Homologs in group_98

Help

11 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14705 FBDBKF_14705 85.2 Morganella morganii S1 fabF beta-ketoacyl-ACP synthase II
EHELCC_15510 EHELCC_15510 85.2 Morganella morganii S2 fabF beta-ketoacyl-ACP synthase II
NLDBIP_16040 NLDBIP_16040 85.2 Morganella morganii S4 fabF beta-ketoacyl-ACP synthase II
LHKJJB_15800 LHKJJB_15800 85.2 Morganella morganii S3 fabF beta-ketoacyl-ACP synthase II
HKOGLL_14920 HKOGLL_14920 85.2 Morganella morganii S5 fabF beta-ketoacyl-ACP synthase II
F4V73_RS07500 F4V73_RS07500 84.3 Morganella psychrotolerans fabF beta-ketoacyl-ACP synthase II
F4V73_RS12000 F4V73_RS12000 31.5 Morganella psychrotolerans - beta-ketoacyl-[acyl-carrier-protein] synthase family protein
F4V73_RS12015 F4V73_RS12015 39.5 Morganella psychrotolerans - beta-ketoacyl-ACP synthase
PMI_RS03710 PMI_RS03710 17.2 Proteus mirabilis HI4320 - 3-oxoacyl-ACP synthase
PMI_RS14370 PMI_RS14370 20.1 Proteus mirabilis HI4320 - beta-ketoacyl synthase N-terminal-like domain-containing protein
PMI_RS14375 PMI_RS14375 35.1 Proteus mirabilis HI4320 - beta-ketoacyl-[acyl-carrier-protein] synthase family protein

Distribution of the homologs in the orthogroup group_98

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_98

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AAI8 0.0 648 82 2 414 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Shigella flexneri
P0AAI5 0.0 648 82 2 414 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli (strain K12)
P0AAI6 0.0 648 82 2 414 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAI7 0.0 648 82 2 414 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O157:H7
Q9KQH9 0.0 645 74 3 415 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P55338 0.0 631 73 3 415 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio harveyi
Q83E37 6.38e-178 505 58 3 414 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
O34340 3.67e-154 444 53 4 413 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Bacillus subtilis (strain 168)
P73283 4.21e-142 414 49 3 413 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8NXE1 1.1e-140 410 49 4 410 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MW2)
Q6GAU2 1.1e-140 410 49 4 410 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MSSA476)
Q5HHA1 1.1e-140 410 49 4 410 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain COL)
Q6GIA3 4e-140 409 49 4 409 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MRSA252)
Q7A6F8 4.36e-140 409 49 4 410 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain N315)
Q99VA6 4.36e-140 409 49 4 410 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5TKS0 8.98e-138 402 49 4 406 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 (Fragment) Staphylococcus aureus
P56902 4.11e-135 396 51 8 420 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Rhizobium meliloti (strain 1021)
P52410 6.15e-121 362 45 3 411 1 KAS1 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Arabidopsis thaliana
P23902 4.7e-115 347 44 3 413 1 KAS12 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Hordeum vulgare
Q8L3X9 5.08e-113 342 45 8 434 1 KAS 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Arabidopsis thaliana
Q9D404 2.92e-112 339 44 6 418 1 Oxsm 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Mus musculus
Q9NWU1 5.97e-112 338 45 7 415 1 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Homo sapiens
Q9C9P4 5.6e-110 336 45 3 411 1 KAS2 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic Arabidopsis thaliana
O94297 1.8e-108 328 41 9 424 3 SPBC887.13c Putative 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0VCA7 8.22e-106 323 44 6 416 2 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Bos taurus
P39525 8.12e-95 294 38 7 442 1 CEM1 3-oxoacyl-[acyl-carrier-protein] synthase homolog Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P9WQD9 3.36e-92 286 41 7 399 1 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD8 3.36e-92 286 41 7 399 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
H8ESN0 3.36e-92 286 41 7 399 2 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
P63455 3.36e-92 286 41 7 399 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q05356 4.36e-91 284 37 6 418 3 sch1 Putative polyketide beta-ketoacyl synthase 1 Streptomyces halstedii
P23155 8.47e-89 278 36 5 421 3 SCO5318 Putative polyketide beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q02578 2.29e-88 277 37 5 418 3 curA Putative polyketide beta-ketoacyl synthase 1 Streptomyces cyaneus
Q9CBS7 2.22e-87 274 39 5 400 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium leprae (strain TN)
P43710 2.77e-87 274 40 10 418 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P72331 1.05e-86 272 39 5 411 3 nodE Nodulation protein E Rhizobium sp. (strain N33)
P16540 1.71e-86 272 37 4 416 3 gra-orf1 Granaticin polyketide putative beta-ketoacyl synthase 1 Streptomyces violaceoruber
P16538 1.79e-85 270 37 5 422 1 tcmK Tetracenomycin polyketide synthase ketoacyl synthase alpha subunit Streptomyces glaucescens
P04684 3.47e-85 268 40 6 411 3 nodE Nodulation protein E Rhizobium leguminosarum bv. trifolii
Q02059 6.65e-85 270 37 5 420 1 SCO5087 Actinorhodin polyketide putative beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P06230 2.51e-84 266 39 7 413 3 nodE Nodulation protein E Rhizobium meliloti (strain 1021)
P9WQD7 2.19e-82 261 36 8 414 1 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD6 2.19e-82 261 36 8 414 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63457 2.19e-82 261 36 8 414 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P06231 5.08e-82 260 39 7 412 3 nodE Nodulation protein E Rhizobium meliloti
P04683 3.27e-80 255 38 5 411 3 nodE Nodulation protein E Rhizobium leguminosarum bv. viciae
O69473 1.11e-77 249 35 8 412 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium leprae (strain TN)
Q89AY4 7.9e-75 241 36 11 418 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P41175 3.56e-74 240 35 7 417 3 None Putative polyketide beta-ketoacyl synthase 1 Streptomyces virginiae
Q02K94 5.48e-74 239 38 7 410 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
P57193 1.4e-72 236 36 11 421 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P0A953 4.06e-70 229 37 12 418 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli (strain K12)
P0A954 4.06e-70 229 37 12 418 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P43678 1.7e-68 226 35 7 425 3 None Oxytetracycline polyketide putative beta-ketoacyl synthase 1 Streptomyces rimosus
Q8KA28 2.32e-56 193 32 9 419 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P16539 5.95e-49 174 31 7 413 1 tcmL Tetracenomycin polyketide synthase ketoacyl synthase beta subunit Streptomyces glaucescens
Q02062 4.56e-39 147 28 7 408 1 SCO5088 Actinorhodin polyketide putative beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
I6X8D2 1.93e-37 148 27 10 437 1 pks13 Polyketide synthase Pks13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7TXM0 1.32e-34 140 27 9 437 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQE6 1.74e-34 139 27 9 437 3 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQE7 1.79e-34 139 27 9 437 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P40804 1.48e-33 133 29 8 356 1 pksF Polyketide biosynthesis malonyl-ACP decarboxylase PksF Bacillus subtilis (strain 168)
P41176 1.9e-33 132 27 9 408 3 None Putative polyketide beta-ketoacyl synthase 2 Streptomyces virginiae
Q869W9 3.34e-31 130 25 11 430 2 pks16 Probable polyketide synthase 16 Dictyostelium discoideum
Q5KTM9 4.37e-31 129 27 5 377 1 alt5 Highly reducing polyketide synthase alt5 Alternaria solani
Q869X2 9.07e-31 129 25 12 430 3 pks17 Probable polyketide synthase 17 Dictyostelium discoideum
I6XD69 1.18e-30 128 27 4 372 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
