62 27 9 268 3 sorA Highly reducing polyketide synthase sorA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
W6QL47 3.7e-09 62 27 11 277 3 mpaC Non-reducing polyketide synthase mapC Penicillium roqueforti (strain FM164)
P9WET2 4.09e-09 62 26 11 278 1 Preu6 Non-reducing polyketide synthase Preu6 Preussia isomera
G4N296 4.23e-09 62 26 5 204 2 PKS19 Highly reducing polyketide synthase 19 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q4W944 4.55e-09 62 24 7 270 1 encA Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
S0EEY3 4.68e-09 62 31 13 272 1 FUS1 Fusarin C synthetase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
P9WQE1 5.27e-09 62 29 9 237 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE0 5.27e-09 62 29 9 237 3 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
G0R6S8 5.31e-09 62 27 9 269 2 sor1 Highly reducing polyketide synthase sor1 Hypocrea jecorina (strain QM6a)
Q7TXL6 5.37e-09 62 29 9 237 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A6S5ZY48 5.4e-09 62 25 9 266 2 g433 Highly reducing polyketide synthase g433 Fusarium sp.
A0A481WQB6 5.96e-09 62 29 7 219 1 claF Clavatol synthase claF Penicillium crustosum
Q54QD3 6.21e-09 62 25 13 316 3 pks22 Probable polyketide synthase 22 Dictyostelium discoideum
S0DS59 6.54e-09 62 27 9 265 2 PKS-NRPS1 Trichosetin synthetase PKS-NRPS1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A5PHD6 6.54e-09 61 30 7 217 1 aspks1 3-methylorcinaldehyde synthase Sarocladium schorii
W3X7U2 7.89e-09 61 23 11 337 2 PfmaE Conidial pigment polyketide synthase PfmaE Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
Q5AUX7 8.25e-09 61 27 6 228 1 dbaI Non-reducing polyketide synthase dbaI Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9Y7D5 8.3e-09 61 25 10 301 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus
A0A1L7U3D7 8.58e-09 61 25 8 284 2 FPY1 Highly reducing polyketide synthase 40 Fusarium mangiferae
Q54QD1 8.74e-09 61 24 12 315 3 pks23 Probable polyketide synthase 23 Dictyostelium discoideum
W3X8X8 8.88e-09 61 27 6 209 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
A0A0S2CHA9 9.11e-09 61 28 12 279 1 pigA Non-reducing polyketide synthase pigA Monascus ruber
B6QK81 9.87e-09 61 25 8 272 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN6 9.87e-09 61 25 8 272 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei
Q5B8A0 1.01e-08 61 27 9 274 1 pkfA Non-reducing polyketide synthase pkfA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
W7MLD7 1.01e-08 61 30 12 277 1 FUS1 Fusarin C synthetase Gibberella moniliformis (strain M3125 / FGSC 7600)
Q0CRQ5 1.05e-08 61 28 7 214 1 ATEG_03629 5-methylorsellinic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
G3XLL5 1.06e-08 61 23 10 324 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
Q5BEJ4 1.07e-08 61 28 11 275 1 afoG Asperfuranone polyketide synthase afoG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2HEW5 1.09e-08 61 27 11 283 2 cheA PKS-NRPS hybrid synthetase cheA Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
B6F209 1.12e-08 61 28 13 277 1 cpaA Cyclo-acetoacetyl-L-tryptophan synthase Aspergillus oryzae
Q5AXA9 1.2e-08 60 25 9 275 1 pkgA Non-reducing polyketide synthase pkgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A2QUI2 1.28e-08 60 23 10 324 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P9WET0 1.47e-08 60 29 10 245 1 Preu9 Polyketide synthase-like protein Preu9 Preussia isomera
Q558W4 1.48e-08 60 24 9 285 3 pks15 Probable polyketide synthase 15 Dictyostelium discoideum
A0A1B5L6A0 1.5e-08 60 25 14 330 1 UVI_02036160 Non-reducing polyketide synthase ustP Ustilaginoidea virens
Q00681 1.68e-08 60 30 8 242 2 stcJ Fatty acid synthase alpha subunit stcJ Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P9WEX0 1.77e-08 60 28 4 194 1 dpasA Non-reducing polyketide synthase dpasA Apiospora sacchari
Q0D1N9 1.84e-08 60 25 9 276 1 terA Non-reducing polyketide synthase terA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A7R7ZK98 1.87e-08 60 29 8 209 3 AcPKS Atrochrysone carboxylic acid synthase Aspergillus chevalieri
P9WET1 1.91e-08 60 24 10 273 1 Preu7 Non-reducing polyketide synthase Preu7 Preussia isomera
I1RL11 1.98e-08 60 26 9 268 1 dpfgA Non-reducing polyketide synthase dpfgA Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A6J4B487 2.11e-08 60 30 12 270 3 LUC5 Hybrid PKS-NRPS synthetase LUC5 Fusarium sp.
