Homologs in group_938

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04410 FBDBKF_04410 77.6 Morganella morganii S1 leuA 2-isopropylmalate synthase
EHELCC_05700 EHELCC_05700 77.6 Morganella morganii S2 leuA 2-isopropylmalate synthase
NLDBIP_06020 NLDBIP_06020 77.6 Morganella morganii S4 leuA 2-isopropylmalate synthase
LHKJJB_02900 LHKJJB_02900 77.6 Morganella morganii S3 leuA 2-isopropylmalate synthase
HKOGLL_06375 HKOGLL_06375 77.6 Morganella morganii S5 leuA 2-isopropylmalate synthase
F4V73_RS08855 F4V73_RS08855 76.7 Morganella psychrotolerans leuA 2-isopropylmalate synthase

Distribution of the homologs in the orthogroup group_938

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_938

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F194 0.0 1076 100 0 519 3 leuA 2-isopropylmalate synthase Proteus mirabilis (strain HI4320)
A8G9R1 0.0 876 79 1 524 3 leuA 2-isopropylmalate synthase Serratia proteamaculans (strain 568)
A1JJH7 0.0 873 79 1 520 3 leuA 2-isopropylmalate synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JK98 0.0 868 79 1 520 3 leuA 2-isopropylmalate synthase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EM1 0.0 868 79 1 520 3 leuA 2-isopropylmalate synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TQA2 0.0 868 79 1 520 3 leuA 2-isopropylmalate synthase Yersinia pestis (strain Pestoides F)
Q1CMP5 0.0 868 79 1 520 3 leuA 2-isopropylmalate synthase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R142 0.0 868 79 1 520 3 leuA 2-isopropylmalate synthase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIG8 0.0 868 79 1 520 3 leuA 2-isopropylmalate synthase Yersinia pestis
B2K4C9 0.0 868 79 1 520 3 leuA 2-isopropylmalate synthase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C1Z6 0.0 868 79 1 520 3 leuA 2-isopropylmalate synthase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FM84 0.0 868 79 1 520 3 leuA 2-isopropylmalate synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7N129 0.0 865 79 1 520 3 leuA 2-isopropylmalate synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2NVW3 0.0 824 75 0 513 3 leuA 2-isopropylmalate synthase Sodalis glossinidius (strain morsitans)
A4W6H9 0.0 811 73 0 517 3 leuA 2-isopropylmalate synthase Enterobacter sp. (strain 638)
C6DEV8 0.0 811 74 0 511 3 leuA 2-isopropylmalate synthase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D0G8 0.0 809 74 0 511 3 leuA 2-isopropylmalate synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3Z5T6 0.0 808 73 0 511 3 leuA 2-isopropylmalate synthase Shigella sonnei (strain Ss046)
Q83SP0 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Shigella flexneri
Q326G1 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Shigella boydii serotype 4 (strain Sb227)
B2U281 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RGC3 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli (strain UTI89 / UPEC)
B6HZ24 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli (strain SE11)
P09151 0.0 807 73 0 511 1 leuA 2-isopropylmalate synthase Escherichia coli (strain K12)
B1IRA4 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FL75 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLR5 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7C2 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O1:K1 / APEC
A7ZW25 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O9:H4 (strain HS)
C4ZPZ7 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M119 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O8 (strain IAI1)
B7NHI2 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LFU5 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli (strain 55989 / EAEC)
B7MAJ9 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZHG6 0.0 807 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7N7U9 0.0 806 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B5YZB0 0.0 806 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9Z8 0.0 806 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O157:H7
A7MIC5 0.0 806 73 0 517 3 leuA 2-isopropylmalate synthase Cronobacter sakazakii (strain ATCC BAA-894)
B5BLB5 0.0 806 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella paratyphi A (strain AKU_12601)
Q5PDG1 0.0 806 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A8ALM5 0.0 806 72 0 517 3 leuA 2-isopropylmalate synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LWE2 0.0 805 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LG11 0.0 805 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli (strain SMS-3-5 / SECEC)
Q32K20 0.0 805 73 0 511 3 leuA 2-isopropylmalate synthase Shigella dysenteriae serotype 1 (strain Sd197)
B7UIC4 0.0 805 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
C0Q5H1 0.0 804 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella paratyphi C (strain RKS4594)
Q57TE6 0.0 804 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella choleraesuis (strain SC-B67)
B7MNT2 0.0 804 73 0 511 3 leuA 2-isopropylmalate synthase Escherichia coli O81 (strain ED1a)
Q0T8C4 0.0 804 73 0 511 3 leuA 2-isopropylmalate synthase Shigella flexneri serotype 5b (strain 8401)
A6T4L9 0.0 804 73 0 517 3 leuA 2-isopropylmalate synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P15875 0.0 803 72 0 517 1 leuA 2-isopropylmalate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TWW1 0.0 803 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella schwarzengrund (strain CVM19633)
A9MZK0 0.0 803 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TJ72 0.0 803 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella heidelberg (strain SL476)
B5RGE4 0.0 803 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R2K9 0.0 803 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella enteritidis PT4 (strain P125109)
B5FI58 0.0 803 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella dublin (strain CT_02021853)
B5F7U9 0.0 803 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella agona (strain SL483)
B4SU36 0.0 803 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella newport (strain SL254)
B5Y1W2 0.0 800 72 0 517 3 leuA 2-isopropylmalate synthase Klebsiella pneumoniae (strain 342)
Q8Z9I0 0.0 798 72 0 517 3 leuA 2-isopropylmalate synthase Salmonella typhi
A9MQD8 0.0 797 72 1 517 3 leuA 2-isopropylmalate synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B2VDA7 0.0 792 72 0 511 3 leuA 2-isopropylmalate synthase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C5B7R4 0.0 788 75 1 515 3 leuA 2-isopropylmalate synthase Edwardsiella ictaluri (strain 93-146)
Q493R0 0.0 770 69 0 510 3 leuA 2-isopropylmalate synthase Blochmanniella pennsylvanica (strain BPEN)
P48571 0.0 768 70 1 506 3 leuA 2-isopropylmalate synthase Buchnera aphidicola subsp. Rhopalosiphum padi
A4SR62 0.0 766 71 0 505 3 leuA 2-isopropylmalate synthase Aeromonas salmonicida (strain A449)
Q7MP77 0.0 764 69 1 515 3 leuA 2-isopropylmalate synthase Vibrio vulnificus (strain YJ016)
Q8DEE1 0.0 764 69 1 515 3 leuA 2-isopropylmalate synthase Vibrio vulnificus (strain CMCP6)