I6XD69 6.52e-27 117 26 4 372 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9ZGI4 3.61e-30 127 25 10 439 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q9ZGI4 8.44e-29 123 26 7 371 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q9ZGI5 8.98e-30 125 27 6 370 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 2.82e-29 124 25 10 437 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 2.1e-24 109 24 11 441 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
A0A5C1RD96 1.3e-29 125 27 15 434 3 pksAC Non-reducing polyketide synthase AC Didymella fabae
P16541 3.14e-29 121 29 8 391 3 gra-orf2 Granaticin polyketide putative beta-ketoacyl synthase 2 Streptomyces violaceoruber
A0A0A0RM07 6.85e-29 123 27 7 369 1 MLNS Mellein synthase Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
P23156 1.21e-28 119 28 9 412 3 SCO5317 Putative polyketide beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q02251 3.04e-28 121 27 12 428 1 mas Mycocerosic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0C8A4 3.2e-28 121 26 14 436 1 trt4 Non-reducing polyketide synthase trt4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A0B5KU17 4.43e-28 120 25 6 364 1 mpaC' Non-reducing polyketide synthase mapC' Penicillium brevicompactum
Q2T4N1 5.83e-28 120 26 9 384 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 4.01e-24 108 26 13 441 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 2.56e-20 97 23 8 441 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 3.22e-19 94 23 8 430 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P96202 6.73e-28 120 25 13 446 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7TXL8 6.73e-28 120 25 13 446 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q02579 8.29e-28 117 28 11 417 3 curB Putative polyketide beta-ketoacyl synthase 2 Streptomyces cyaneus
Q5ATJ7 9.23e-28 119 25 11 427 1 ausA Non-reducing polyketide synthase ausA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q03133 9.53e-28 119 27 7 365 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
Q03133 2.26e-17 88 26 5 321 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
P96284 1.46e-27 117 26 11 439 1 pks15 Putative inactive phenolphthiocerol synthesis polyketide synthase type I Pks15 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A0Y0M151 1.89e-27 119 25 6 365 1 cla2 Highly reducing polyketide synthase cla2 Cladosporium cladosporioides
Q5ATG8 2.9e-27 118 25 6 374 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VJR7 3.19e-27 118 25 11 420 1 alnA Highly reducing polyketide synthase alnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B8MYS6 3.3e-27 118 25 14 447 1 pks27 Non-reducing polyketide synthase pks27 Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A0U5GFS8 4.41e-27 117 25 15 435 1 ausA Non-reducing polyketide synthase ausA Aspergillus calidoustus
Q7TXK8 4.95e-27 117 26 10 437 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q07017 6.08e-27 117 26 10 426 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
Q07017 3.7e-25 112 25 6 366 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
P0CU67 6.81e-27 117 24 8 376 1 claG Atrochrysone carboxylic acid synthase Passalora fulva
Q4WA61 7.01e-27 117 26 15 448 3 nscA Non-reducing polyketide synthase nscA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
F1DBA9 9.68e-27 116 25 6 366 1 mpaC Non-reducing polyketide synthase mapC Penicillium brevicompactum
Q05357 9.73e-27 114 29 10 418 3 sch2 Putative polyketide beta-ketoacyl synthase 2 Streptomyces halstedii
A0A0U5GK88 1.04e-26 116 25 5 366 1 ausV Highly reducing polyketide synthase ausV Aspergillus calidoustus
Q5SBL6 1.19e-26 116 26 11 397 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
A0A097ZPE0 1.72e-26 115 24 11 428 1 andM Non-reducing polyketide synthase andM Emericella variicolor
Q84HC6 1.84e-26 115 26 10 412 1 ncsB Neocarzinostatin naphthoate synthase Streptomyces carzinostaticus
B6HNK3 1.9e-26 115 29 4 278 3 sorA Highly reducing polyketide synthase sorA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q9R9J1 2.37e-26 115 24 11 440 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
A0A0R8YWJ7 2.43e-26 115 24 11 433 1 mpas Methylphloroacetophenone synthase Cladonia uncialis
C5FM57 2.56e-26 115 26 15 449 3 nscA Non-reducing polyketide synthase nscA Arthroderma otae (strain ATCC MYA-4605 / CBS 113480)
B6HN77 3.17e-26 115 25 7 384 3 sorB Non-reducing polyketide synthase sorB Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
M1WG96 5.46e-26 114 25 9 377 2 CPUR_05437 Non-reducing polyketide synthase CPUR_05437 Claviceps purpurea (strain 20.1)
Q5B7U4 7.21e-26 114 23 9 429 1 pkiA Non-reducing polyketide synthase pkiA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A1D8I9 8.9e-26 114 26 15 448 3 nscA Non-reducing polyketide synthase nscA Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A0A067XNI2 9.09e-26 114 25 9 371 2 ptaA Non-reducing polyketide synthase ptaA Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
Q55E72 1.07e-25 113 24 13 459 1 stlA Probable polyketide synthase 1 Dictyostelium discoideum
Q0D1N9 1.12e-25 113 25 12 395 1 terA Non-reducing polyketide synthase terA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P9WQE5 1.29e-25 113 25 11 435 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE4 1.29e-25 113 25 11 435 3 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
M3A326 1.31e-25 113 25 10 384 2 PKS8-1 Non-reducing polyketide synthase PKS8-1 Pseudocercospora fijiensis (strain CIRAD86)
Q03132 1.33e-25 113 25 5 365 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
Q03132 2.22e-20 97 25 4 324 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
Q7TXL9 1.39e-25 113 25 11 435 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O31782 2.33e-25 112 25 12 450 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 1.24e-20 98 23 11 449 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 1.05e-17 89 25 12 435 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
D4AU31 2.49e-25 112 26 7 374 3 swnK PKS-NRPS hybrid synthetase swnK Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
A0A1W5T1T1 2.58e-25 112 23 12 423 2 poxF Highly reducing polyketide synthase poxF Penicillium oxalicum
A0A0K0MCJ4 2.61e-25 112 23 7 384 1 cazM Iterative polyketide synthase CazM Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q03131 2.63e-25 112 26 7 383 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03131 2.23e-24 109 24 5 366 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q4WQZ5 2.66e-25 112 26 8 327 2 tpcC Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B6QK76 3.02e-25 112 22 7 424 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN5 3.02e-25 112 22 7 424 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei
E4V2N2 3.09e-25 112 25 14 447 3 nscA Non-reducing polyketide synthase nscA Arthroderma gypseum (strain ATCC MYA-4604 / CBS 118893)
A0A481WQB6 3.57e-25 112 24 12 435 1 claF Clavatol synthase claF Penicillium crustosum
F2PWS5 3.88e-25 112 25 15 448 3 nscA Non-reducing polyketide synthase nscA Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
A0A089QRB9 3.97e-25 112 24 10 425 1 msl3 Mycolipanoate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
F2S6Z9 4.27e-25 111 25 15 448 3 nscA Non-reducing polyketide synthase nscA Trichophyton tonsurans (strain CBS 112818)
B2HIL7 4.4e-25 111 30 5 282 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium marinum (strain ATCC BAA-535 / M)
A0A0F7U103 4.68e-25 111 25 14 435 3 ausA Non-reducing polyketide synthase ausA Penicillium brasilianum
B3FWU0 4.97e-25 111 25 10 376 1 rdc5 Reducing polyketide synthase rdc5 Metacordyceps chlamydosporia
Q2UB00 5.12e-25 111 25 14 451 3 ppsB Reducing polyketide synthase ppsB Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A0R1E8 5.34e-25 111 25 9 411 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q5BG07 6.12e-25 111 23 11 430 1 pkdA Non-reducing polyketide synthase pkdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54T36 8.49e-25 110 23 10 401 3 pks19 Probable polyketide synthase 19 Dictyostelium discoideum