I1RVD8 2.22e-08 60 28 13 270 3 PKS6 Highly reducing polyketide synthase PKS6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q12053 2.33e-08 60 24 12 325 1 aflC Norsolorinic acid synthase Aspergillus parasiticus (strain ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1)
P0DO30 2.37e-08 60 31 12 277 1 iliA Hybrid PKS-NRPS synthetase iliA Neonectria sp. (strain DH2)
Q0CS88 2.4e-08 60 28 5 214 2 tazB Highly reducing polyketide synthase tazB Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q71SP7 2.61e-08 60 29 11 270 1 FASN Fatty acid synthase Bos taurus
I1S166 2.77e-08 59 25 13 369 2 FSL1 Fusarielin synthase FSL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A5ABG0 2.77e-08 59 26 11 271 1 pynA Hybrid PKS-NRPS synthetase pynA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
B3FWS8 3.02e-08 59 23 12 326 1 hpm3 Non-reducing polyketide synthase hmp3 Hypomyces subiculosus
A0A0E4AZP0 3.48e-08 59 28 12 275 3 fsa1 Hybrid PKS-NRPS synthetase fsa1 Fusarium sp. (strain FN080326)
B3FWT3 3.59e-08 59 26 12 305 1 hpm8 Reducing polyketide synthase hmp8 Hypomyces subiculosus
S0DZM7 3.6e-08 59 24 13 325 1 bik1 Bikaverin polyketide synthase bik1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A3G1DJF3 3.65e-08 59 26 9 272 2 pks2 Squalestatin hexaketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A1CFL8 3.68e-08 59 28 8 210 1 patK 6-methylcalicylic acide synthase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A0A0M4L8I7 4.08e-08 59 28 12 277 1 aurA Highly reducing polyketide synthase aurA Calcarisporium arbuscula
A0A7L9EYL1 4.19e-08 59 28 12 279 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
Q4WQZ5 4.33e-08 59 25 10 273 2 tpcC Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WAZ9 5.39e-08 58 26 9 295 2 NRPS14 PKS-NRPS hybrid synthetase psoA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
R4WH05 5.65e-08 58 26 8 277 3 ACRTS2 Highly reducing polyketide synthase ACRTS2 Alternaria alternata
A0A2I2F2N6 5.89e-08 58 28 4 168 1 cfoA Chalcone synthase cfoA Aspergillus candidus
G0LET7 6.73e-08 58 26 11 266 2 BOA9 Reducing polyketide synthase BOA9 Botryotinia fuckeliana (strain B05.10)
Q4WZA8 7.55e-08 58 24 14 327 1 alb1 Conidial pigment polyketide synthase alb1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P9WET5 7.75e-08 58 25 7 224 1 Preu4 Non-reducing polyketide synthase Preu4 Preussia isomera
A0A068ABB7 7.97e-08 58 26 11 271 1 Bref-PKS Highly reducing polyketide synthase Eupenicillium brefeldianum
B1GVX7 8.21e-08 58 29 13 328 2 BOA6 Reducing polyketide synthase BOA6 Botryotinia fuckeliana (strain B05.10)
M2YKT6 8.95e-08 58 27 10 285 2 hps1 Hybrid PKS-NRPS synthetase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
P19096 9.05e-08 58 26 8 268 1 Fasn Fatty acid synthase Mus musculus
S0DTP6 9.13e-08 58 25 12 330 2 FSR1 Non-reducing polyketide synthase fsr1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
E5A7D9 9.9e-08 58 26 9 276 2 pks5 Highly reducing polyketide synthase pks5 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
S4W172 1.01e-07 58 27 11 274 1 eqxS Equisetin synthetase eqxS Fusarium heterosporum
