Homologs in group_938

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04410 FBDBKF_04410 100.0 Morganella morganii S1 leuA 2-isopropylmalate synthase
EHELCC_05700 EHELCC_05700 100.0 Morganella morganii S2 leuA 2-isopropylmalate synthase
NLDBIP_06020 NLDBIP_06020 100.0 Morganella morganii S4 leuA 2-isopropylmalate synthase
HKOGLL_06375 HKOGLL_06375 100.0 Morganella morganii S5 leuA 2-isopropylmalate synthase
F4V73_RS08855 F4V73_RS08855 97.0 Morganella psychrotolerans leuA 2-isopropylmalate synthase
PMI_RS10265 PMI_RS10265 77.6 Proteus mirabilis HI4320 leuA 2-isopropylmalate synthase

Distribution of the homologs in the orthogroup group_938

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_938

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F194 0.0 843 78 0 511 3 leuA 2-isopropylmalate synthase Proteus mirabilis (strain HI4320)
A1JJH7 0.0 828 74 0 516 3 leuA 2-isopropylmalate synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JK98 0.0 824 73 0 516 3 leuA 2-isopropylmalate synthase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EM1 0.0 824 73 0 516 3 leuA 2-isopropylmalate synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TQA2 0.0 824 73 0 516 3 leuA 2-isopropylmalate synthase Yersinia pestis (strain Pestoides F)
Q1CMP5 0.0 824 73 0 516 3 leuA 2-isopropylmalate synthase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R142 0.0 824 73 0 516 3 leuA 2-isopropylmalate synthase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIG8 0.0 824 73 0 516 3 leuA 2-isopropylmalate synthase Yersinia pestis
B2K4C9 0.0 824 73 0 516 3 leuA 2-isopropylmalate synthase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C1Z6 0.0 824 73 0 516 3 leuA 2-isopropylmalate synthase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FM84 0.0 824 73 0 516 3 leuA 2-isopropylmalate synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7N129 0.0 819 75 0 515 3 leuA 2-isopropylmalate synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8G9R1 0.0 811 70 1 533 3 leuA 2-isopropylmalate synthase Serratia proteamaculans (strain 568)
Q2NVW3 0.0 785 71 0 517 3 leuA 2-isopropylmalate synthase Sodalis glossinidius (strain morsitans)
C6DEV8 0.0 777 70 0 512 3 leuA 2-isopropylmalate synthase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D0G8 0.0 775 70 0 512 3 leuA 2-isopropylmalate synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7MIC5 0.0 772 69 1 520 3 leuA 2-isopropylmalate synthase Cronobacter sakazakii (strain ATCC BAA-894)
C4LAV7 0.0 771 68 0 518 3 leuA 2-isopropylmalate synthase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A0KGM9 0.0 770 70 0 511 3 leuA 2-isopropylmalate synthase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q83SP0 0.0 769 68 1 526 3 leuA 2-isopropylmalate synthase Shigella flexneri
A8ALM5 0.0 769 69 1 518 3 leuA 2-isopropylmalate synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4SR62 0.0 769 70 0 511 3 leuA 2-isopropylmalate synthase Aeromonas salmonicida (strain A449)
Q3Z5T6 0.0 769 68 1 526 3 leuA 2-isopropylmalate synthase Shigella sonnei (strain Ss046)
Q326G1 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Shigella boydii serotype 4 (strain Sb227)
B2U281 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RGC3 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli (strain UTI89 / UPEC)
B6HZ24 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli (strain SE11)
P09151 0.0 768 68 1 526 1 leuA 2-isopropylmalate synthase Escherichia coli (strain K12)
B1IRA4 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FL75 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLR5 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7C2 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O1:K1 / APEC
A7ZW25 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O9:H4 (strain HS)
C4ZPZ7 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M119 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O8 (strain IAI1)
B7NHI2 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LFU5 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli (strain 55989 / EAEC)
