Homologs in group_3669

Help

3 homologs were identified in 2 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20470 FBDBKF_20470 76.2 Morganella morganii S1 - HTH tetR-type domain-containing protein
PMI_RS07070 PMI_RS07070 24.5 Proteus mirabilis HI4320 betI transcriptional regulator BetI
PMI_RS15255 PMI_RS15255 30.2 Proteus mirabilis HI4320 - TetR/AcrR family transcriptional regulator C-terminal domain-containing protein

Distribution of the homologs in the orthogroup group_3669

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3669

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P51561 1.05e-135 381 88 0 205 1 tetR Tetracycline repressor protein class H Pasteurella multocida
P04483 8.53e-91 268 64 2 204 1 tetR Tetracycline repressor protein class B from transposon Tn10 Escherichia coli
P51562 3.61e-88 261 61 1 204 2 tetR Tetracycline repressor protein class H Photobacterium damsela subsp. piscicida
P0ACT5 3.61e-88 261 61 1 204 3 tetR Tetracycline repressor protein class D Salmonella ordonez
P0ACT4 3.61e-88 261 61 1 204 1 tetR Tetracycline repressor protein class D Escherichia coli
P03039 1.51e-70 216 52 1 204 4 tetR Tetracycline repressor protein class C Escherichia coli
P03038 2.27e-70 216 54 2 203 1 tetR Tetracycline repressor protein class A from transposon 1721 Escherichia coli
P21337 6.28e-66 204 50 2 209 1 tetR Tetracycline repressor protein class E Escherichia coli
P51560 3.05e-64 200 50 2 201 2 tetR Tetracycline repressor protein class G Vibrio anguillarum
P67435 1.1e-07 54 25 2 169 4 BQ2027_MB1388C Uncharacterized HTH-type transcriptional regulator Mb1388c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMD3 1.1e-07 54 25 2 169 1 Rv1353c HTH-type transcriptional repressor Rv1353c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMD2 1.1e-07 54 25 2 169 3 MT1396 HTH-type transcriptional repressor MT1396 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q79ZV4 0.00015 44 24 0 69 3 icaR Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR Staphylococcus aureus (strain MW2)
Q6G609 0.00015 44 24 0 69 3 icaR Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR Staphylococcus aureus (strain MSSA476)
Q6GDD9 0.00015 44 24 0 69 3 icaR Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR Staphylococcus aureus (strain MRSA252)
Q7A352 0.00015 44 24 0 69 3 icaR Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR Staphylococcus aureus (strain N315)
Q7A2K5 0.00015 44 24 0 69 3 icaR Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QKF4 0.00015 44 24 0 69 1 icaR Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR Staphylococcus aureus (strain Newman)
Q5HCN2 0.00015 44 24 0 69 1 icaR Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR Staphylococcus aureus (strain COL)
Q9RQQ0 0.00015 44 24 0 69 3 icaR Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q5HKQ1 0.000499 42 32 0 46 1 icaR Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8GLC6 0.000518 42 32 0 46 3 icaR Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR Staphylococcus epidermidis
O53789 0.000606 43 41 0 46 1 Rv0681 Uncharacterized HTH-type transcriptional regulator Rv0681 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11865
Feature type CDS
Gene tetR(J)
Product tetracycline resistance transcriptional repressor TetR(J)
Location 2620845 - 2621468 (strand: -1)
Length 624 (nucleotides) / 207 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_3669
Orthogroup size 4
N. genomes 2

Actions

Genomic region

Domains

PF00440 Bacterial regulatory proteins, tetR family
PF02909 Tetracyclin repressor-like, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1309 Transcription (K) K DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K18476 TetR/AcrR family transcriptional regulator, tetracycline repressor protein - -

Protein Sequence

MAKLDKEQVIDNALILLNEVGMEGLTTRKLAQKLGVEQPTLYWHVKNKRALLDALAETILQKHHHHVLPLANESWQDFLRNNAISFRQALLMYRDGGKIHAGTRPSANQFETSEQQLQFLCDAGFTLTQAVYALSSIAHFTLGSVLETQEHQESQKEREKVPKIEINYPPLLTQAIDIMDSDNGEAAFLFVLDVMISGLETVLNNHH

Flanking regions ( +/- flanking 50bp)

TATCTCTATCAGTGATAGATTGTCAAGAATATTTTATTATGAGGACGCAAATGGCAAAATTAGATAAAGAACAGGTTATTGATAACGCATTGATTTTATTAAATGAAGTCGGTATGGAAGGGTTAACAACACGTAAGTTGGCGCAAAAATTAGGAGTAGAGCAACCGACACTTTATTGGCATGTAAAGAATAAACGTGCGTTATTAGATGCTTTAGCTGAGACTATTTTACAAAAGCATCATCATCATGTTTTGCCATTAGCGAATGAAAGTTGGCAGGATTTTTTGCGTAATAACGCAATAAGTTTTCGTCAGGCGCTATTAATGTATCGTGATGGTGGAAAGATCCATGCAGGCACACGACCATCAGCCAATCAATTTGAGACATCAGAGCAACAATTGCAATTTTTGTGCGATGCTGGCTTTACGTTAACGCAAGCTGTTTATGCATTAAGTTCCATCGCGCATTTTACACTTGGTTCAGTGCTTGAAACCCAAGAACATCAAGAGAGCCAAAAAGAGCGAGAAAAAGTGCCAAAAATAGAGATAAACTACCCACCATTATTAACGCAAGCTATTGATATTATGGATAGTGATAATGGTGAAGCTGCATTCCTTTTTGTGCTCGATGTGATGATTTCAGGGCTAGAAACAGTGCTAAATAATCATCATTAAATAGGCTGACGCCCCTTAGGGGCGATGAGTTGCCCTTGTCTATCTGCGAT