D4CZZ2 8.78e-25 110 25 15 448 3 nscA Non-reducing polyketide synthase nscA Trichophyton verrucosum (strain HKI 0517)
D4AWH3 1.02e-24 110 25 15 448 3 nscA Non-reducing polyketide synthase nscA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q5AUX7 1.03e-24 110 24 10 429 1 dbaI Non-reducing polyketide synthase dbaI Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A6F9DYX9 1.05e-24 110 24 13 451 1 men2 Non-reducing polyketide synthase men2 Menisporopsis theobromae
D7PHZ2 1.09e-24 110 25 11 394 1 vrtA Non-reducing polyketide synthase vrtA Penicillium aethiopicum
P9WET9 1.6e-24 110 25 10 374 1 PvBS090_009107 Non-reducing polyketide synthase PvBS090_009107 Byssochlamys spectabilis
G0R6S9 1.86e-24 110 26 11 383 2 sor2 Non-reducing polyketide synthase sor2 Hypocrea jecorina (strain QM6a)
A0A2I1BSV9 2.11e-24 109 23 12 438 1 nvfA Non-reducing polyketide synthase nvfA Aspergillus novofumigatus (strain IBT 16806)
A0A1L9UCG2 2.11e-24 109 25 9 374 3 albA Non-reducing polyketide synthase albA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
B8MV59 2.33e-24 109 24 12 440 3 tpeA Partially reducing polyketide synthase tpeA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A2QTE9 2.81e-24 109 24 8 425 3 epaA Non-reducing polyketide synthase epaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
G0REX6 2.88e-24 109 32 7 288 1 iliA Hybrid PKS-NRPS synthetase iliA Hypocrea jecorina (strain QM6a)
A2QUI2 3.05e-24 109 26 10 374 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
E9F8M3 3.21e-24 109 25 7 382 1 swnK PKS-NRPS hybrid synthetase swnK Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A098D8A0 3.33e-24 109 29 4 291 2 ZEA2 Highly reducing polyketide synthase ZEA2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A7R7ZK98 3.44e-24 108 25 12 391 3 AcPKS Atrochrysone carboxylic acid synthase Aspergillus chevalieri
A0A1E1FFN8 4.19e-24 108 25 14 435 3 prhL Non-reducing polyketide synthase prhL Penicillium brasilianum
F2T0M0 4.51e-24 108 25 15 448 3 nscA Non-reducing polyketide synthase nscA Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q0CCY3 5.4e-24 108 23 14 458 1 gedC Atrochrysone carboxylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
G3XLL5 5.69e-24 108 26 10 374 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
P9WET5 6.19e-24 108 24 14 448 1 Preu4 Non-reducing polyketide synthase Preu4 Preussia isomera
A0A7L9EYL1 6.43e-24 108 24 13 449 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
G0R6S8 6.6e-24 108 24 11 423 2 sor1 Highly reducing polyketide synthase sor1 Hypocrea jecorina (strain QM6a)
Q5BEJ6 7.12e-24 108 24 5 366 1 afoE Iterative polyketide synthase afoE Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A482N9V7 7.38e-24 108 29 6 284 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
G4MVZ2 7.45e-24 108 24 9 401 1 ACE1 Polyketide synthase-nonribosomal peptide synthetase ACE1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
P9WQE9 8.3e-24 107 26 10 428 1 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE8 8.3e-24 107 26 10 428 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U9F4 8.3e-24 107 26 10 428 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q7TVK8 8.3e-24 107 26 10 428 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
G3XMC4 9.46e-24 107 24 8 425 1 azaA Non-reducing polyketide synthase azaA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
J4UHQ6 9.76e-24 107 22 11 441 1 OpS1 Orsellinic acid synthase Beauveria bassiana (strain ARSEF 2860)
B0G138 9.81e-24 107 23 10 404 3 pks21 Probable polyketide synthase 21 Dictyostelium discoideum
A1KQG0 9.88e-24 107 26 10 428 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P9WQE1 1.13e-23 107 30 5 282 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE0 1.13e-23 107 30 5 282 3 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WET6 1.2e-23 107 24 7 432 1 Preu3 Non-reducing polyketide synthase Preu3 Preussia isomera
Q7TXL6 1.2e-23 107 30 5 282 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A161CEU9 1.22e-23 107 23 8 429 1 citS Citrinin polyketide synthase Monascus ruber
Q65Z23 1.22e-23 107 23 8 429 1 pksCT Citrinin polyketide synthase Monascus purpureus
A5PHD6 1.27e-23 107 24 10 439 1 aspks1 3-methylorcinaldehyde synthase Sarocladium schorii
A0A0B4I1J8 1.38e-23 107 27 8 330 2 Pks2 Polyketide synthase 2 Metarhizium majus (strain ARSEF 297)
A0A3T0QHT6 1.6e-23 107 24 12 438 1 pvhA Hybrid PKS-NRPS synthetase pvhA Talaromyces variabilis
A0A2Z5TM64 1.62e-23 107 24 8 413 3 himA Polyketide synthase-nonribosomal peptide synthetase hybrid himA Aspergillus japonicus
Q9ZGI2 1.63e-23 107 25 5 372 1 pikAIV Narbonolide/10-deoxymethynolide synthase PikA4, module 6 Streptomyces venezuelae
Q86JI5 1.73e-23 107 25 14 439 2 pks5 Probable polyketide synthase 5 Dictyostelium discoideum
P9WQE3 1.91e-23 106 25 7 381 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit D Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE2 1.91e-23 106 25 7 381 3 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q0CJ59 1.98e-23 106 24 10 435 1 atX 6-methylsalicylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A1L7U4V5 2.12e-23 106 25 6 375 2 FMN1 Reducing polyketide synthase 8 Fusarium mangiferae
Q7TXL7 2.17e-23 106 25 7 381 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0CF73 2.22e-23 106 24 5 366 1 ATEG_07661 Non-reducing polyketide synthase ATEG_07661 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CRQ5 2.62e-23 106 23 11 426 1 ATEG_03629 5-methylorsellinic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P12276 3.13e-23 106 25 12 426 1 FASN Fatty acid synthase Gallus gallus
D7PI15 3.18e-23 106 23 10 442 1 gsfA Non-reducing polyketide synthase gsfA Penicillium aethiopicum
P9WET1 3.8e-23 105 25 12 403 1 Preu7 Non-reducing polyketide synthase Preu7 Preussia isomera
Q4W944 5.46e-23 105 23 7 369 1 encA Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A075TRC0 5.72e-23 105 24 9 430 1 patK 6-methylsalicylic acid synthase Penicillium expansum
A0A2L0P0K3 6.92e-23 105 28 6 287 1 TwmB Polyketide synthase-nonribosomal peptide synthetase TwmB Talaromyces wortmannii
B1GVX7 7.47e-23 105 25 8 387 2 BOA6 Reducing polyketide synthase BOA6 Botryotinia fuckeliana (strain B05.10)
B0G103 7.9e-23 105 23 7 378 3 pks10 Probable polyketide synthase 10 Dictyostelium discoideum
Q9ZGI3 8.02e-23 104 25 6 371 1 pikAIII Narbonolide/10-deoxymethynolide synthase PikA3, module 5 Streptomyces venezuelae
P40872 8.43e-23 105 22 8 397 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 3.58e-21 100 23 10 444 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 8.05e-21 99 25 16 453 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
W3X8X8 8.44e-23 105 27 5 285 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
G3Y419 8.48e-23 104 26 4 326 1 yanA 6-methylsalicylic acid synthase Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A0A0S2CHA9 9.59e-23 104 22 9 429 1 pigA Non-reducing polyketide synthase pigA Monascus ruber
A0A5C1RDA3 9.76e-23 104 24 13 433 3 orf7 Highly reducing polyketide synthase Didymella fabae
N4WHE3 1.01e-22 104 24 8 387 3 PKS1 Reducing polyketide synthase PKS1 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
A0A0H4ADX3 1.04e-22 104 24 13 446 2 None Non-reducing polyketide synthase PKS19 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
K3VA96 1.41e-22 104 23 8 378 3 PKS40 Highly reducing polyketide synthase 40 Fusarium pseudograminearum (strain CS3096)
O53901 1.44e-22 104 25 9 426 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A1CFL8 1.49e-22 103 25 7 367 1 patK 6-methylcalicylic acide synthase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A0A4P8GHJ1 1.49e-22 104 25 10 389 1 eupA 3-methylorcinaldehyde synthase Phoma sp.