A0KGM9 0.0 764 70 0 505 3 leuA 2-isopropylmalate synthase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
C4LAV7 0.0 763 70 0 511 3 leuA 2-isopropylmalate synthase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
O85063 0.0 761 69 2 512 3 leuA 2-isopropylmalate synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q6LV24 0.0 761 70 2 511 3 leuA 2-isopropylmalate synthase Photobacterium profundum (strain SS9)
B5FGH4 0.0 754 68 2 515 3 leuA 2-isopropylmalate synthase Aliivibrio fischeri (strain MJ11)
Q9ZEY8 0.0 754 68 1 506 3 leuA 2-isopropylmalate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5E856 0.0 753 68 2 515 3 leuA 2-isopropylmalate synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
C3LR32 0.0 752 69 2 512 3 leuA 2-isopropylmalate synthase Vibrio cholerae serotype O1 (strain M66-2)
Q9KP83 0.0 752 69 2 512 3 leuA 2-isopropylmalate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87SS7 0.0 750 68 2 512 3 leuA 2-isopropylmalate synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B6ELK0 0.0 746 68 2 512 3 leuA 2-isopropylmalate synthase Aliivibrio salmonicida (strain LFI1238)
O85070 0.0 744 67 1 506 3 leuA 2-isopropylmalate synthase Buchnera aphidicola subsp. Diuraphis noxia
B7VIF2 0.0 743 67 2 515 3 leuA 2-isopropylmalate synthase Vibrio atlanticus (strain LGP32)
Q9CJN5 0.0 739 68 2 507 3 leuA 2-isopropylmalate synthase Pasteurella multocida (strain Pm70)
Q9EVH0 0.0 734 69 1 493 3 leuA 2-isopropylmalate synthase (Fragment) Buchnera aphidicola subsp. Uroleucon ambrosiae
A1S2E0 0.0 732 66 1 518 3 leuA 2-isopropylmalate synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A3QIP0 0.0 731 66 1 512 3 leuA 2-isopropylmalate synthase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A5UD85 0.0 731 68 2 515 3 leuA 2-isopropylmalate synthase Haemophilus influenzae (strain PittEE)
Q4QLS4 0.0 730 68 2 515 3 leuA 2-isopropylmalate synthase Haemophilus influenzae (strain 86-028NP)
B0USF6 0.0 729 66 3 518 3 leuA 2-isopropylmalate synthase Histophilus somni (strain 2336)
Q9EVH6 0.0 729 68 1 493 3 leuA 2-isopropylmalate synthase (Fragment) Buchnera aphidicola subsp. Uroleucon erigeronensis
Q0I2G1 0.0 728 66 3 518 3 leuA 2-isopropylmalate synthase Histophilus somni (strain 129Pt)
Q07WG9 0.0 728 66 1 518 3 leuA 2-isopropylmalate synthase Shewanella frigidimarina (strain NCIMB 400)
A1SRG8 0.0 722 65 1 512 3 leuA 2-isopropylmalate synthase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q0HZT4 0.0 721 66 1 518 3 leuA 2-isopropylmalate synthase Shewanella sp. (strain MR-7)
A8H9A1 0.0 721 66 1 506 3 leuA 2-isopropylmalate synthase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q0HE65 0.0 721 66 1 518 3 leuA 2-isopropylmalate synthase Shewanella sp. (strain MR-4)
B0TQM0 0.0 721 65 2 519 3 leuA 2-isopropylmalate synthase Shewanella halifaxensis (strain HAW-EB4)
P43861 0.0 721 67 2 515 3 leuA 2-isopropylmalate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9EVI8 0.0 720 67 1 493 3 leuA 2-isopropylmalate synthase (Fragment) Buchnera aphidicola subsp. Uroleucon sonchi
A0L1R0 0.0 720 66 1 518 3 leuA 2-isopropylmalate synthase Shewanella sp. (strain ANA-3)
B1KKZ4 0.0 718 66 1 512 3 leuA 2-isopropylmalate synthase Shewanella woodyi (strain ATCC 51908 / MS32)
A6WIB5 0.0 716 66 1 518 3 leuA 2-isopropylmalate synthase Shewanella baltica (strain OS185)
A3CZK5 0.0 716 66 1 518 3 leuA 2-isopropylmalate synthase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A1REY0 0.0 715 66 1 518 3 leuA 2-isopropylmalate synthase Shewanella sp. (strain W3-18-1)
A4Y2M0 0.0 715 66 1 518 3 leuA 2-isopropylmalate synthase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A9KY13 0.0 714 66 1 518 3 leuA 2-isopropylmalate synthase Shewanella baltica (strain OS195)
B8E4K4 0.0 713 66 1 518 3 leuA 2-isopropylmalate synthase Shewanella baltica (strain OS223)
B8CM39 0.0 711 65 1 512 3 leuA 2-isopropylmalate synthase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q8E9N2 0.0 710 66 1 518 3 leuA 2-isopropylmalate synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9EVG4 0.0 707 65 1 493 3 leuA 2-isopropylmalate synthase (Fragment) Buchnera aphidicola subsp. Macrosiphoniella ludovicianae
Q12SE7 0.0 704 66 1 506 3 leuA 2-isopropylmalate synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A8FQ83 0.0 702 65 1 512 3 leuA 2-isopropylmalate synthase Shewanella sediminis (strain HAW-EB3)
Q15QR4 0.0 694 62 1 516 3 leuA 2-isopropylmalate synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q7VQJ6 0.0 693 63 2 518 3 leuA 2-isopropylmalate synthase Blochmanniella floridana
Q5WQ01 0.0 669 61 2 510 3 leuA 2-isopropylmalate synthase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q9EVE3 0.0 645 67 1 437 3 leuA 2-isopropylmalate synthase (Fragment) Buchnera aphidicola subsp. Uroleucon rurale
P58898 0.0 644 57 1 508 3 leuA 2-isopropylmalate synthase Buchnera aphidicola subsp. Pemphigus spyrothecae
Q9PLV9 0.0 635 60 2 508 3 leuA 2-isopropylmalate synthase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7H667 0.0 632 60 2 509 3 leuA 2-isopropylmalate synthase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A1W1X2 0.0 632 60 2 508 3 leuA 2-isopropylmalate synthase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FP35 0.0 632 60 2 508 3 leuA 2-isopropylmalate synthase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5HS76 0.0 631 60 2 508 3 leuA 2-isopropylmalate synthase Campylobacter jejuni (strain RM1221)
Q89A49 0.0 571 66 0 378 5 leuA Putative 2-isopropylmalate synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q3AEQ5 1.22e-179 517 50 3 509 3 leuA 2-isopropylmalate synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B0TCR1 1.66e-179 517 50 1 499 3 leuA 2-isopropylmalate synthase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A4J181 2.68e-179 516 50 2 506 3 leuA 2-isopropylmalate synthase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
O31287 1.05e-177 507 66 2 359 3 leuA 2-isopropylmalate synthase (Fragment) Buchnera aphidicola subsp. Thelaxes suberi
B8I1T7 1.84e-176 509 51 1 497 3 leuA 2-isopropylmalate synthase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q605K7 8.33e-176 508 51 1 501 3 leuA 2-isopropylmalate synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
O67862 1.04e-174 505 50 4 510 3 leuA 2-isopropylmalate synthase Aquifex aeolicus (strain VF5)
A5D4W0 1.38e-174 504 50 3 506 3 leuA 2-isopropylmalate synthase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B1WQQ4 1.99e-174 505 49 6 537 3 leuA 2-isopropylmalate synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
B1H0A7 4.96e-174 503 50 3 500 3 leuA 2-isopropylmalate synthase Endomicrobium trichonymphae
Q7UI51 7.98e-173 501 50 1 499 3 leuA 2-isopropylmalate synthase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q0AGN5 3.42e-171 496 49 3 504 3 leuA 2-isopropylmalate synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3J877 2.77e-170 493 50 1 500 3 leuA 2-isopropylmalate synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A1AWA1 2.37e-169 491 50 3 502 3 leuA 2-isopropylmalate synthase Ruthia magnifica subsp. Calyptogena magnifica