Q5BG07 1.06e-07 58 28 14 290 1 pkdA Non-reducing polyketide synthase pkdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54B49 1.13e-07 57 23 17 384 3 pks45 Probable polyketide synthase 45 Dictyostelium discoideum
A0A1B3PEI8 1.17e-07 57 27 9 218 1 ORF-B Polyunsaturated fatty acid synthase subunit B Thraustochytrium sp. (strain ATCC 26185 / S-3)
A0A1B7YCC9 1.19e-07 57 27 3 194 1 dpchA Non-reducing polyketide synthase dpchA Colletotrichum higginsianum (strain IMI 349063)
Q0CZH1 1.34e-07 57 25 9 271 2 pytA Hybrid PKS-NRPS synthetase pytA (Fragment) Aspergillus terreus (strain NIH 2624 / FGSC A1156)
S0EMV0 1.41e-07 57 27 6 204 1 GPY1 Highly reducing polyketide synthase GPY1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A142C799 1.43e-07 57 25 7 245 1 phnA Non-reducing polyketide synthase phnA Penicillium herquei
P9WEQ0 1.49e-07 57 27 10 275 3 olcA Non-reducing polyketide synthase olcA Penicillium canescens
O31784 1.63e-07 57 26 11 287 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
O31784 0.000174 47 25 8 217 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
A0A4P8DJV2 1.71e-07 57 23 8 315 3 dmxL2 Highly reducing polyketide synthase dmxL2 Cryptosporiopsis sp. (strain 8999)
A0A345BJN0 1.71e-07 57 25 8 266 1 clz14 Squalestatin hexaketide synthase clz14 Cochliobolus lunatus
A0A1B3PEI6 1.76e-07 57 26 6 227 1 ORF-A Polyunsaturated fatty acid synthase subunit A Thraustochytrium sp. (strain ATCC 26185 / S-3)
A0A1L9WLD9 1.83e-07 57 23 7 274 1 AacuL Atrochrysone carboxylic acid synthase AacuL Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
Q2UB00 1.88e-07 57 27 9 274 3 ppsB Reducing polyketide synthase ppsB Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q54B51 1.92e-07 57 23 17 386 3 pks44 Probable polyketide synthase 44 Dictyostelium discoideum
C5H885 1.93e-07 57 25 12 330 3 rads1 Reducing polyketide synthase rads1 Floropilus chiversii
G3KLH6 2.49e-07 56 25 10 271 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger
D9N1A1 2.51e-07 56 27 12 287 2 ACTTS3 Highly reducing polyketide synthase ACTTS3 Alternaria alternata
A0A1L9UCG2 2.52e-07 56 22 10 324 3 albA Non-reducing polyketide synthase albA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A2QX22 2.6e-07 56 25 10 271 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
G3XNF4 2.68e-07 56 27 8 279 1 ATPKS PKS-NRPS hybrid synthetase ATPKS Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
Q2T4N2 2.8e-07 56 27 9 233 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N2 5.63e-06 52 27 8 218 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A0A067XNI2 2.9e-07 56 26 6 197 2 ptaA Non-reducing polyketide synthase ptaA Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
P9WET9 3.13e-07 56 23 10 324 1 PvBS090_009107 Non-reducing polyketide synthase PvBS090_009107 Byssochlamys spectabilis
A0A411PQP9 3.3e-07 56 24 12 279 3 Agnpks1 Atrochrysone carboxylic acid synthase Agnpks1 Paecilomyces divaricatus
P9WEZ4 3.36e-07 56 25 9 270 2 pytA Hybrid PKS-NRPS synthetase pytA Aspergillus terreus
A0A8F4S8Q3 3.37e-07 56 25 8 279 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