A0A0B4FLB2 1.49e-22 104 26 8 330 2 Pks2 Polyketide synthase 2 Metarhizium anisopliae (strain ARSEF 549)
Q05470 1.68e-22 103 26 10 381 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 1.14e-20 98 23 10 426 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 4.5e-18 90 22 9 441 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 1.06e-15 83 23 13 452 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
E9ET39 1.7e-22 103 26 8 330 2 Pks2 Polyketide synthase 2 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
B8MKY6 1.91e-22 103 29 6 279 1 tstA Highly reducing polyketide synthase tstA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A481WNP4 2.09e-22 103 25 7 373 3 traA Hybrid PKS-NRPS synthetase traA Penicillium crustosum
A0A167LUQ4 2.12e-22 103 28 10 348 3 fumoS Fumosorinone synthetase Cordyceps fumosorosea (strain ARSEF 2679)
B6HV32 2.14e-22 103 25 11 381 1 adrD Non-reducing polyketide synthase adrD Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
P0DO30 2.16e-22 103 27 11 378 1 iliA Hybrid PKS-NRPS synthetase iliA Neonectria sp. (strain DH2)
A0A2P1DP91 2.41e-22 103 26 6 333 1 macA 6-methylsalicylic acid synthase Penicillium terrestre
A0A455R5P9 2.51e-22 103 26 15 435 1 ascC Non-reducing polyketide synthase ascC Acremonium egyptiacum
A0A411L027 2.59e-22 103 23 6 381 3 buaA Hybrid PKS-NRPS synthetase buaA Petromyces alliaceus
A0A0B4I1L1 2.69e-22 103 26 8 330 2 Pks2 Polyketide synthase 2 Metarhizium guizhouense (strain ARSEF 977)
S7Z800 2.71e-22 103 27 7 295 3 opdA Hybrid PKS-NRPs synthetase opdA Penicillium oxalicum (strain 114-2 / CGMCC 5302)
B8MV60 3.06e-22 103 24 9 381 3 tpeB Non-reducing polyketide synthase tpeB Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A411PQP9 4.11e-22 102 24 10 385 3 Agnpks1 Atrochrysone carboxylic acid synthase Agnpks1 Paecilomyces divaricatus
Q5BBP5 4.51e-22 102 22 8 425 1 pkhB Highly reducing polyketide synthase pkhB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4WZA8 4.78e-22 102 24 10 374 1 alb1 Conidial pigment polyketide synthase alb1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A1B4XBH3 5.06e-22 102 28 5 280 3 sdnO Highly reducing polyketide synthase sdnO Sordaria araneosa
Q5B0D0 5.45e-22 102 24 15 456 1 aptA Non-reducing polyketide synthase aptA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A348HAX6 6e-22 102 27 4 277 1 phiA Highly reducing polyketide synthase phiA Fungal sp. (strain ATCC 74256)
A0A1B3PEI6 6.07e-22 102 24 12 461 1 ORF-A Polyunsaturated fatty acid synthase subunit A Thraustochytrium sp. (strain ATCC 26185 / S-3)
B6F209 6.21e-22 102 24 8 373 1 cpaA Cyclo-acetoacetyl-L-tryptophan synthase Aspergillus oryzae
Q5BH30 6.32e-22 102 23 11 400 3 mdpG Atrochrysone carboxylic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2HBN0 6.7e-22 102 25 8 371 1 cghG Hybrid PKS-NRPS synthetase cghG Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
D9N1A1 8.91e-22 102 27 5 284 2 ACTTS3 Highly reducing polyketide synthase ACTTS3 Alternaria alternata
Q50LG3 8.97e-22 102 28 5 278 3 AFT9-1 Highly reducing polyketide synthase AFT9-1 Alternaria alternata
F9XMW3 9.33e-22 101 23 12 449 3 PKS1 Non-reducing polyketide synthase PKS1 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q2ABP6 9.56e-22 101 25 14 438 1 pksF Reducing polyketide synthase pksF Alternaria solani
A0A8F4S6Z6 1.06e-21 101 24 15 447 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
W6QL47 1.16e-21 101 25 9 370 3 mpaC Non-reducing polyketide synthase mapC Penicillium roqueforti (strain FM164)
Q54KU3 1.17e-21 101 23 10 439 3 pks25 Probable polyketide synthase 25 Dictyostelium discoideum
P9WEZ4 1.18e-21 101 26 8 369 2 pytA Hybrid PKS-NRPS synthetase pytA Aspergillus terreus
A0A1Y0BRF1 1.19e-21 101 23 9 384 3 adrD Non-reducing polyketide synthase adrD Penicillium roqueforti
A0A084API3 1.22e-21 101 25 9 368 3 SAT13 Highly reducing polyketide synthase SAT13 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
M2XHZ5 1.44e-21 101 25 11 386 2 pksA Norsolorinic acid synthase Dothistroma septosporum (strain NZE10 / CBS 128990)
Q30DW5 1.44e-21 101 25 11 386 2 pksA Norsolorinic acid synthase Dothistroma septosporum
Q55DM7 1.47e-21 101 23 12 438 3 pks2 Probable polyketide synthase 2 Dictyostelium discoideum
A0A3G9GQ29 1.48e-21 101 25 10 397 1 cdmE 6-hydroxymellein synthase cdmE Talaromyces verruculosus
A0A2I2F2N6 1.65e-21 100 28 5 281 1 cfoA Chalcone synthase cfoA Aspergillus candidus
P40806 1.79e-21 100 24 8 416 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 2.95e-19 94 24 12 435 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 3.13e-15 82 23 11 450 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
A0A6F9DXA0 2.01e-21 100 23 10 439 1 men1 Partially reducing polyketide synthase men1 Menisporopsis theobromae
E5A7D9 2.15e-21 100 24 9 377 2 pks5 Highly reducing polyketide synthase pks5 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
A0A1L7U3D7 2.33e-21 100 29 7 289 2 FPY1 Highly reducing polyketide synthase 40 Fusarium mangiferae
A0A2I1C3X5 2.33e-21 100 26 8 332 1 nsrB Atrochrysone carboxylic acid synthase nsrB Aspergillus novofumigatus (strain IBT 16806)
A0A193PS74 2.49e-21 100 24 13 438 1 stbA Non-reducing polyketide synthase stbA Stachybotrys bisbyi
K2QVI8 2.65e-21 100 25 3 261 1 dpmpA Non-reducing polyketide synthase dpmpA Macrophomina phaseolina (strain MS6)
A0A0B4H8J1 2.84e-21 100 26 8 330 2 Pks2 Polyketide synthase 2 Metarhizium brunneum (strain ARSEF 3297)
A0A4P8DJU2 2.9e-21 100 24 11 388 3 dmx-nrPKS Atrochrysone carboxylic acid synthase Cryptosporiopsis sp. (strain 8999)
A0A443HK81 3.05e-21 100 22 13 453 1 VdtA Non-reducing polyketide synthase VdtA Byssochlamys spectabilis
Q5B8A0 3.09e-21 100 23 7 383 1 pkfA Non-reducing polyketide synthase pkfA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54FI3 3.19e-21 100 23 10 371 1 StlB Polyketide synthase 37 Dictyostelium discoideum
A0JJU1 3.54e-21 100 26 6 323 1 tenS Tenellin synthetase Beauveria bassiana
P0CU84 3.7e-21 100 25 14 442 1 apmlA Highly reducing polyketide synthase apmlA Arthrinium phaeospermum
B8NYX0 3.78e-21 99 24 10 430 2 fluP Cluster 41 polyketide synthase Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A1L9WN37 3.93e-21 99 24 8 418 1 acuA 6-methylsalicylic acid synthase acuA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
Q12397 4.22e-21 99 24 9 386 2 stcA Norsolorinic acid synthase stcA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
W7MT31 4.23e-21 99 25 8 364 1 FUB1 Reducing polyketide synthase FUB1 Gibberella moniliformis (strain M3125 / FGSC 7600)
A0A0E4AZP0 4.63e-21 99 28 7 284 3 fsa1 Hybrid PKS-NRPS synthetase fsa1 Fusarium sp. (strain FN080326)
A0A142C799 4.83e-21 99 25 9 334 1 phnA Non-reducing polyketide synthase phnA Penicillium herquei
B6H999 5e-21 99 28 11 293 1 xilA Highly reducing polyketide synthase xilA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A1L9WQM9 5.37e-21 99 26 5 311 2 acrA Highly reducing polyketide synthase acrA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
J4KMC1 6.47e-21 99 25 10 390 1 tenS Tenellin synthetase Beauveria bassiana (strain ARSEF 2860)
P9WET3 6.57e-21 99 24 9 382 1 Preu8 Non-reducing polyketide synthase Preu8 Preussia isomera
A0A1P8NTI3 6.61e-21 99 25 13 400 2 pks8 Non-reducing polyketide synthase 8 Pestalotiopsis microspora
M2YKT6 8.69e-21 99 26 10 379 2 hps1 Hybrid PKS-NRPS synthetase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
S4W172 1.02e-20 98 28 7 284 1 eqxS Equisetin synthetase eqxS Fusarium heterosporum
A0A1L9WLD9 1.12e-20 98 23 15 450 1 AacuL Atrochrysone carboxylic acid synthase AacuL Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A6J4B487 1.26e-20 98 22 6 370 3 LUC5 Hybrid PKS-NRPS synthetase LUC5 Fusarium sp.
A0A455M7S4 1.27e-20 98 26 9 333 1 atnG Non-reducing polyketide synthase atnG Arthrinium sp.
A0A455LXK0 1.37e-20 98 25 9 333 2 ntnG Non-reducing polyketide synthase ntnG Nectria sp.