B7JYP4 5.31e-169 491 49 5 522 3 leuA 2-isopropylmalate synthase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q31I16 1.74e-168 489 48 3 503 3 leuA 2-isopropylmalate synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q820M0 2.13e-168 489 48 3 504 3 leuA 2-isopropylmalate synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B1XLQ9 3.27e-167 486 49 4 520 3 leuA 2-isopropylmalate synthase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q8DJ32 7.24e-167 486 48 4 526 3 leuA 2-isopropylmalate synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B7KJX8 1.55e-166 485 48 5 530 3 leuA 2-isopropylmalate synthase Gloeothece citriformis (strain PCC 7424)
Q8U2A2 4.17e-166 482 48 3 502 3 leuA 2-isopropylmalate synthase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A5CWZ3 5.88e-165 480 48 1 501 3 leuA 2-isopropylmalate synthase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B0JGK2 7.94e-165 480 49 4 513 3 leuA 2-isopropylmalate synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q112U2 6.57e-164 478 48 4 522 3 leuA 2-isopropylmalate synthase Trichodesmium erythraeum (strain IMS101)
Q47BI0 7.28e-164 477 48 1 500 3 leuA 2-isopropylmalate synthase Dechloromonas aromatica (strain RCB)
B1I1Y1 1.77e-163 476 47 3 513 3 leuA 2-isopropylmalate synthase Desulforudis audaxviator (strain MP104C)
P48575 2.66e-163 476 49 4 517 3 leuA 2-isopropylmalate synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5NXN2 2.83e-163 476 48 4 504 3 leuA 2-isopropylmalate synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q3MBA3 3.98e-163 476 49 4 517 3 leuA 2-isopropylmalate synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P94907 8.9e-163 475 49 4 513 3 leuA 2-isopropylmalate synthase Microcystis aeruginosa
B5YEF4 2.57e-160 468 48 3 494 3 leuA 2-isopropylmalate synthase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B8E2W9 2.12e-159 466 47 3 494 3 leuA 2-isopropylmalate synthase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
P48576 2.26e-159 466 48 5 526 3 leuA 2-isopropylmalate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q138Z2 6.45e-159 465 46 2 511 3 leuA 2-isopropylmalate synthase Rhodopseudomonas palustris (strain BisB5)
A5MZ76 6.49e-159 464 46 2 501 3 leuA 2-isopropylmalate synthase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E371 6.49e-159 464 46 2 501 3 leuA 2-isopropylmalate synthase Clostridium kluyveri (strain NBRC 12016)
A3PDH0 7.81e-159 466 46 6 524 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9301)
Q2YBW0 9.16e-159 464 48 2 500 3 leuA 2-isopropylmalate synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B3DX88 4.57e-158 462 46 4 499 3 leuA 2-isopropylmalate synthase Methylacidiphilum infernorum (isolate V4)
Q9JZG1 1.25e-157 461 46 3 501 1 leuA 2-isopropylmalate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1KTV6 1.59e-157 461 46 3 501 3 leuA 2-isopropylmalate synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JUK6 1.62e-157 461 46 3 501 3 leuA 2-isopropylmalate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q2LWJ3 2.22e-157 461 46 1 495 3 leuA 2-isopropylmalate synthase Syntrophus aciditrophicus (strain SB)
B8DM91 4.22e-157 460 47 2 499 3 leuA 2-isopropylmalate synthase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A5GM47 7.73e-157 460 49 5 495 3 leuA 2-isopropylmalate synthase Synechococcus sp. (strain WH7803)
Q7P0H2 1.13e-156 459 46 1 506 3 leuA 2-isopropylmalate synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
C0Z9C8 1.52e-156 458 47 2 495 3 leuA 2-isopropylmalate synthase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q07PI3 1.59e-156 459 46 1 503 3 leuA 2-isopropylmalate synthase Rhodopseudomonas palustris (strain BisA53)
Q9UZ08 2.99e-156 457 48 3 487 3 leuA 2-isopropylmalate synthase Pyrococcus abyssi (strain GE5 / Orsay)
B4E5N2 3.4e-156 457 47 6 509 3 leuA 2-isopropylmalate synthase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q21VZ1 6.52e-156 457 47 2 501 3 leuA 2-isopropylmalate synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q0IBI3 7.9e-156 457 48 5 495 3 leuA 2-isopropylmalate synthase Synechococcus sp. (strain CC9311)
Q39ED5 9.65e-156 456 47 6 509 3 leuA 2-isopropylmalate synthase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A6LDN1 1.2e-155 456 47 3 498 3 leuA 2-isopropylmalate synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B1ZDN3 1.4e-155 456 46 1 497 3 leuA 2-isopropylmalate synthase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q5F8D4 1.9e-155 459 46 3 501 3 leuA 2-isopropylmalate synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9RUA9 2.63e-155 456 47 3 497 3 leuA 2-isopropylmalate synthase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q6N858 3.13e-155 456 46 2 506 3 leuA 2-isopropylmalate synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B9MA32 3.15e-155 455 47 2 501 3 leuA 2-isopropylmalate synthase Acidovorax ebreus (strain TPSY)
Q8XXP1 4.18e-155 455 47 2 501 3 leuA 2-isopropylmalate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B3QCX5 4.34e-155 455 46 2 506 3 leuA 2-isopropylmalate synthase Rhodopseudomonas palustris (strain TIE-1)
Q3SHE7 5.66e-155 454 46 1 500 3 leuA 2-isopropylmalate synthase Thiobacillus denitrificans (strain ATCC 25259)
Q212A9 7.14e-155 454 45 1 497 3 leuA 2-isopropylmalate synthase Rhodopseudomonas palustris (strain BisB18)
A2C3L7 7.9e-155 455 47 5 511 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain NATL1A)
A1W6T7 1.03e-154 454 46 2 501 3 leuA 2-isopropylmalate synthase Acidovorax sp. (strain JS42)
Q72RL9 1.74e-154 453 45 0 499 3 leuA 2-isopropylmalate synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8F445 1.74e-154 453 45 0 499 1 leuA1 2-isopropylmalate synthase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q1BV03 1.87e-154 453 46 6 509 3 leuA 2-isopropylmalate synthase Burkholderia orbicola (strain AU 1054)
B1JVQ1 1.87e-154 453 46 6 509 3 leuA 2-isopropylmalate synthase Burkholderia orbicola (strain MC0-3)
A0K933 1.87e-154 453 46 6 509 3 leuA 2-isopropylmalate synthase Burkholderia cenocepacia (strain HI2424)
Q89GB0 1.88e-154 453 46 1 502 3 leuA 2-isopropylmalate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B1HR98 2.23e-154 453 46 3 495 3 leuA 2-isopropylmalate synthase Lysinibacillus sphaericus (strain C3-41)
Q1LPX2 2.23e-154 453 47 2 501 3 leuA 2-isopropylmalate synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q2IUT4 2.87e-154 453 45 2 509 3 leuA 2-isopropylmalate synthase Rhodopseudomonas palustris (strain HaA2)
Q46K01 3.28e-154 454 46 5 511 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain NATL2A)
Q1QJV3 3.85e-154 452 45 1 505 3 leuA 2-isopropylmalate synthase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q9K8E8 7.7e-154 452 46 2 503 3 leuA 2-isopropylmalate synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A8G5D5 8.15e-154 453 46 5 517 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9215)