B8M9J9 3.87e-07 56 25 8 274 1 tropA 3-methylorcinaldehyde synthase tropA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
P9WES2 4.51e-07 55 25 7 224 1 None Atrochrysone carboxylic acid synthase PKS4 Calonarius odorifer
P22367 4.79e-07 55 28 8 230 1 None 6-methylsalicylic acid synthase Penicillium patulum
I1R9A6 4.8e-07 55 43 2 78 3 FG00036 Fatty acid synthase subunit alpha Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A3T0QHT6 4.82e-07 55 26 9 273 1 pvhA Hybrid PKS-NRPS synthetase pvhA Talaromyces variabilis
Q5BBP8 4.86e-07 55 25 7 269 1 pkhA Non-reducing polyketide synthase pkhA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q0CCY3 4.87e-07 55 24 9 273 1 gedC Atrochrysone carboxylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0C8L6 5.36e-07 55 26 5 207 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q03149 5.67e-07 55 23 10 331 1 wA Conidial yellow pigment biosynthesis polyketide synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0D1DNX1 6.68e-07 55 26 6 212 2 fas2 Fatty acid synthase 2 Ustilago maydis (strain 521 / FGSC 9021)
E9F646 6.99e-07 55 23 7 269 1 Pks1 Polyketide synthase 1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
P9WET4 7.03e-07 55 25 11 302 1 Preu5 Highly reducing polyketide synthase Preu5 Preussia isomera
P9WES1 7.61e-07 55 25 8 224 1 None Atrochrysone carboxylic acid synthase PKS1 Calonarius odorifer
N4WHA7 8.25e-07 55 22 7 273 3 PKS2 Reducing polyketide synthase PKS2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
A0A098D8A0 8.39e-07 55 28 11 252 2 ZEA2 Highly reducing polyketide synthase ZEA2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
E5AE40 8.9e-07 55 26 11 305 2 PKS2 Highly reducing polyketide synthase PKS2 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
Q5BH30 8.99e-07 55 26 6 196 3 mdpG Atrochrysone carboxylic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P36189 9.34e-07 53 25 4 167 1 FASN Fatty acid synthase (Fragment) Anser anser anser
Q5ATJ7 1.1e-06 54 25 9 266 1 ausA Non-reducing polyketide synthase ausA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
G4NEB1 1.17e-06 54 27 7 197 1 NEC1 Highly reducing polyketide synthase NEC1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
B6HV32 1.22e-06 54 27 8 220 1 adrD Non-reducing polyketide synthase adrD Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A0U4ZX08 1.3e-06 54 26 12 273 1 drtA Low-reducing polyketide synthase drtA Aspergillus calidoustus
A0A2I1C3X5 1.32e-06 54 27 7 201 1 nsrB Atrochrysone carboxylic acid synthase nsrB Aspergillus novofumigatus (strain IBT 16806)
A0A0C6E0I7 1.38e-06 54 26 9 267 1 bet1 Highly reducing polyketide synthase bet1 Neocamarosporium betae
A0A179H2I8 1.39e-06 54 29 9 198 2 lcsB Highly reducing polyketide synthase lcsB Purpureocillium lilacinum
M3A326 1.47e-06 54 23 8 273 2 PKS8-1 Non-reducing polyketide synthase PKS8-1 Pseudocercospora fijiensis (strain CIRAD86)
Q5AUX1 1.62e-06 54 25 9 269 1 orsA Orsellinic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0B4G9F9 1.94e-06 53 23 7 269 1 Pks1 Polyketide synthase 1 Metarhizium guizhouense (strain ARSEF 977)