B8N8R0 1.45e-20 98 24 11 394 2 afvB Non-reducing polyketide synthase afvB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
W7MLD7 1.5e-20 98 23 8 371 1 FUS1 Fusarin C synthetase Gibberella moniliformis (strain M3125 / FGSC 7600)
G9N4B2 1.66e-20 97 25 5 284 1 virA Highly reducing polyketide synthase virA Hypocrea virens (strain Gv29-8 / FGSC 10586)
S0DZM7 1.66e-20 97 22 9 378 1 bik1 Bikaverin polyketide synthase bik1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
B0G101 1.69e-20 97 23 11 443 3 pks8 Probable polyketide synthase 8/35 Dictyostelium discoideum
Q03149 1.76e-20 97 25 7 327 1 wA Conidial yellow pigment biosynthesis polyketide synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BBP8 2e-20 97 22 8 381 1 pkhA Non-reducing polyketide synthase pkhA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A4P8DJV2 2.01e-20 97 24 10 390 3 dmxL2 Highly reducing polyketide synthase dmxL2 Cryptosporiopsis sp. (strain 8999)
Q9Y7D5 2.56e-20 97 23 5 356 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus
A0A8F4S8Q3 2.66e-20 97 24 11 385 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
I1RF58 2.77e-20 97 23 9 381 1 PKS12 Non-reducing polyketide synthase PKS12 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A9P5GG56 2.9e-20 97 28 11 293 1 xilA Highly reducing polyketide synthase xilA Penicillium crustosum
A0A7L8UVC9 3.73e-20 97 23 10 398 3 ffsA Polyketide synthase-nonribosomal peptide synthetase ffsA Aspergillus flavipes
S0EEY3 4.08e-20 97 23 8 371 1 FUS1 Fusarin C synthetase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
E9F5E7 4.33e-20 96 25 9 370 1 subA Non-reducing polyketide synthase subA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
Q5AZ32 4.46e-20 96 26 11 360 1 pkbA Non-reducing polyketide synthase pkbA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A2QX22 5.2e-20 96 23 14 448 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q54IX3 5.45e-20 96 23 10 346 3 pks26 Probable polyketide synthase 26 Dictyostelium discoideum
A0A0D2YG10 6.74e-20 96 25 9 364 1 FUB1 Reducing polyketide synthase FUB1 Fusarium oxysporum f. sp. lycopersici (strain 4287 / CBS 123668 / FGSC 9935 / NRRL 34936)
G2Q9A5 6.92e-20 96 24 6 305 1 mycA Hybrid PKS-NRPS synthetase mycA Thermothelomyces thermophilus (strain ATCC 42464 / BCRC 31852 / DSM 1799)
G3KLH6 6.96e-20 95 23 14 448 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger
Q12053 7.85e-20 95 23 6 375 1 aflC Norsolorinic acid synthase Aspergillus parasiticus (strain ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1)
S3D9F1 8.83e-20 95 25 3 274 1 gloL Highly reducing polyketide synthase gloL Glarea lozoyensis (strain ATCC 20868 / MF5171)
A0A2Z5XAL7 9.16e-20 95 27 8 311 1 phm1 Hybrid PKS-NRPS synthetase phm1 Pyrenochaetopsis sp.
A0A3T0ZHJ0 1.02e-19 95 25 9 422 1 cle1 Triacetic acid lactone synthase cle1 Aspergillus versicolor
A0A8F4SKJ7 1.14e-19 95 24 12 437 1 atr1 Non-reducing polyketide synthase atr1 Stereocaulon alpinum
A0A0C6E0I7 1.14e-19 95 26 5 282 1 bet1 Highly reducing polyketide synthase bet1 Neocamarosporium betae
Q4WLD4 1.72e-19 94 24 8 380 1 pyr2 Non-reducing polyketide synthase pyr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
E9F646 2.1e-19 94 24 10 379 1 Pks1 Polyketide synthase 1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
K2QYX5 2.15e-19 94 25 12 398 1 mpsA Hybrid PKS-NRPS synthetase mpsA Macrophomina phaseolina (strain MS6)
A5ABG0 2.33e-19 94 26 9 361 1 pynA Hybrid PKS-NRPS synthetase pynA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q4WAZ9 2.4e-19 94 26 5 295 2 NRPS14 PKS-NRPS hybrid synthetase psoA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q559A9 2.53e-19 94 23 5 296 3 pks13 Probable polyketide synthase 13 Dictyostelium discoideum
Q0CZH1 2.57e-19 94 26 7 340 2 pytA Hybrid PKS-NRPS synthetase pytA (Fragment) Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A2I2F262 2.64e-19 94 28 7 281 1 acdB PKS-NRPS hybrid synthetase acdB Aspergillus candidus
Q0CF75 2.73e-19 94 25 6 305 1 ATEG_07659 Highly reducing polyketide synthase ATEG_07659 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0D159 3.23e-19 94 24 6 372 2 ATEG_00325 Hybrid PKS-NRPS synthetase ATEG_00325 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A6H0YV38 3.35e-19 94 24 14 438 2 crz7 Non-reducing polyketide synthase crz7 Cladonia metacorallifera
I1RLA7 3.42e-19 94 24 10 395 2 FGR1 Highly reducing polyketide synthase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
S7ZFK6 3.75e-19 94 23 8 391 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
Q5BEJ4 3.98e-19 94 25 7 294 1 afoG Asperfuranone polyketide synthase afoG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B8NJG3 4.13e-19 94 25 6 285 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A1W5T1U1 4.21e-19 94 23 8 391 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
Q8J0F5 4.29e-19 93 24 4 305 1 mlcB Compactin diketide synthase mlcB Penicillium citrinum
Q54TW0 4.61e-19 93 21 10 453 2 pks18 Probable polyketide synthase 18 Dictyostelium discoideum
P0DUT7 4.62e-19 93 24 8 373 1 Ba17a Highly reducing polyketide synthase 17 Metarhizium anisopliae
A0A2H3CTK0 4.68e-19 93 25 10 383 1 armB Orsellinic acid synthase armB Armillaria gallica
B0G100 4.81e-19 93 26 5 283 3 pks7 Probable polyketide synthase 7 Dictyostelium discoideum
A0A2U8NEV6 4.97e-19 93 24 10 379 1 Pks1 Polyketide synthase 1 Metarhizium acridum (strain CQMa 102)
S0DRI1 5.78e-19 93 25 9 364 1 FUB1 Reducing polyketide synthase FUB1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
P9WEX6 5.86e-19 93 25 11 371 1 dpmaA Non-reducing polyketide synthase dpmaA Metarhizium anisopliae
A0A0N9HNS9 5.94e-19 93 22 12 439 3 desS Desertorin synthase Aspergillus desertorum
Q4WKW9 6.43e-19 93 26 6 284 1 fgnA Fumigermin synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P9WET8 6.44e-19 93 24 15 441 2 Preu1 Highly reducing polyketide synthase Preu1 Preussia isomera
Q2HEW5 6.7e-19 93 28 7 294 2 cheA PKS-NRPS hybrid synthetase cheA Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A1B5L6A0 6.73e-19 93 21 13 458 1 UVI_02036160 Non-reducing polyketide synthase ustP Ustilaginoidea virens
A1CLY8 6.75e-19 93 25 6 319 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A0A284RE13 6.79e-19 93 24 10 383 1 armB Orsellinic acid synthase ArmB Armillaria ostoyae
A0A0B4FTU6 7.01e-19 93 24 10 379 1 Pks1 Polyketide synthase 1 Metarhizium anisopliae (strain ARSEF 549)
A0A0B4ESU9 7.13e-19 92 24 10 379 1 Pks1 Polyketide synthase 1 Metarhizium brunneum (strain ARSEF 3297)
Q6DQW3 7.29e-19 92 23 8 334 1 CTB1 Non-reducing polyketide synthase CTB1 Cercospora nicotianae
E9EHG2 7.42e-19 92 25 7 320 2 Pks2 Polyketide synthase 2 Metarhizium acridum (strain CQMa 102)
A7UMW1 8.42e-19 92 26 8 317 2 PKS1 Non-reducing polyketide synthase 1 Elsinoe fawcettii
Q71SP7 8.43e-19 92 22 14 428 1 FASN Fatty acid synthase Bos taurus
A0A0B4H4F0 8.79e-19 92 24 10 379 1 Pks1 Polyketide synthase 1 Metarhizium majus (strain ARSEF 297)
Q8J0F7 9.02e-19 92 22 8 391 1 mlcA Compactin nonaketide synthase, polyketide synthase component Penicillium citrinum
P9WEX0 9.63e-19 92 25 9 385 1 dpasA Non-reducing polyketide synthase dpasA Apiospora sacchari
P36189 1.06e-18 90 24 9 367 1 FASN Fatty acid synthase (Fragment) Anser anser anser
A0A0B4G9F9 1.13e-18 92 24 10 379 1 Pks1 Polyketide synthase 1 Metarhizium guizhouense (strain ARSEF 977)