Q63VP3 1.01e-153 451 46 4 506 3 leuA 2-isopropylmalate synthase Burkholderia pseudomallei (strain K96243)
A3N7K7 1.01e-153 451 46 4 506 3 leuA 2-isopropylmalate synthase Burkholderia pseudomallei (strain 668)
Q3JUB9 1.01e-153 451 46 4 506 3 leuA 2-isopropylmalate synthase Burkholderia pseudomallei (strain 1710b)
A3NT94 1.01e-153 451 46 4 506 3 leuA 2-isopropylmalate synthase Burkholderia pseudomallei (strain 1106a)
A4YZ76 1.09e-153 452 45 1 505 3 leuA 2-isopropylmalate synthase Bradyrhizobium sp. (strain ORS 278)
Q7NI93 1.76e-153 452 46 4 514 3 leuA 2-isopropylmalate synthase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B6JB87 2.39e-153 451 46 1 504 3 leuA 2-isopropylmalate synthase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
B2JDN6 2.66e-153 450 46 3 503 3 leuA 2-isopropylmalate synthase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A2BRP4 2.72e-153 451 46 5 517 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain AS9601)
A7ZES2 3.18e-153 450 47 5 501 3 leuA 2-isopropylmalate synthase Campylobacter concisus (strain 13826)
A7I0N8 3.47e-153 449 46 4 504 3 leuA 2-isopropylmalate synthase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B8CX21 3.93e-153 450 46 5 518 3 leuA 2-isopropylmalate synthase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
D3EBC1 4.33e-153 450 44 5 504 3 leuA 2-isopropylmalate synthase Geobacillus sp. (strain Y412MC10)
Q0KCT8 1.05e-152 449 46 2 501 3 leuA 2-isopropylmalate synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A1VN06 1.43e-152 448 47 2 501 3 leuA 2-isopropylmalate synthase Polaromonas naphthalenivorans (strain CJ2)
Q12B47 1.86e-152 448 47 4 504 3 leuA 2-isopropylmalate synthase Polaromonas sp. (strain JS666 / ATCC BAA-500)
A5GRZ0 3.34e-152 448 49 4 494 3 leuA 2-isopropylmalate synthase Synechococcus sp. (strain RCC307)
B1XYA8 3.6e-152 447 47 3 502 3 leuA 2-isopropylmalate synthase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B8IHS8 3.61e-152 447 45 1 498 3 leuA 2-isopropylmalate synthase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q31AF9 4.62e-152 448 46 5 517 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9312)
C5D5M0 4.67e-152 447 46 1 506 3 leuA 2-isopropylmalate synthase Geobacillus sp. (strain WCH70)
A5EP79 4.89e-152 447 44 1 505 3 leuA 2-isopropylmalate synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q5WEN3 5.04e-152 447 45 3 512 3 leuA 2-isopropylmalate synthase Shouchella clausii (strain KSM-K16)
C5CYP2 6.68e-152 447 47 4 506 3 leuA 2-isopropylmalate synthase Variovorax paradoxus (strain S110)
B9KB95 1.51e-151 446 46 3 494 3 leuA 2-isopropylmalate synthase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q473V1 1.8e-151 446 46 2 501 3 leuA 2-isopropylmalate synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q7V121 3.02e-151 446 46 5 517 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A6Q4V5 3.3e-151 445 46 4 501 3 leuA 2-isopropylmalate synthase Nitratiruptor sp. (strain SB155-2)
A9AJN4 4.1e-151 445 47 6 509 3 leuA 2-isopropylmalate synthase Burkholderia multivorans (strain ATCC 17616 / 249)
A1TRT4 6.47e-151 444 46 2 501 3 leuA 2-isopropylmalate synthase Paracidovorax citrulli (strain AAC00-1)
A4JGE0 7.54e-151 444 47 6 509 3 leuA 2-isopropylmalate synthase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q3AIA2 7.7e-151 445 46 6 531 3 leuA 2-isopropylmalate synthase Synechococcus sp. (strain CC9605)
Q0BDB9 7.79e-151 444 47 7 511 3 leuA 2-isopropylmalate synthase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B7GH19 1.45e-150 443 46 1 504 3 leuA 2-isopropylmalate synthase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A8FFW5 1.68e-150 443 45 4 513 3 leuA 2-isopropylmalate synthase Bacillus pumilus (strain SAFR-032)
A2BX52 1.79e-150 444 46 5 498 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9515)
B1YTR7 2.77e-150 442 47 6 509 3 leuA 2-isopropylmalate synthase Burkholderia ambifaria (strain MC40-6)
A2SHL8 3.45e-150 442 47 3 502 3 leuA 2-isopropylmalate synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
P58900 1.74e-149 441 46 2 499 3 leuA 2-isopropylmalate synthase Xanthomonas axonopodis pv. citri (strain 306)
B1XUJ3 1.82e-149 441 45 2 509 3 leuA 2-isopropylmalate synthase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q7VBG1 1.96e-149 441 46 6 531 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q3BPJ9 2.05e-149 441 46 2 499 3 leuA 2-isopropylmalate synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B2SNG9 3.48e-149 440 46 2 502 3 leuA 2-isopropylmalate synthase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P761 3.48e-149 440 46 2 502 3 leuA 2-isopropylmalate synthase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q7U892 4.13e-149 441 46 6 531 3 leuA 2-isopropylmalate synthase Parasynechococcus marenigrum (strain WH8102)
A9BB43 7.2e-149 440 47 5 495 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9211)
Q5H4C6 2.38e-148 438 45 2 502 3 leuA 2-isopropylmalate synthase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B8DBU4 3.67e-148 437 45 4 508 3 leuA 2-isopropylmalate synthase Listeria monocytogenes serotype 4a (strain HCC23)
A0AK92 6.46e-148 436 45 4 508 3 leuA 2-isopropylmalate synthase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B8H607 7.28e-148 437 45 3 512 3 leuA 2-isopropylmalate synthase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A823 7.28e-148 437 45 3 512 3 leuA 2-isopropylmalate synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q71Y35 7.36e-148 436 45 4 508 1 leuA 2-isopropylmalate synthase Listeria monocytogenes serotype 4b (strain F2365)
C1KWT1 7.36e-148 436 45 4 508 3 leuA 2-isopropylmalate synthase Listeria monocytogenes serotype 4b (strain CLIP80459)
A4SXR0 7.36e-148 436 45 2 509 3 leuA 2-isopropylmalate synthase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q3SQ49 9.24e-148 436 45 1 505 3 leuA 2-isopropylmalate synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q5KWJ3 1.43e-147 436 46 1 506 3 leuA 2-isopropylmalate synthase Geobacillus kaustophilus (strain HTA426)
A5IJM2 2.68e-147 435 45 3 494 3 leuA 2-isopropylmalate synthase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B1L8U2 4.32e-147 434 45 3 494 3 leuA 2-isopropylmalate synthase Thermotoga sp. (strain RQ2)
Q9WZ23 4.32e-147 434 45 3 494 3 leuA 2-isopropylmalate synthase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8Y5R9 4.97e-147 434 45 4 508 3 leuA 2-isopropylmalate synthase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P58901 7.59e-147 434 45 2 502 3 leuA 2-isopropylmalate synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RP28 7.59e-147 434 45 2 502 3 leuA 2-isopropylmalate synthase Xanthomonas campestris pv. campestris (strain B100)
Q4UYG1 7.59e-147 434 45 2 502 3 leuA 2-isopropylmalate synthase Xanthomonas campestris pv. campestris (strain 8004)
A1WNY5 1.57e-146 433 46 5 505 3 leuA 2-isopropylmalate synthase Verminephrobacter eiseniae (strain EF01-2)