S7ZFK6 2.08e-06 53 26 9 272 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
A0A1W5T1U1 2.12e-06 53 26 9 272 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
A0A1Y0BRF1 2.12e-06 53 27 5 176 3 adrD Non-reducing polyketide synthase adrD Penicillium roqueforti
A0A0B4ESU9 2.21e-06 53 23 7 269 1 Pks1 Polyketide synthase 1 Metarhizium brunneum (strain ARSEF 3297)
G4MVZ2 2.41e-06 53 26 11 290 1 ACE1 Polyketide synthase-nonribosomal peptide synthetase ACE1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q12397 2.43e-06 53 25 13 331 2 stcA Norsolorinic acid synthase stcA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0B4H4F0 2.47e-06 53 23 7 269 1 Pks1 Polyketide synthase 1 Metarhizium majus (strain ARSEF 297)
A0A0B4FTU6 2.58e-06 53 23 7 269 1 Pks1 Polyketide synthase 1 Metarhizium anisopliae (strain ARSEF 549)
A0A0G0AID6 2.63e-06 53 27 10 271 1 thnA Hybrid PKS-NRPS synthetase thnA Trichoderma harzianum
A0A0A2JW91 2.82e-06 53 27 9 274 1 cnsI Highly reducing polyketide synthase cnsI Penicillium expansum
D7PI15 2.83e-06 53 23 10 276 1 gsfA Non-reducing polyketide synthase gsfA Penicillium aethiopicum
Q3S2T9 3.57e-06 53 25 9 278 1 mokA Lovastatin nonaketide synthase mokA Monascus pilosus
A0A4P8WAE5 3.79e-06 53 25 14 372 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
B6QK76 3.81e-06 53 28 8 230 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN5 3.81e-06 53 28 8 230 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei
Q4WAY3 4.1e-06 52 25 9 277 1 af370 Fumagillin dodecapentaenoate synthase af370 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A0N7D4P6 4.13e-06 52 24 10 290 2 Dhc3 Highly reducing polyketide synthase Dhc3 Alternaria cinerariae
A0A0U5GFS8 4.18e-06 52 28 12 267 1 ausA Non-reducing polyketide synthase ausA Aspergillus calidoustus
A0A097ZPE0 4.21e-06 52 24 10 273 1 andM Non-reducing polyketide synthase andM Emericella variicolor
A0A067MTM1 4.24e-06 52 28 6 166 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Botryobasidium botryosum (strain FD-172 SS1)
L7X8J4 4.47e-06 52 27 6 221 1 curS1 Highly reducing polyketide synthase curS1 Aspergillus terreus
A0A3G9GQ29 4.5e-06 52 29 10 268 1 cdmE 6-hydroxymellein synthase cdmE Talaromyces verruculosus
M2XHZ5 4.59e-06 52 24 12 329 2 pksA Norsolorinic acid synthase Dothistroma septosporum (strain NZE10 / CBS 128990)
Q30DW5 4.59e-06 52 24 12 329 2 pksA Norsolorinic acid synthase Dothistroma septosporum
A0A2U8NEV6 5.13e-06 52 23 7 269 1 Pks1 Polyketide synthase 1 Metarhizium acridum (strain CQMa 102)
A0A284RE13 5.66e-06 52 27 4 171 1 armB Orsellinic acid synthase ArmB Armillaria ostoyae
Q02062 5.74e-06 51 25 6 219 1 SCO5088 Actinorhodin polyketide putative beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A0A2H3CTK0 5.76e-06 52 27 4 171 1 armB Orsellinic acid synthase armB Armillaria gallica
A0A8F4S6Z6 6.67e-06 52 26 9 275 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
G2Q9A5 8.12e-06 52 27 11 277 1 mycA Hybrid PKS-NRPS synthetase mycA Thermothelomyces thermophilus (strain ATCC 42464 / BCRC 31852 / DSM 1799)
A0A455LXK0 8.65e-06 52 23 15 331 2 ntnG Non-reducing polyketide synthase ntnG Nectria sp.