R4WH05 1.16e-18 92 25 12 388 3 ACRTS2 Highly reducing polyketide synthase ACRTS2 Alternaria alternata
P9WES1 1.17e-18 92 23 5 363 1 None Atrochrysone carboxylic acid synthase PKS1 Calonarius odorifer
C5H885 1.24e-18 92 28 6 289 3 rads1 Reducing polyketide synthase rads1 Floropilus chiversii
P9WEQ0 1.45e-18 92 24 7 375 3 olcA Non-reducing polyketide synthase olcA Penicillium canescens
Q86AE3 1.68e-18 92 22 10 445 2 pks9 Probable polyketide synthase 9/36 Dictyostelium discoideum
B0G0Z9 1.84e-18 91 24 4 284 3 pks6 Probable polyketide synthase 6 Dictyostelium discoideum
I3ZNU9 1.89e-18 91 25 10 383 1 armB Orsellinic acid synthase armB Armillaria mellea
P12785 2.22e-18 91 22 13 428 1 Fasn Fatty acid synthase Rattus norvegicus
A0A2G5IC96 2.36e-18 91 23 8 334 3 CTB1 Non-reducing polyketide synthase CTB1 Cercospora beticola
A0A1V6NYI6 2.72e-18 91 24 8 382 3 verA Highly reducing polyketide synthase verA Penicillium polonicum
E5AE40 2.97e-18 91 24 12 439 2 PKS2 Highly reducing polyketide synthase PKS2 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
P49327 3.43e-18 90 23 13 429 1 FASN Fatty acid synthase Homo sapiens
Q55CN6 3.98e-18 90 25 9 286 3 pks3 Probable polyketide synthase 3 Dictyostelium discoideum
B8M9J9 4.1e-18 90 24 11 389 1 tropA 3-methylorcinaldehyde synthase tropA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
B6QK81 4.3e-18 90 24 12 436 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN6 4.3e-18 90 24 12 436 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei
A0A0A2KT65 4.68e-18 90 22 10 400 2 melA Conidial yellow pigment biosynthesis polyketide synthase melA Penicillium expansum
A0A411KUP8 5.79e-18 90 26 11 344 1 ucsA Hybrid PKS-NRPS synthetase ucsA Acremonium sp.
A0A068ABB7 6.69e-18 90 25 8 375 1 Bref-PKS Highly reducing polyketide synthase Eupenicillium brefeldianum
Q558Y6 7.27e-18 90 24 7 352 3 pks14 Probable polyketide synthase 14 Dictyostelium discoideum
P19096 8.53e-18 89 22 13 428 1 Fasn Fatty acid synthase Mus musculus
A0A0S6XH49 8.58e-18 89 28 8 280 1 frbB Highly reducing polyketide synthase frbB Fungal sp. (strain No.11243)
G1XU04 1.03e-17 89 23 5 367 1 AOL_s00215g283 6-methylsalicylic acid synthase AOL_s00215g283 Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491)
Q5AXA9 1.13e-17 89 24 9 375 1 pkgA Non-reducing polyketide synthase pkgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P9WES2 1.22e-17 89 23 5 363 1 None Atrochrysone carboxylic acid synthase PKS4 Calonarius odorifer
Q54B51 1.31e-17 89 24 7 298 3 pks44 Probable polyketide synthase 44 Dictyostelium discoideum
Q3S2T9 1.6e-17 89 21 10 443 1 mokA Lovastatin nonaketide synthase mokA Monascus pilosus
Q54KU5 1.64e-17 89 22 11 442 3 pks24 Probable polyketide synthase 24 Dictyostelium discoideum
G3XNF4 1.75e-17 88 24 8 421 1 ATPKS PKS-NRPS hybrid synthetase ATPKS Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
P0DUK1 1.76e-17 88 22 11 430 3 pspA Highly reducing polyketide synthase pspA Penicillium soppii
A0A0A2JW91 1.8e-17 88 24 9 370 1 cnsI Highly reducing polyketide synthase cnsI Penicillium expansum
W7LKX1 1.81e-17 88 25 6 281 2 FUM1 Highly reducing polyketide synthase FUM1 Gibberella moniliformis (strain M3125 / FGSC 7600)
A0A0D1DNX1 1.86e-17 88 25 10 357 2 fas2 Fatty acid synthase 2 Ustilago maydis (strain 521 / FGSC 9021)
A0A0G0AID6 2.48e-17 88 28 8 289 1 thnA Hybrid PKS-NRPS synthetase thnA Trichoderma harzianum
A0A084B9Z6 2.87e-17 88 22 5 322 3 SAT8 Non-reducing polyketide synthase SAT8 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
A0A443HK66 2.93e-17 88 27 8 280 3 VdtX Highly reducing polyketide synthase VdtX Byssochlamys spectabilis
P22367 2.93e-17 88 24 10 430 1 None 6-methylsalicylic acid synthase Penicillium patulum
A0A0M4L8I7 2.96e-17 88 25 12 381 1 aurA Highly reducing polyketide synthase aurA Calcarisporium arbuscula
A0A4P8WAE5 3.1e-17 88 24 11 377 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
Q7SHI6 3.33e-17 87 23 9 380 2 srdA Highly reducing polyketide synthase srdA Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A0A1V6PAF7 3.84e-17 87 28 7 291 1 calA Highly reducing polyketide synthase calA Penicillium decumbens
D7UQ44 4.46e-17 87 24 9 374 1 sol1 Prosolanapyrone synthase Alternaria solani
A0A6F8RNP4 5.25e-17 87 23 8 396 1 grgA Reducing polyketide synthase grgA Penicillium sp.
L7X8J4 5.62e-17 87 24 9 366 1 curS1 Highly reducing polyketide synthase curS1 Aspergillus terreus
Q0UI00 5.89e-17 87 22 10 403 1 elcA Non-reducing polyketide synthase elcA (Fragment) Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0C8M3 6.05e-17 87 22 9 396 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P9WEV0 6.08e-17 87 25 10 370 3 valA Highly reducing polyketide synthase valA Aspergillus terreus
Q5W262 6.34e-17 86 28 8 275 1 pigJ Beta-ketoacyl synthase PigJ Serratia sp. (strain ATCC 39006)
Q9Y8A5 7.11e-17 87 22 9 396 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus
Q54QD3 7.41e-17 86 22 12 443 3 pks22 Probable polyketide synthase 22 Dictyostelium discoideum
E9KMQ2 7.9e-17 86 24 14 440 2 PKS16 Non-reducing polyketide synthase PKS16 Cladonia grayi
Q0C9L7 8.52e-17 86 26 6 293 1 ctvA Highly reducing polyketide synthase ctvA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q54FQ2 8.68e-17 86 23 11 437 3 pks30 Probable polyketide synthase 30 Dictyostelium discoideum
V5Y0F7 8.79e-17 86 28 11 308 3 AFT16-1 Reducing polyketide synthase AFT16-1 Alternaria alternata
Q54FN7 9.17e-17 86 23 11 442 3 pks33 Probable polyketide synthase 33 Dictyostelium discoideum
Q2T4N2 1.01e-16 86 29 7 276 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N2 4.61e-15 81 22 14 452 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3S2U6 1.13e-16 86 22 6 362 1 mokB Lovastatin diketide synthase mokB Monascus pilosus
A0A1R3RGK0 1.23e-16 86 25 4 279 1 otaA Highly reducing polyketide synthase otaA Aspergillus carbonarius (strain ITEM 5010)
S0DS59 1.25e-16 86 26 6 281 2 PKS-NRPS1 Trichosetin synthetase PKS-NRPS1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q54B49 1.25e-16 86 24 7 293 3 pks45 Probable polyketide synthase 45 Dictyostelium discoideum
B4XYB8 1.39e-16 85 26 4 332 1 aziB 5-methyl-1-naphthoate synthase Streptomyces sahachiroi
A0A0N7D4P6 1.42e-16 85 24 7 361 2 Dhc3 Highly reducing polyketide synthase Dhc3 Alternaria cinerariae
A0A0N7D745 1.44e-16 85 24 4 285 2 Dhc5 Non-reducing polyketide synthase Dhc5 Alternaria cinerariae
A0A067MTM1 1.68e-16 85 23 12 387 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Botryobasidium botryosum (strain FD-172 SS1)
A2QK66 1.72e-16 85 23 11 397 3 ktnS Kotanin synthase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
I1RVD8 2.37e-16 85 24 11 370 3 PKS6 Highly reducing polyketide synthase PKS6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
S0EET5 2.6e-16 85 23 10 394 2 PKS19 Polyketide synthase 19 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
B0G170 2.6e-16 85 23 7 339 3 pks28 Probable polyketide synthase 28 Dictyostelium discoideum
I1S166 2.65e-16 85 25 5 296 2 FSL1 Fusarielin synthase FSL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A3G9K3K9 2.85e-16 85 22 13 438 1 hisps Hispidin synthase Neonothopanus nambi
B3FWT3 3.15e-16 84 26 5 292 1 hpm8 Reducing polyketide synthase hmp8 Hypomyces subiculosus
A0A6S5ZY48 3.18e-16 84 26 7 280 2 g433 Highly reducing polyketide synthase g433 Fusarium sp.