Q92A28 3.05e-146 432 45 4 508 3 leuA 2-isopropylmalate synthase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q7M9W4 3.21e-146 432 46 7 504 3 leuA 2-isopropylmalate synthase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q3AYY2 3.3e-146 433 46 6 531 3 leuA 2-isopropylmalate synthase Synechococcus sp. (strain CC9902)
A8ES07 3.7e-146 432 44 7 516 3 leuA 2-isopropylmalate synthase Aliarcobacter butzleri (strain RM4018)
Q8RL85 9.62e-146 431 45 1 513 3 leuA 2-isopropylmalate synthase Geobacillus stearothermophilus
B0T0G9 2.81e-145 430 46 2 502 3 leuA 2-isopropylmalate synthase Caulobacter sp. (strain K31)
D5HB86 4.03e-145 431 43 5 528 3 leuA 2-isopropylmalate synthase Salinibacter ruber (strain M8)
Q8EN67 4.03e-145 429 45 2 496 3 leuA 2-isopropylmalate synthase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q7TUV5 7.26e-145 430 48 4 494 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9313)
A2C859 7.66e-145 430 48 5 495 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9303)
E1R5X1 2.42e-144 427 44 5 514 3 leuA 2-isopropylmalate synthase Sediminispirochaeta smaragdinae (strain DSM 11293 / JCM 15392 / SEBR 4228)
A0RQK7 3.17e-144 427 44 4 500 3 leuA 2-isopropylmalate synthase Campylobacter fetus subsp. fetus (strain 82-40)
A4IRH8 5.33e-144 427 45 1 506 3 leuA 2-isopropylmalate synthase Geobacillus thermodenitrificans (strain NG80-2)
P94565 9.17e-144 426 45 2 495 3 leuA 2-isopropylmalate synthase Bacillus subtilis (strain 168)
Q87CL8 1.37e-143 426 44 3 503 3 leuA 2-isopropylmalate synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I596 1.37e-143 426 44 3 503 3 leuA 2-isopropylmalate synthase Xylella fastidiosa (strain M23)
Q9PCG3 2.28e-143 425 44 3 503 3 leuA 2-isopropylmalate synthase Xylella fastidiosa (strain 9a5c)
A7Z7B8 1.25e-142 423 45 2 493 3 leuA 2-isopropylmalate synthase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A3DF94 1.4e-142 423 44 2 490 3 leuA 2-isopropylmalate synthase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
E1QWZ1 2.38e-142 422 45 6 513 3 leuA 2-isopropylmalate synthase Olsenella uli (strain ATCC 49627 / DSM 7084 / CCUG 31166 / CIP 109912 / JCM 12494 / LMG 11480 / NCIMB 702895 / VPI D76D-27C)
B4SI67 2.56e-140 417 44 5 505 3 leuA 2-isopropylmalate synthase Stenotrophomonas maltophilia (strain R551-3)
B2FT78 2.88e-140 417 44 5 505 3 leuA 2-isopropylmalate synthase Stenotrophomonas maltophilia (strain K279a)
Q65GI8 1.47e-136 408 43 1 493 3 leuA 2-isopropylmalate synthase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A7GMU1 2.92e-136 406 45 2 493 3 leuA 2-isopropylmalate synthase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B9IUZ0 5.25e-136 406 44 3 495 3 leuA 2-isopropylmalate synthase Bacillus cereus (strain Q1)
Q73BA0 5.25e-136 406 44 3 495 3 leuA 2-isopropylmalate synthase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81T68 7.58e-136 405 44 3 495 3 leuA 2-isopropylmalate synthase Bacillus anthracis
C3L9Q7 7.58e-136 405 44 3 495 3 leuA 2-isopropylmalate synthase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P4Z6 7.58e-136 405 44 3 495 3 leuA 2-isopropylmalate synthase Bacillus anthracis (strain A0248)
Q6HLF3 9.12e-136 405 44 3 495 3 leuA 2-isopropylmalate synthase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7JFY5 9.52e-136 405 44 3 495 3 leuA 2-isopropylmalate synthase Bacillus cereus (strain AH820)
A0RBL2 9.94e-136 405 44 3 495 3 leuA 2-isopropylmalate synthase Bacillus thuringiensis (strain Al Hakam)
Q63DX8 1.13e-135 405 44 3 495 3 leuA 2-isopropylmalate synthase Bacillus cereus (strain ZK / E33L)
C1EMA9 1.17e-135 405 44 3 495 3 leuA 2-isopropylmalate synthase Bacillus cereus (strain 03BB102)
C7M0E4 4.45e-135 404 45 2 496 3 leuA 2-isopropylmalate synthase Acidimicrobium ferrooxidans (strain DSM 10331 / JCM 15462 / NBRC 103882 / ICP)
Q8CNL3 1.83e-134 402 41 2 494 3 leuA 2-isopropylmalate synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMF9 1.83e-134 402 41 2 494 3 leuA 2-isopropylmalate synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P63477 4.45e-134 401 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain N315)
P63476 4.45e-134 401 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IUK3 4.45e-134 401 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain JH9)
A6U3E2 4.45e-134 401 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain JH1)
A7X4N1 4.45e-134 401 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A9VLG7 6.1e-134 400 44 3 495 3 leuA 2-isopropylmalate synthase Bacillus mycoides (strain KBAB4)
A8Z4W0 6.29e-134 400 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain USA300 / TCH1516)
A6QIQ3 6.29e-134 400 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain Newman)
Q5HEE4 6.29e-134 400 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain COL)
Q2FWK3 6.29e-134 400 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF67 6.29e-134 400 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain USA300)
Q6GF16 7.09e-134 400 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain MRSA252)
P58899 7.9e-134 400 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain MW2)
Q6G7Q1 7.9e-134 400 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain MSSA476)
Q2YUF2 4.05e-133 399 41 5 508 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q02YX5 1.26e-132 397 43 5 491 3 leuA 2-isopropylmalate synthase Lactococcus lactis subsp. cremoris (strain SK11)
B9DMJ6 2.22e-132 397 41 2 492 3 leuA 2-isopropylmalate synthase Staphylococcus carnosus (strain TM300)
O04973 2.05e-131 397 42 9 531 2 IPMSA 2-isopropylmalate synthase A Solanum pennellii
Q4L7U0 3.58e-131 394 41 2 494 3 leuA 2-isopropylmalate synthase Staphylococcus haemolyticus (strain JCSC1435)
Q49Z12 4.76e-130 391 41 2 494 3 leuA 2-isopropylmalate synthase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
C4XPA8 7.98e-130 390 41 2 503 3 leuA 2-isopropylmalate synthase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q9C550 8.74e-129 392 42 9 528 1 IPMS2 2-isopropylmalate synthase 2, chloroplastic Arabidopsis thaliana
O04974 7.11e-128 389 42 10 528 2 IPMSB 2-isopropylmalate synthase B Solanum pennellii
Q9LPR4 1.09e-127 389 42 9 528 1 IPMS1 2-isopropylmalate synthase 1, chloroplastic Arabidopsis thaliana
D3HCJ2 1.42e-127 385 40 3 508 3 leuA 2-isopropylmalate synthase Streptococcus gallolyticus (strain UCN34)
Q02141 6.26e-126 380 43 5 491 3 leuA 2-isopropylmalate synthase Lactococcus lactis subsp. lactis (strain IL1403)
Q8RDK3 4.2e-123 369 49 0 371 3 leuA1 2-isopropylmalate synthase 1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q58595 3.24e-118 360 42 7 506 1 leuA 2-isopropylmalate synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9FG67 5.24e-117 357 45 5 414 1 MAM1 Methylthioalkylmalate synthase 1, chloroplastic Arabidopsis thaliana
Q9FN52 4.98e-114 349 44 5 397 1 MAM3 Methylthioalkylmalate synthase 3, chloroplastic Arabidopsis thaliana
Q8VX04 6.69e-114 349 46 4 391 2 MAM2 Methylthioalkylmalate synthase 2, chloroplastic Arabidopsis thaliana
Q8TYB1 8.7e-114 348 40 7 507 3 leuA Probable 2-isopropylmalate synthase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