A0A1E1FFN8 9.13e-06 52 24 11 275 3 prhL Non-reducing polyketide synthase prhL Penicillium brasilianum
Q0C9L7 9.44e-06 51 24 10 277 1 ctvA Highly reducing polyketide synthase ctvA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A481WNP4 9.47e-06 51 24 9 270 3 traA Hybrid PKS-NRPS synthetase traA Penicillium crustosum
G4N137 9.87e-06 51 30 8 188 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q5B7V0 1.03e-05 51 34 5 128 1 pkiB Fatty acid synthase alpha subunit pkiB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P0CU67 1.13e-05 51 26 7 219 1 claG Atrochrysone carboxylic acid synthase Passalora fulva
A0A1L9WQM9 1.26e-05 51 29 14 274 2 acrA Highly reducing polyketide synthase acrA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
I3ZNU9 1.45e-05 51 27 6 191 1 armB Orsellinic acid synthase armB Armillaria mellea
B8NJG3 1.71e-05 50 25 14 351 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A411KUP8 1.77e-05 50 25 9 268 1 ucsA Hybrid PKS-NRPS synthetase ucsA Acremonium sp.
M1WG96 1.92e-05 50 23 10 276 2 CPUR_05437 Non-reducing polyketide synthase CPUR_05437 Claviceps purpurea (strain 20.1)
A0A167LUQ4 1.95e-05 50 28 13 281 3 fumoS Fumosorinone synthetase Cordyceps fumosorosea (strain ARSEF 2679)
J4UHQ6 1.96e-05 50 27 13 282 1 OpS1 Orsellinic acid synthase Beauveria bassiana (strain ARSEF 2860)
A0A0F7U103 2.17e-05 50 25 12 275 3 ausA Non-reducing polyketide synthase ausA Penicillium brasilianum
A0A7L8UVC9 2.22e-05 50 26 12 283 3 ffsA Polyketide synthase-nonribosomal peptide synthetase ffsA Aspergillus flavipes
A0JJU1 2.58e-05 50 27 14 287 1 tenS Tenellin synthetase Beauveria bassiana
G3J453 2.66e-05 50 26 8 262 1 cm3B Highly reducing polyketide synthase cm3B Cordyceps militaris (strain CM01)
W6QDA2 2.99e-05 50 25 6 203 1 anuA Highly reducing polyketide synthase anuA Penicillium roqueforti (strain FM164)
A0A2U8NET4 3.02e-05 50 22 6 275 1 Pks1 Polyketide synthase 1 Metarhizium album (strain ARSEF 1941)
A0A8F4SKJ7 3.03e-05 50 25 10 278 1 atr1 Non-reducing polyketide synthase atr1 Stereocaulon alpinum
Q5B7U4 3.05e-05 50 28 7 216 1 pkiA Non-reducing polyketide synthase pkiA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
J4KMC1 3.29e-05 50 27 14 288 1 tenS Tenellin synthetase Beauveria bassiana (strain ARSEF 2860)
A2R6H1 4.18e-05 49 29 11 268 2 otaA Highly reducing polyketide synthase otaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
I1RF58 4.25e-05 49 24 7 222 1 PKS12 Non-reducing polyketide synthase PKS12 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A4SMT9 4.29e-05 48 28 7 206 3 fadI 3-ketoacyl-CoA thiolase Aeromonas salmonicida (strain A449)
Q54D44 4.34e-05 49 24 11 277 3 pks42 Probable polyketide synthase 42 Dictyostelium discoideum
G3XMD1 4.67e-05 49 27 12 279 1 azaB Highly reducing polyketide synthase azaB Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A0A455M7S4 5.79e-05 49 23 11 323 1 atnG Non-reducing polyketide synthase atnG Arthrinium sp.
A0A0A2KT65 5.87e-05 49 22 11 323 2 melA Conidial yellow pigment biosynthesis polyketide synthase melA Penicillium expansum
A0A0F7GFS4 6.33e-05 49 31 6 171 1 tasS Hybrid PKS-NRPS synthetase tasS Hapsidospora irregularis
A0A2V5GX43 6.37e-05 49 26 11 275 3 pyvA Hybrid PKS-NRPS synthetase pyvA Aspergillus violaceofuscus (strain CBS 115571)
A0A2Z5XAL7 6.55e-05 49 26 9 267 1 phm1 Hybrid PKS-NRPS synthetase phm1 Pyrenochaetopsis sp.