P9WET2 3.32e-16 84 25 18 446 1 Preu6 Non-reducing polyketide synthase Preu6 Preussia isomera
A0A481WR96 4.63e-16 84 22 10 371 3 claI Highly reducing polyketide synthase claI Penicillium crustosum
S0DTP6 4.7e-16 84 22 11 407 2 FSR1 Non-reducing polyketide synthase fsr1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q54FC8 4.74e-16 84 23 11 440 3 pks39 Probable polyketide synthase 39 Dictyostelium discoideum
Q54FQ3 5.37e-16 84 23 11 442 3 pks29 Probable polyketide synthase 29 Dictyostelium discoideum
Q9HU15 5.5e-16 83 28 11 300 1 fabY Beta-ketoacyl-[acyl-carrier-protein] synthase FabY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A3G9H990 5.57e-16 84 25 5 287 1 ALT1 Highly reducing polyketide synthase ALT1 Alternaria alternata
Q54FD2 5.78e-16 84 23 11 440 3 pks38 Probable polyketide synthase 38 Dictyostelium discoideum
A0A8D5M692 8.14e-16 83 24 10 373 1 esdpA Non-reducing polyketide synthase esdpA Penicillium shearii
A2R6H1 8.68e-16 83 24 7 370 2 otaA Highly reducing polyketide synthase otaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A1U8QN18 8.98e-16 83 23 8 400 1 sdgA Highly reducing polyketide synthase sdgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P9WET4 9.32e-16 83 24 6 373 1 Preu5 Highly reducing polyketide synthase Preu5 Preussia isomera
B3FWT6 1.07e-15 83 24 14 397 1 rdc1 Non-reducing polyketide synthase rdc1 Metacordyceps chlamydosporia
Q54QD1 1.27e-15 83 21 12 443 3 pks23 Probable polyketide synthase 23 Dictyostelium discoideum
Q5AUX1 1.38e-15 82 24 9 384 1 orsA Orsellinic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
G3JUI8 1.47e-15 82 22 8 379 1 milA Highly reducing polyketide synthase milA Cordyceps militaris (strain CM01)
A0A0U4ZX08 1.68e-15 82 22 9 421 1 drtA Low-reducing polyketide synthase drtA Aspergillus calidoustus
Q54FQ1 1.83e-15 82 23 13 442 3 pks31 Probable polyketide synthase 31 Dictyostelium discoideum
L7XAV2 2.11e-15 82 25 4 285 1 curS2 Non-reducing polyketide synthase curS2 Aspergillus terreus
Q54FN2 2.13e-15 82 23 11 443 3 pks34 Probable polyketide synthase 34 Dictyostelium discoideum
Q4WAY3 2.23e-15 82 23 7 366 1 af370 Fumagillin dodecapentaenoate synthase af370 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P9WES9 2.48e-15 82 23 11 394 1 PFUR17_0229 Non-reducing polyketide synthase PFUR17_0229 Pseudevernia furfuracea
S0EMV0 2.71e-15 82 24 9 367 1 GPY1 Highly reducing polyketide synthase GPY1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
W3X7U2 3.34e-15 81 23 10 347 2 PfmaE Conidial pigment polyketide synthase PfmaE Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
G3XMD1 3.9e-15 81 23 5 305 1 azaB Highly reducing polyketide synthase azaB Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
N4WHA7 4.29e-15 81 22 5 280 3 PKS2 Reducing polyketide synthase PKS2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
Q54ED7 4.46e-15 81 22 9 395 3 pks40 Probable polyketide synthase 40 Dictyostelium discoideum
G4N296 4.71e-15 81 21 8 382 2 PKS19 Highly reducing polyketide synthase 19 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q86ZD9 7.51e-15 80 21 8 368 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain C2932)
I1RL11 7.81e-15 80 26 9 286 1 dpfgA Non-reducing polyketide synthase dpfgA Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A017SEX7 8.97e-15 80 23 4 282 1 fogA Highly reducing polyketide synthase fogA Aspergillus ruber (strain CBS 135680)
Q0CS88 1e-14 80 27 6 238 2 tazB Highly reducing polyketide synthase tazB Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q00681 1.26e-14 79 28 8 296 2 stcJ Fatty acid synthase alpha subunit stcJ Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
G3J9P0 1.38e-14 79 22 14 453 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Cordyceps militaris (strain CM01)
A0A1B3PEI8 1.47e-14 79 26 8 303 1 ORF-B Polyunsaturated fatty acid synthase subunit B Thraustochytrium sp. (strain ATCC 26185 / S-3)
S7RK07 1.65e-14 79 25 12 376 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Gloeophyllum trabeum (strain ATCC 11539 / FP-39264 / Madison 617)
A0A345BJN0 1.72e-14 79 25 8 324 1 clz14 Squalestatin hexaketide synthase clz14 Cochliobolus lunatus
A0A1W7M1U5 1.92e-14 79 23 14 394 1 pgmA Non-reducing polyketide synthase pgmA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q558W4 2.32e-14 79 24 6 303 3 pks15 Probable polyketide synthase 15 Dictyostelium discoideum
A0A3G1DJF3 2.66e-14 79 25 9 328 2 pks2 Squalestatin hexaketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A0A089FSA4 3.06e-14 79 27 10 303 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
Q54FP8 3.07e-14 79 23 12 443 3 pks32 Probable polyketide synthase 32 Dictyostelium discoideum
O31784 3.09e-14 78 22 11 446 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
O31784 6.08e-11 68 21 13 456 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
A0A2U8NET4 3.11e-14 78 22 11 389 1 Pks1 Polyketide synthase 1 Metarhizium album (strain ARSEF 1941)
Q54G30 3.68e-14 78 24 7 324 3 pks27 Probable polyketide synthase 27 Dictyostelium discoideum
A0A179H0J7 5.04e-14 78 23 12 386 2 lcsC Highly reducing polyketide synthase lcsC Purpureocillium lilacinum
Q0UK48 1.15e-13 77 23 8 365 1 sthA Highly reducing polyketide synthase sthA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0C8L6 1.15e-13 77 24 6 299 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q54ED6 1.63e-13 76 23 7 308 3 pks41 Probable polyketide synthase 41 Dictyostelium discoideum
B3FWS8 1.67e-13 76 21 11 445 1 hpm3 Non-reducing polyketide synthase hmp3 Hypomyces subiculosus
A0A1B7YCC9 2.57e-13 75 22 10 420 1 dpchA Non-reducing polyketide synthase dpchA Colletotrichum higginsianum (strain IMI 349063)
A0A455LLX1 3.52e-13 75 26 10 283 1 atnH Highly reducing polyketide synthase atnH Arthrinium sp.