P0DO77 7.93e-113 347 45 4 391 1 MAM1-1 Methylthioalkylmalate synthase 1-1, chloroplastic Eutrema japonicum
P0DO78 7.65e-112 344 45 4 391 1 MAM1-2 Methylthioalkylmalate synthase 1-2, chloroplastic Eutrema japonicum
Q39891 2.65e-111 344 38 8 532 2 GMN56 Probable 2-isopropylmalate synthase Glycine max
O27525 1.16e-109 338 41 9 507 3 leuA Probable 2-isopropylmalate synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O30020 6.7e-105 326 37 7 503 3 leuA Probable 2-isopropylmalate synthase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q58787 9.5e-102 317 36 6 498 1 cimA (R)-citramalate synthase CimA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P58968 5.99e-97 306 36 10 513 3 leuA Probable 2-isopropylmalate synthase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
O26819 9.79e-97 305 38 10 511 3 cimA Putative (R)-citramalate synthase CimA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B8GEI1 2.67e-96 303 38 5 492 3 cimA Putative (R)-citramalate synthase CimA Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
Q8TJJ1 1.83e-95 301 36 5 495 3 cimA Putative (R)-citramalate synthase CimA Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8THA5 4.45e-95 301 35 9 513 3 leuA Probable 2-isopropylmalate synthase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O29305 8.49e-94 297 37 9 502 3 cimA Putative (R)-citramalate synthase CimA Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P58966 5.36e-93 295 36 5 495 3 cimA Putative (R)-citramalate synthase CimA Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A3CUF2 6.15e-93 295 36 5 499 3 cimA Putative (R)-citramalate synthase CimA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q8TYM1 2.49e-90 288 36 8 505 3 cimA Putative (R)-citramalate synthase CimA Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
A8AB61 2.65e-90 285 44 4 346 3 leuA Probable 2-isopropylmalate synthase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
Q974X3 4.45e-88 278 43 6 365 3 leuA 2-isopropylmalate synthase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q97W36 1.26e-87 277 41 6 380 3 leuA 2-isopropylmalate synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q8ZW35 1.44e-87 277 42 5 352 3 leuA Probable 2-isopropylmalate synthase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q4JA78 7.18e-86 273 40 5 380 1 Saci_0940 2-isopropylmalate synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q56216 1.09e-77 250 45 3 299 2 leuA 2-isopropylmalate synthase (Fragment) Thermus thermophilus
Q57926 1.25e-75 247 42 6 355 1 aksA Homocitrate synthase AksA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8TW28 2.85e-73 241 38 4 378 3 aksA Homocitrate synthase AksA Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
P58967 1.01e-66 224 34 6 387 3 aksA Homocitrate synthase AksA Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8TKQ6 4.06e-65 219 33 6 387 3 aksA Homocitrate synthase AksA Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O27667 4.59e-65 219 39 4 345 3 aksA Homocitrate synthase AksA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8RCF9 5.5e-64 216 37 6 378 3 leuA2 2-isopropylmalate synthase 2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
O66682 3.75e-62 215 30 14 520 3 cimA (R)-citramalate synthase Aquifex aeolicus (strain VF5)
C3MPM7 9.25e-60 207 34 5 356 3 LS215_1332 Homocitrate synthase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C3NDV7 1.02e-59 207 34 5 356 3 YG5714_1230 Homocitrate synthase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NHU6 1.02e-59 207 34 5 356 3 YN1551_1618 Homocitrate synthase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MYM1 1.02e-59 207 34 5 356 3 M1425_1245 Homocitrate synthase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C4KGW9 1.02e-59 207 34 5 356 3 M164_1229 Homocitrate synthase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3N5A3 1.02e-59 207 34 5 356 3 M1627_1295 Homocitrate synthase Sulfolobus islandicus (strain M.16.27)
Q971S5 6.11e-57 199 33 6 356 1 STK_13010 Homocitrate synthase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q9WZ22 2.74e-56 199 29 15 526 3 cimA (R)-citramalate synthase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P05342 4.02e-55 192 34 6 358 3 nifV Homocitrate synthase Azotobacter vinelandii
Q97ZE0 1.67e-54 193 34 5 356 3 SSO0977 Homocitrate synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q4J989 1.83e-54 193 32 12 418 1 Saci_1304 Homocitrate synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P58637 5.28e-53 187 34 7 361 3 nifV2 Homocitrate synthase 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O59390 5.55e-52 183 31 5 346 3 PH1727 Homocitrate synthase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9V1J1 8.77e-52 183 32 5 343 3 PYRAB04360 Homocitrate synthase Pyrococcus abyssi (strain GE5 / Orsay)
Q8F8T4 7.52e-51 182 33 7 351 1 leuA2 2-isopropylmalate synthase 2 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q44290 3.88e-48 174 33 6 360 3 nifV1 Homocitrate synthase 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q74C76 2.97e-46 172 27 16 541 1 cimA (R)-citramalate synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q4J6H1 3.93e-46 172 27 14 529 1 cimA (R)-citramalate synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P23122 1.6e-45 167 33 7 353 3 nifV Homocitrate synthase Azotobacter chroococcum mcd 1
Q0ZQ46 3.6e-44 163 31 6 348 1 frbC 2-phosphonomethylmalate synthase Streptomyces rubellomurinus (strain ATCC 31215)
P74269 8.58e-44 166 28 16 532 3 cimA (R)-citramalate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P54610 2.44e-43 161 33 10 364 3 nifV Homocitrate synthase Frankia sp. (strain FaC1)
P05345 5.69e-43 160 30 8 375 3 nifV Homocitrate synthase Klebsiella pneumoniae
Q8F3Q1 1e-42 162 28 14 526 1 cimA (R)-citramalate synthase CimA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q9Y823 7.56e-42 158 31 7 377 1 lys4 Homocitrate synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q52070 2.2e-41 156 31 6 346 3 nifV Homocitrate synthase Enterobacter agglomerans
Q07179 3.36e-41 155 33 6 357 3 nifV Homocitrate synthase Rhodobacter capsulatus
O86511 2.87e-40 155 27 14 486 3 cimA (R)-citramalate synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q47884 4.52e-40 151 33 8 353 3 nifV Homocitrate synthase Frankia alni
P0DO96 5.31e-40 152 31 9 361 1 cbdbA1708 Citrate (Re)-synthase Dehalococcoides mccartyi (strain CBDB1)
P48570 3.4e-39 150 30 4 363 1 LYS20 Homocitrate synthase, cytosolic isozyme Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12122 4.66e-38 148 29 4 362 1 LYS21 Homocitrate synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O87198 1.02e-37 145 31 11 369 1 lys20 Homocitrate synthase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q01181 1.63e-37 145 29 6 358 3 nifV Homocitrate synthase Cereibacter sphaeroides
Q97MC5 1.41e-36 145 25 15 531 3 leuA 2-isopropylmalate synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P70728 1.73e-35 139 31 8 360 3 nifV Homocitrate synthase Azospirillum brasilense