Q8J0F7 6.8e-05 48 25 10 280 1 mlcA Compactin nonaketide synthase, polyketide synthase component Penicillium citrinum
Q9HU15 6.95e-05 48 26 19 333 1 fabY Beta-ketoacyl-[acyl-carrier-protein] synthase FabY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A089FSA4 7.15e-05 48 29 7 200 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
K2QYX5 7.46e-05 48 25 9 285 1 mpsA Hybrid PKS-NRPS synthetase mpsA Macrophomina phaseolina (strain MS6)
P9WEV0 7.52e-05 48 25 7 268 3 valA Highly reducing polyketide synthase valA Aspergillus terreus
A0A1V6NYI6 7.59e-05 48 24 9 286 3 verA Highly reducing polyketide synthase verA Penicillium polonicum
A0A4P8GHJ1 8.24e-05 48 26 10 269 1 eupA 3-methylorcinaldehyde synthase Phoma sp.
A0A2I1BSV9 0.000105 48 27 7 203 1 nvfA Non-reducing polyketide synthase nvfA Aspergillus novofumigatus (strain IBT 16806)
P41176 0.000106 47 27 9 237 3 None Putative polyketide beta-ketoacyl synthase 2 Streptomyces virginiae
Q0C8A4 0.000107 48 24 11 267 1 trt4 Non-reducing polyketide synthase trt4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A3G9K3K9 0.000128 48 27 6 193 1 hisps Hispidin synthase Neonothopanus nambi
A0A0N0DCA3 0.000131 48 23 11 273 2 DEP5 Reducing polyketide synthase DEP5 Fusarium langsethiae
S0DL59 0.000137 48 40 1 83 1 apf5 Fatty acid synthase apf5 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A1CLY8 0.00014 48 24 9 292 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A0A1V6PAF7 0.000214 47 24 9 276 1 calA Highly reducing polyketide synthase calA Penicillium decumbens
Q2TXF0 0.000219 47 43 1 69 3 oryfasA Fatty acid synthase subunit alpha Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P19097 0.00022 47 43 1 69 1 FAS2 Fatty acid synthase subunit alpha Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q765N2 0.00022 47 43 1 69 3 FAS2 Fatty acid synthase subunit alpha Lachancea kluyveri
G3J9P0 0.000222 47 26 12 303 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Cordyceps militaris (strain CM01)
A0A0H4ADX3 0.000227 47 21 8 275 2 None Non-reducing polyketide synthase PKS19 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A1L7U4V5 0.00025 47 25 15 306 2 FMN1 Reducing polyketide synthase 8 Fusarium mangiferae
Q0C8M3 0.000274 47 24 11 284 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9Y8A5 0.000314 47 24 11 284 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus
A0A411L027 0.000319 47 24 14 372 3 buaA Hybrid PKS-NRPS synthetase buaA Petromyces alliaceus
Q5SBL6 0.000324 47 26 10 279 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
A0A1P8NTI3 0.000344 46 22 9 272 2 pks8 Non-reducing polyketide synthase 8 Pestalotiopsis microspora
P16539 0.000345 46 24 8 234 1 tcmL Tetracenomycin polyketide synthase ketoacyl synthase beta subunit Streptomyces glaucescens