C5H882 3.77e-13 75 21 11 448 3 radS2 Non-reducing polyketide synthase rads2 Floropilus chiversii
A0A2V5GX43 4.41e-13 75 22 6 342 3 pyvA Hybrid PKS-NRPS synthetase pyvA Aspergillus violaceofuscus (strain CBS 115571)
G4N137 5.59e-13 74 23 11 409 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A0A3G1DJH7 7.13e-13 74 21 8 368 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A0A384XH94 9.29e-13 73 25 5 331 1 stpks1 Highly reducing polyketide synthase stpks1 Strobilurus tenacellus
Q5BA83 1.39e-12 73 20 7 366 3 easB Highly reducing polyketide synthase easB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P9WET0 1.43e-12 73 29 6 205 1 Preu9 Polyketide synthase-like protein Preu9 Preussia isomera
A0A455M2Y3 8.31e-12 71 24 8 287 2 ntnH Highly reducing polyketide synthase ntnH Nectria sp.
W6QDA2 2.14e-11 69 26 4 207 1 anuA Highly reducing polyketide synthase anuA Penicillium roqueforti (strain FM164)
G4NEB1 2.52e-11 69 28 5 205 1 NEC1 Highly reducing polyketide synthase NEC1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A0A098D6U0 3.4e-11 69 23 5 288 1 ZEA1 Non-reducing polyketide synthase ZEA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
G3J453 3.95e-11 68 25 7 275 1 cm3B Highly reducing polyketide synthase cm3B Cordyceps militaris (strain CM01)
Q0V6Q6 4.72e-11 68 28 8 257 1 phmA Polyketide synthase-nonribosomal peptide synthetase phmA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A0F7GFS4 5.25e-11 68 21 10 405 1 tasS Hybrid PKS-NRPS synthetase tasS Hapsidospora irregularis
G0LET7 7.23e-11 68 22 12 367 2 BOA9 Reducing polyketide synthase BOA9 Botryotinia fuckeliana (strain B05.10)
M2YJJ3 1.21e-10 67 23 12 413 2 hexA Fatty acid synthase alpha subunit hexA Dothistroma septosporum (strain NZE10 / CBS 128990)
Q54D44 1.29e-10 67 21 9 376 3 pks42 Probable polyketide synthase 42 Dictyostelium discoideum
A0A0N0DCA3 2.08e-10 66 23 7 288 2 DEP5 Reducing polyketide synthase DEP5 Fusarium langsethiae
A0A125R003 2.1e-10 66 25 6 291 1 cla3 Non-reducing polyketide synthase cla3 Cladosporium cladosporioides
S5NIA2 3.2e-10 65 24 6 257 3 TOXH Fatty acid synthase subunit alpha Cochliobolus carbonum
D2E9X0 3.98e-10 65 23 8 290 2 DEP5 Reducing polyketide synthase DEP5 Alternaria brassicicola
Q0CSA2 6.62e-10 65 22 5 245 1 tazA Non-reducing polyketide synthase tazA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q2T4P1 8.41e-10 64 20 8 405 3 thaQ Polyketide synthase ThaQ Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A0A179H2I8 8.51e-10 64 29 9 206 2 lcsB Highly reducing polyketide synthase lcsB Purpureocillium lilacinum
P9WET7 7.39e-09 61 26 5 215 2 Preu2 Reducing polyketide synthase Preu2 Preussia isomera
A0A1D5AG16 8.63e-09 61 32 3 131 1 pigJ Fatty acid synthase alpha subunit pigJ Monascus ruber
A0A345BJP0 1.61e-08 60 20 9 372 3 clz2 Squalestatin tetraketide synthase clz2 Cochliobolus lunatus
S0DL59 4.89e-08 59 25 6 231 1 apf5 Fatty acid synthase apf5 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DL59 0.000143 48 29 3 141 1 apf5 Fatty acid synthase apf5 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q5B7V0 2.98e-07 56 30 3 124 1 pkiB Fatty acid synthase alpha subunit pkiB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q10289 6.32e-07 55 25 6 203 1 fas2 Fatty acid synthase subunit alpha Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q10289 4.15e-05 49 32 3 130 1 fas2 Fatty acid synthase subunit alpha Schizosaccharomyces pombe (strain 972 / ATCC 24843)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS04235
Feature type CDS
Gene fabF
Product beta-ketoacyl-ACP synthase II
Location 952376 - 953617 (strand: 1)
Length 1242 (nucleotides) / 413 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_98
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF00109 Beta-ketoacyl synthase, N-terminal domain
PF02801 Beta-ketoacyl synthase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0304 Lipid transport and metabolism (I)
Secondary metabolites biosynthesis, transport and catabolism (Q)		 IQ 3-oxoacyl-(acyl-carrier-protein) synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MSKRRVVVTGLGMLSPVGNNAEASWKAVCAGQSGIGLIEEFDTSHHATKFAGLVKDFNHEDYNLSRKDARKMDLFIQYGIAAGVQAIADSGLEVTEANASRIGAAIGSGIGGLGLIEENHSSLINGGPRKISPFFVPSTIINMVAGHLSIIYGLRGPTISIATACTSGVHNIGHAARIIAYGDADVMLAGGAEKATTPLGVGGFGAVRALSTRNDDPQAASRPWDKDRDGFVLGDGAGVLVLEEYEHAKARGAKIYAEVVGFGMSSDAYHMTSPAENGAGGALAMENALKDAGITAADVGYINAHGTSTNAGDIAEAQAVETVFGKGTDVLVSSTKSMTGHLLGAAGAIESIFTILSLRDQIVPPTINLDNQDEHCHLDFVPHKARKVENMDYALCNSFGFGGTNGSILFKRV

Flanking regions ( +/- flanking 50bp)

GACCGCCTATATTCTTAATCCTAAACTTTTTCCCTCCTTGGAGGATAAGCGTGTCTAAGCGTCGTGTAGTTGTGACCGGACTAGGCATGTTATCTCCTGTCGGTAATAACGCAGAAGCTTCTTGGAAAGCTGTGTGTGCCGGACAGAGTGGTATCGGCCTTATCGAAGAATTTGACACCAGTCATCATGCGACTAAATTCGCAGGATTGGTAAAAGATTTCAATCATGAAGATTACAATCTTTCGCGTAAAGATGCGCGCAAGATGGATCTCTTTATTCAATATGGTATTGCAGCAGGTGTTCAAGCCATTGCGGATTCAGGTCTTGAAGTAACAGAAGCCAATGCAAGTCGTATCGGAGCTGCTATTGGTTCTGGTATTGGTGGCTTAGGCCTTATCGAGGAAAATCATTCATCATTAATCAATGGTGGCCCTCGTAAAATTAGCCCATTCTTTGTTCCTTCAACCATCATTAATATGGTTGCTGGCCATTTAAGCATTATTTATGGCTTACGTGGACCGACCATTTCTATCGCAACTGCATGTACATCAGGTGTGCATAATATCGGGCATGCCGCTCGTATTATCGCTTATGGTGATGCTGATGTGATGTTAGCGGGCGGTGCTGAAAAAGCAACAACACCATTAGGTGTTGGTGGTTTTGGTGCAGTACGTGCATTATCAACACGTAATGATGATCCTCAAGCGGCAAGTCGCCCATGGGATAAAGATCGTGATGGTTTCGTGTTAGGTGATGGTGCAGGTGTGTTAGTCCTCGAAGAGTATGAACACGCTAAAGCACGTGGCGCTAAAATTTATGCAGAAGTTGTTGGCTTTGGTATGAGTAGTGATGCTTACCATATGACCTCTCCTGCAGAAAATGGTGCGGGTGGTGCACTTGCAATGGAAAACGCATTGAAAGATGCGGGTATTACCGCTGCTGATGTCGGTTATATCAACGCGCATGGTACTTCTACTAATGCGGGTGATATTGCAGAAGCGCAAGCTGTTGAAACGGTATTTGGCAAAGGGACTGATGTATTAGTTAGCTCAACAAAATCGATGACGGGTCACTTATTAGGTGCTGCCGGGGCGATTGAGTCTATCTTTACTATTTTGTCTTTACGTGACCAAATTGTACCGCCAACAATCAATCTTGATAATCAAGATGAACATTGTCACCTTGATTTCGTACCACATAAAGCGCGTAAAGTTGAGAACATGGATTATGCACTATGTAACTCATTTGGCTTTGGCGGTACCAACGGTTCGATTCTCTTTAAGCGTGTGTAAACCGCTTATTCGCGTATTGAATTAGTCTAAAGACCCAGACGTCATGCTGG