A7HP03 2.44e-35 142 27 18 541 3 leuA 2-isopropylmalate synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
O94225 1.29e-34 139 26 6 429 1 lys1 Homocitrate synthase, mitochondrial Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A8FAK7 3.23e-34 139 24 16 529 3 leuA 2-isopropylmalate synthase Bacillus pumilus (strain SAFR-032)
Q24PE3 3.67e-34 139 24 15 536 3 leuA 2-isopropylmalate synthase Desulfitobacterium hafniense (strain Y51)
Q12726 5.62e-34 136 27 3 359 3 LYS1 Homocitrate synthase, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
Q47RM9 1.76e-33 137 27 17 536 3 leuA 2-isopropylmalate synthase Thermobifida fusca (strain YX)
A8L551 7.14e-33 135 25 13 530 3 leuA 2-isopropylmalate synthase Parafrankia sp. (strain EAN1pec)
Q31EF5 1.37e-32 134 24 14 517 3 leuA 2-isopropylmalate synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B2AHM5 2.92e-31 130 27 16 523 3 leuA 2-isopropylmalate synthase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A9HW07 6.36e-31 129 25 13 530 3 leuA 2-isopropylmalate synthase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A6WDF2 6.58e-31 129 25 14 543 3 leuA 2-isopropylmalate synthase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
E3PVH7 1.17e-30 129 25 14 532 3 leuA 2-isopropylmalate synthase Acetoanaerobium sticklandii (strain ATCC 12662 / DSM 519 / JCM 1433 / CCUG 9281 / NCIMB 10654 / HF)
Q7VH30 1.28e-30 129 22 13 541 3 leuA 2-isopropylmalate synthase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B2SXZ9 3.86e-30 127 26 20 538 3 leuA 2-isopropylmalate synthase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
O31046 4e-30 127 25 16 547 3 leuA 2-isopropylmalate synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q13WM0 7.04e-30 126 26 20 534 3 leuA 2-isopropylmalate synthase Paraburkholderia xenovorans (strain LB400)
Q82BV3 8.31e-30 126 25 21 552 3 leuA 2-isopropylmalate synthase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q2RT17 1.34e-29 125 24 14 530 3 leuA 2-isopropylmalate synthase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q9X7L2 3.8e-29 124 24 13 529 3 leuA 2-isopropylmalate synthase Rhizobium meliloti (strain 1021)
B0RCQ8 4.49e-29 124 25 18 540 3 leuA 2-isopropylmalate synthase Clavibacter sepedonicus
B2UJY9 6.71e-29 124 25 17 533 3 leuA 2-isopropylmalate synthase Ralstonia pickettii (strain 12J)
Q98HN3 1.24e-28 122 24 13 529 3 leuA 2-isopropylmalate synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A1KBD3 1.63e-28 122 25 17 541 3 leuA 2-isopropylmalate synthase Azoarcus sp. (strain BH72)
Q00853 2.92e-28 116 35 4 244 3 nifV-ALPHA Homocitrate synthase subunit alpha Clostridium pasteurianum
A5CRB9 3.51e-28 121 25 18 540 3 leuA 2-isopropylmalate synthase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q3K7C3 6.63e-28 120 24 12 533 3 leuA 2-isopropylmalate synthase Pseudomonas fluorescens (strain Pf0-1)
B0KRD9 1.1e-27 120 24 15 534 3 leuA 2-isopropylmalate synthase Pseudomonas putida (strain GB-1)
B1JDI2 1.66e-27 119 23 15 534 3 leuA 2-isopropylmalate synthase Pseudomonas putida (strain W619)
A0LBW3 2.31e-27 119 26 17 534 3 leuA 2-isopropylmalate synthase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A5VZB6 2.99e-27 119 23 15 534 3 leuA 2-isopropylmalate synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88P28 4.13e-27 118 23 15 534 3 leuA 2-isopropylmalate synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4K6V7 5.53e-27 118 24 13 533 3 leuA 2-isopropylmalate synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B8H8Q9 5.74e-27 118 23 15 544 3 leuA 2-isopropylmalate synthase Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
A4XY24 1.29e-26 117 25 15 525 3 leuA 2-isopropylmalate synthase Pseudomonas mendocina (strain ymp)
Q8UD63 1.34e-26 117 24 14 529 3 leuA 2-isopropylmalate synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
A1R6V4 1.54e-26 117 23 14 544 3 leuA 2-isopropylmalate synthase Paenarthrobacter aurescens (strain TC1)
A0PVE6 1.86e-26 116 25 16 542 3 leuA 2-isopropylmalate synthase Mycobacterium ulcerans (strain Agy99)
P06208 2.93e-26 116 25 13 548 1 LEU4 2-isopropylmalate synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A9WML8 3.01e-26 115 23 13 548 3 leuA 2-isopropylmalate synthase Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
A4VNV6 3.24e-26 115 24 16 552 3 leuA 2-isopropylmalate synthase Stutzerimonas stutzeri (strain A1501)
Q8FZC4 3.41e-26 115 25 16 532 3 leuA 2-isopropylmalate synthase Brucella suis biovar 1 (strain 1330)
Q1I5K2 3.78e-26 115 24 18 532 3 leuA 2-isopropylmalate synthase Pseudomonas entomophila (strain L48)
A6VSA9 5.82e-26 115 27 9 363 3 leuA 2-isopropylmalate synthase Marinomonas sp. (strain MWYL1)
C3K1K7 5.85e-26 115 24 13 529 3 leuA 2-isopropylmalate synthase Pseudomonas fluorescens (strain SBW25)
Q1MDH6 6.94e-26 114 25 16 532 3 leuA 2-isopropylmalate synthase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8XSZ5 7.89e-26 114 26 18 538 3 leuA 2-isopropylmalate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
O59736 1.08e-25 114 24 15 533 3 leu3 2-isopropylmalate synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q48LY5 2.02e-25 113 24 16 533 3 leuA 2-isopropylmalate synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A0JX36 2.26e-25 113 22 15 544 3 leuA 2-isopropylmalate synthase Arthrobacter sp. (strain FB24)
S3D9F8 2.8e-25 113 26 6 326 1 gloH Isopropyl malate synthase gloH Glarea lozoyensis (strain ATCC 20868 / MF5171)
C1DE40 2.96e-25 112 23 13 527 3 leuA 2-isopropylmalate synthase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B7GT76 4.3e-25 112 27 10 381 3 leuA 2-isopropylmalate synthase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q8YIJ3 4.42e-25 112 24 16 532 3 leuA 2-isopropylmalate synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q6AED3 4.53e-25 112 25 17 542 3 leuA 2-isopropylmalate synthase Leifsonia xyli subsp. xyli (strain CTCB07)
D8J0Q1 1.26e-24 110 25 17 543 3 leuA 2-isopropylmalate synthase Herbaspirillum seropedicae (strain SmR1)
D2ATJ4 1.5e-24 110 26 17 542 3 leuA 2-isopropylmalate synthase Streptosporangium roseum (strain ATCC 12428 / DSM 43021 / JCM 3005 / KCTC 9067 / NCIMB 10171 / NRRL 2505 / NI 9100)
A4QAP0 1.53e-24 110 24 16 536 3 leuA 2-isopropylmalate synthase Corynebacterium glutamicum (strain R)
Q886Y1 1.93e-24 110 23 15 529 3 leuA 2-isopropylmalate synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZX14 7.01e-24 108 23 15 529 3 leuA 2-isopropylmalate synthase Pseudomonas syringae pv. syringae (strain B728a)
P9WQB3 8.22e-24 108 25 15 505 1 leuA 2-isopropylmalate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQB2 8.22e-24 108 25 15 505 3 leuA 2-isopropylmalate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8FU05 1.26e-23 108 24 16 542 3 leuA 2-isopropylmalate synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q9CB76 1.42e-23 108 24 17 533 3 leuA 2-isopropylmalate synthase Mycobacterium leprae (strain TN)