D2E9X0 0.000437 46 23 10 276 2 DEP5 Reducing polyketide synthase DEP5 Alternaria brassicicola
Q2T4P1 0.000506 46 23 3 212 3 thaQ Polyketide synthase ThaQ Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B6H999 0.000568 46 26 6 198 1 xilA Highly reducing polyketide synthase xilA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A1D5AG16 0.000893 45 36 1 80 1 pigJ Fatty acid synthase alpha subunit pigJ Monascus ruber

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS12000
Feature type CDS
Gene -
Product beta-ketoacyl-[acyl-carrier-protein] synthase family protein
Location 554253 - 555431 (strand: 1)
Length 1179 (nucleotides) / 392 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_98
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF00109 Beta-ketoacyl synthase, N-terminal domain
PF02801 Beta-ketoacyl synthase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0304 Lipid transport and metabolism (I)
Secondary metabolites biosynthesis, transport and catabolism (Q)		 IQ 3-oxoacyl-(acyl-carrier-protein) synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MIYINAVGMLNALGNNTQEIRRNLPLRHAPGMKARDNWLQSGDACVLGGVQAELPDVPVHLHAHNSRNNRLLLAALEQIREPVTRMIHTYGADRIAVILGTSTSGLDEADHFIDAHFQSGEAPGYHYYQQELGDPARFLAANLSLTGPAYTLSTACSSSARAVLSGQRLIKAGLVDAVIAGGADTLSRMPINGFNSLEALSLTLCQPFAQDRPGITIGEGAALLLMSREPADVAFPGGGESGDGYHMSAPEPDGKGAEQAIRMALDNAGLTIGDIGYINLHGTGTPLNDAMESTVINRLFGTDTPCSSTKPLTGHMLGAAGAGEAGLCWLILKENLALPAQIFTDKPQDSQLPSCGLLTTEIPLRKPVILSNSFAFGGNNCALIFAGVTHDI

Flanking regions ( +/- flanking 50bp)

AATCAGATATTCAGTTATCAGATAATCATCTCTCATCTGGAAACCACGCCATGATTTACATTAATGCGGTTGGCATGCTCAATGCGCTGGGAAATAACACGCAAGAGATCCGCCGTAATCTGCCGCTGCGCCATGCGCCCGGTATGAAAGCGCGGGATAACTGGTTACAGTCAGGTGATGCGTGTGTGCTGGGTGGCGTGCAGGCGGAGCTTCCTGATGTTCCGGTGCATTTGCATGCACATAACAGCCGTAATAATCGTCTGTTGCTGGCGGCATTAGAGCAGATCCGCGAACCGGTGACCCGGATGATACACACTTATGGTGCGGATCGTATTGCGGTGATCCTCGGTACCAGTACCTCGGGGCTGGATGAGGCGGATCACTTTATTGATGCGCACTTTCAGTCAGGGGAAGCGCCGGGCTACCATTATTATCAGCAGGAGCTGGGTGATCCTGCCCGGTTTCTTGCCGCTAACCTCAGCCTGACCGGACCTGCCTATACACTGTCTACCGCCTGTTCATCCAGCGCGCGGGCGGTATTGTCGGGTCAGCGTCTGATTAAGGCGGGGCTGGTGGATGCGGTGATTGCCGGGGGCGCTGATACACTCAGCCGGATGCCAATCAATGGCTTTAACAGCCTTGAGGCACTCTCATTGACGCTGTGTCAGCCGTTTGCGCAGGATCGCCCCGGAATAACCATCGGTGAGGGTGCAGCACTGTTACTGATGAGCCGCGAACCGGCAGACGTGGCTTTTCCCGGCGGCGGGGAGTCCGGAGATGGTTATCATATGTCTGCGCCTGAGCCTGACGGCAAAGGTGCGGAGCAGGCAATCCGCATGGCGCTGGATAACGCGGGACTGACAATCGGGGATATCGGCTATATTAATCTGCACGGGACAGGAACACCGCTCAATGATGCGATGGAATCCACTGTCATCAACCGGCTTTTTGGTACGGATACCCCCTGTAGTTCAACCAAACCGCTGACCGGTCACATGCTGGGCGCTGCCGGAGCCGGGGAGGCGGGGCTGTGCTGGCTTATCCTGAAAGAGAATCTGGCGTTACCGGCGCAGATTTTTACGGATAAACCGCAGGATAGTCAATTACCGTCCTGTGGTCTGCTGACCACAGAAATTCCTTTGCGCAAGCCGGTGATCCTGTCGAATTCGTTTGCATTCGGTGGCAATAACTGTGCTCTGATATTTGCAGGAGTGACGCATGATATATGATAAACCGGCGGCGTATCTGCCGCATTCGGCACCCATGGTACTGCTGGAAA