Q12166 1.47e-23 107 27 6 362 1 LEU9 2-isopropylmalate synthase 2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7TVV6 2.01e-23 107 25 15 505 3 leuA 2-isopropylmalate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B2GHT7 2.84e-23 107 23 14 551 3 leuA 2-isopropylmalate synthase Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
A6V0X2 4.5e-23 106 23 15 535 3 leuA 2-isopropylmalate synthase Pseudomonas aeruginosa (strain PA7)
Q9HXK5 6.19e-23 105 23 15 535 3 leuA 2-isopropylmalate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
C9K7B8 9.5e-23 105 27 6 324 2 AMT7 Isopropyl malate synthase AMT7 Alternaria alternata
Q0VLR3 1.38e-22 104 25 14 520 3 leuA 2-isopropylmalate synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
P42455 1.56e-22 104 24 19 545 1 leuA 2-isopropylmalate synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
C7QJN7 1.67e-21 101 23 15 549 3 leuA 2-isopropylmalate synthase Catenulispora acidiphila (strain DSM 44928 / JCM 14897 / NBRC 102108 / NRRL B-24433 / ID139908)
A6W1X1 1.02e-19 94 27 13 304 3 Mmwyl1_3801 4-hydroxy-2-oxovalerate aldolase Marinomonas sp. (strain MWYL1)
Q5YVA5 1.48e-18 92 26 9 367 3 leuA 2-isopropylmalate synthase Nocardia farcinica (strain IFM 10152)
A8H4E9 5.3e-17 85 26 9 300 3 Spea_2116 4-hydroxy-2-oxovalerate aldolase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A5N6T4 4.59e-16 84 24 10 355 1 CKL_0973 Citrate (Re)-synthase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
K0E4E5 6.44e-16 84 28 7 327 1 htyA Isopropyl malate synthase htyA Aspergillus rugulosus
B0TTS9 6.69e-16 82 27 13 305 3 Shal_2088 4-hydroxy-2-oxovalerate aldolase Shewanella halifaxensis (strain HAW-EB4)
P51017 3.46e-15 80 26 12 304 3 nahM 4-hydroxy-2-oxovalerate aldolase Pseudomonas putida
Q3ACM0 2.31e-14 77 27 10 268 3 mhpE 4-hydroxy-2-oxovalerate aldolase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q9ZI56 5.88e-14 76 25 12 304 3 nahM 4-hydroxy-2-oxovalerate aldolase Stutzerimonas stutzeri
A5D523 6.75e-14 76 28 12 311 3 PTH_0483 4-hydroxy-2-oxovalerate aldolase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A1TDB7 2.1e-13 75 28 9 262 3 Mvan_4391 4-hydroxy-2-oxovalerate aldolase 2 Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
B1VRH5 7.14e-13 73 26 10 310 3 SGR_564 4-hydroxy-2-oxovalerate aldolase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q2T7S9 1.18e-12 72 27 7 257 3 mhpE 4-hydroxy-2-oxovalerate aldolase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3JK55 2.08e-12 72 28 9 257 3 mhpE 4-hydroxy-2-oxovalerate aldolase Burkholderia pseudomallei (strain 1710b)
O34873 2.1e-12 71 24 12 295 1 yngG Hydroxymethylglutaryl-CoA lyase YngG Bacillus subtilis (strain 168)
A1W2K3 2.23e-12 72 27 14 309 3 Ajs_0224 4-hydroxy-2-oxovalerate aldolase Acidovorax sp. (strain JS42)
A3NML2 2.34e-12 72 28 9 257 3 mhpE 4-hydroxy-2-oxovalerate aldolase Burkholderia pseudomallei (strain 668)
A3P825 2.34e-12 72 28 9 257 3 BURPS1106A_A2454 4-hydroxy-2-oxovalerate aldolase Burkholderia pseudomallei (strain 1106a)
A1K6L9 2.83e-12 71 26 12 280 3 lapG 4-hydroxy-2-oxovalerate aldolase 1 Azoarcus sp. (strain BH72)
Q0A5T5 3.32e-12 71 26 9 260 3 Mlg_2462 4-hydroxy-2-oxovalerate aldolase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q63JB1 4.74e-12 70 28 10 260 3 mhpE 4-hydroxy-2-oxovalerate aldolase Burkholderia pseudomallei (strain K96243)
Q5R9E1 8.71e-12 70 24 5 201 2 HMGCL Hydroxymethylglutaryl-CoA lyase, mitochondrial Pongo abelii
B8G187 1.3e-11 69 26 10 287 3 Dhaf_1245 4-hydroxy-2-oxovalerate aldolase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q8HXZ6 1.37e-11 69 23 7 292 2 HMGCL Hydroxymethylglutaryl-CoA lyase, mitochondrial Macaca fascicularis
Q764S0 1.53e-11 69 26 10 291 3 nahM 4-hydroxy-2-oxovalerate aldolase Geobacillus genomosp. 3
Q0RWN1 2.36e-11 68 28 8 255 3 RHA1_ro10112 4-hydroxy-2-oxovalerate aldolase 7 Rhodococcus jostii (strain RHA1)
Q53WI0 3.64e-11 68 27 7 249 1 TTHB246 4-hydroxy-2-oxovalerate aldolase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P97519 3.81e-11 67 21 9 299 2 Hmgcl Hydroxymethylglutaryl-CoA lyase, mitochondrial Rattus norvegicus
C1DN55 5.1e-11 67 26 9 260 3 lapG 4-hydroxy-2-oxovalerate aldolase 3 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS10265
Feature type CDS
Gene leuA
Product 2-isopropylmalate synthase
Location 2250396 - 2251955 (strand: 1)
Length 1560 (nucleotides) / 519 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_938
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00682 HMGL-like
PF08502 LeuA allosteric (dimerisation) domain
PF22617 Homocitrate synthase post-HMGL domain-like

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0119 Amino acid transport and metabolism (E) E Isopropylmalate/homocitrate/citramalate synthases

Kegg Ortholog Annotation(s)

Protein Sequence

MSNNVIIFDTTLRDGEQALQASLSVKEKLQIAYALERLGVDIIEAGFPVSSPGDFESVQTIAREIKNSRICALARCVDNDIDVAAESLNIAEAFRIHVFLATSALHAEHKLKKSFDDIIEMGTRSIKRARRYTDDVEFSCEDAGRTHIDNLCRIVESAINAGATTINIPDTVGYTTPYQFGGIITNLFERVPNIDKAVISVHCHDDLGMAVANSITAVQAGARQVEGTINGLGERAGNCALEEVIMAIKVREQMMNVQTRINHKEIYRTSQLVSQLCNTPIHANKSIVGSNAFAHSSGIHQDGVLKNRETYEIMTPESIGLKEVQLNLTSRSGRAAVKHRMEEMGYRETDYNLDSLYAAFLRLADKKGQVFDYDLEALAFMGQQQQEPDEFVMNYFNTQSGSSTVATASVSISRKNEEITEAATGNGPVDAVYQAISRATGYPLKLVTYQLTAKGEGRDALGQVDIVVEYQGRKFHGMGLETDIVGSSANAMMHVINSIWRSEQVEIEKRKHHTTQEAV

Flanking regions ( +/- flanking 50bp)

ATACCTGGGAGAGCGCAAAAAACGAAATAAAAAAGTATAAGGAACAGATTATGAGCAACAATGTGATTATTTTTGACACCACATTAAGAGATGGCGAACAAGCATTGCAAGCTAGCTTAAGCGTAAAAGAGAAGTTACAAATTGCTTATGCCTTAGAACGTTTAGGTGTAGATATCATTGAAGCGGGTTTTCCTGTCTCTTCCCCTGGGGATTTTGAATCTGTACAAACCATCGCTCGAGAAATTAAAAATAGTCGCATTTGTGCGTTAGCTCGCTGTGTTGATAATGATATTGACGTTGCCGCAGAGTCATTAAACATTGCCGAGGCATTTCGTATTCATGTTTTTTTAGCTACCTCCGCTTTGCATGCTGAACATAAGTTAAAAAAATCCTTTGATGACATTATTGAAATGGGAACACGCTCAATTAAACGCGCCCGACGCTATACTGATGATGTTGAGTTTTCTTGCGAAGATGCGGGGCGTACCCATATTGATAATTTATGTCGCATTGTGGAAAGTGCCATCAACGCGGGCGCAACAACCATTAATATTCCAGACACCGTAGGTTATACCACGCCTTATCAATTCGGTGGCATTATCACTAATTTATTTGAACGTGTACCTAATATTGATAAAGCGGTGATCTCCGTTCATTGCCATGATGATTTAGGTATGGCTGTTGCAAACTCTATTACCGCAGTACAAGCAGGTGCAAGACAAGTTGAAGGGACTATCAACGGCTTAGGTGAACGAGCCGGTAACTGCGCTTTAGAAGAAGTGATTATGGCGATAAAAGTACGTGAACAAATGATGAATGTACAAACGCGTATTAATCACAAAGAGATCTACCGTACCAGCCAGTTAGTCAGTCAATTATGTAATACCCCTATTCATGCCAATAAATCCATCGTTGGCTCAAATGCCTTTGCCCACTCCTCTGGTATTCACCAAGATGGCGTACTGAAAAATCGTGAAACTTACGAAATTATGACACCTGAATCAATTGGTTTAAAAGAGGTGCAATTGAACTTAACGTCTCGCTCTGGTCGAGCTGCGGTAAAACACCGTATGGAAGAGATGGGCTATCGCGAAACAGATTATAACTTAGATTCTTTATATGCTGCTTTCTTACGTTTAGCTGATAAAAAAGGTCAAGTTTTTGACTATGACTTAGAAGCATTGGCTTTTATGGGGCAACAACAACAAGAGCCTGATGAGTTTGTAATGAACTATTTTAATACTCAATCCGGCTCCTCAACAGTTGCCACGGCCAGTGTCAGCATTAGTCGTAAAAATGAAGAAATCACTGAAGCAGCAACAGGAAATGGTCCCGTTGATGCTGTCTATCAAGCTATTTCTCGTGCTACAGGTTATCCCTTAAAACTGGTGACTTATCAATTAACAGCCAAAGGTGAAGGACGAGATGCATTAGGACAAGTTGATATCGTAGTTGAATACCAAGGACGTAAATTTCATGGCATGGGATTAGAAACTGATATCGTCGGTTCATCCGCCAACGCCATGATGCATGTTATCAACAGTATTTGGCGTTCAGAGCAAGTCGAAATAGAAAAACGCAAACACCATACAACACAAGAAGCGGTTTAATCATTATGTCTAAACATTATCATATTGCAGTATTGCCCGGAGATGGCATT