B7MAJ9 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZHG6 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7N7U9 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B5YZB0 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9Z8 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O157:H7
B7UIC4 0.0 768 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LWE2 0.0 767 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LG11 0.0 767 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli (strain SMS-3-5 / SECEC)
Q32K20 0.0 766 68 1 526 3 leuA 2-isopropylmalate synthase Shigella dysenteriae serotype 1 (strain Sd197)
Q0T8C4 0.0 765 68 1 526 3 leuA 2-isopropylmalate synthase Shigella flexneri serotype 5b (strain 8401)
A6T4L9 0.0 765 69 1 518 3 leuA 2-isopropylmalate synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7MNT2 0.0 765 68 1 526 3 leuA 2-isopropylmalate synthase Escherichia coli O81 (strain ED1a)
B5Y1W2 0.0 763 69 1 518 3 leuA 2-isopropylmalate synthase Klebsiella pneumoniae (strain 342)
C0Q5H1 0.0 761 69 1 518 3 leuA 2-isopropylmalate synthase Salmonella paratyphi C (strain RKS4594)
Q57TE6 0.0 761 69 1 518 3 leuA 2-isopropylmalate synthase Salmonella choleraesuis (strain SC-B67)
P15875 0.0 760 69 1 518 1 leuA 2-isopropylmalate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TWW1 0.0 760 69 1 518 3 leuA 2-isopropylmalate synthase Salmonella schwarzengrund (strain CVM19633)
B5BLB5 0.0 760 69 1 518 3 leuA 2-isopropylmalate synthase Salmonella paratyphi A (strain AKU_12601)
A9MZK0 0.0 760 69 1 518 3 leuA 2-isopropylmalate synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PDG1 0.0 760 69 1 518 3 leuA 2-isopropylmalate synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SU36 0.0 760 69 1 518 3 leuA 2-isopropylmalate synthase Salmonella newport (strain SL254)
B4TJ72 0.0 760 69 1 518 3 leuA 2-isopropylmalate synthase Salmonella heidelberg (strain SL476)
B5RGE4 0.0 760 69 1 518 3 leuA 2-isopropylmalate synthase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R2K9 0.0 760 69 1 518 3 leuA 2-isopropylmalate synthase Salmonella enteritidis PT4 (strain P125109)
B5FI58 0.0 760 69 1 518 3 leuA 2-isopropylmalate synthase Salmonella dublin (strain CT_02021853)
B5F7U9 0.0 759 68 1 518 3 leuA 2-isopropylmalate synthase Salmonella agona (strain SL483)
A4W6H9 0.0 759 68 1 518 3 leuA 2-isopropylmalate synthase Enterobacter sp. (strain 638)
Q8Z9I0 0.0 758 68 1 518 3 leuA 2-isopropylmalate synthase Salmonella typhi
A9MQD8 0.0 755 68 1 524 3 leuA 2-isopropylmalate synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B2VDA7 0.0 753 69 0 511 3 leuA 2-isopropylmalate synthase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q6LV24 0.0 751 68 1 514 3 leuA 2-isopropylmalate synthase Photobacterium profundum (strain SS9)
Q7MP77 0.0 751 68 1 511 3 leuA 2-isopropylmalate synthase Vibrio vulnificus (strain YJ016)
Q8DEE1 0.0 751 68 1 511 3 leuA 2-isopropylmalate synthase Vibrio vulnificus (strain CMCP6)
Q87SS7 0.0 751 68 1 511 3 leuA 2-isopropylmalate synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P48571 0.0 746 67 1 518 3 leuA 2-isopropylmalate synthase Buchnera aphidicola subsp. Rhopalosiphum padi
C5B7R4 0.0 745 70 1 515 3 leuA 2-isopropylmalate synthase Edwardsiella ictaluri (strain 93-146)
O85063 0.0 745 66 1 518 3 leuA 2-isopropylmalate synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q493R0 0.0 743 66 0 517 3 leuA 2-isopropylmalate synthase Blochmanniella pennsylvanica (strain BPEN)
C3LR32 0.0 740 68 1 511 3 leuA 2-isopropylmalate synthase Vibrio cholerae serotype O1 (strain M66-2)
Q9KP83 0.0 740 68 1 511 3 leuA 2-isopropylmalate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B5FGH4 0.0 738 67 1 511 3 leuA 2-isopropylmalate synthase Aliivibrio fischeri (strain MJ11)
Q5E856 0.0 736 67 1 511 3 leuA 2-isopropylmalate synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A1S2E0 0.0 735 66 1 514 3 leuA 2-isopropylmalate synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B7VIF2 0.0 734 66 1 511 3 leuA 2-isopropylmalate synthase Vibrio atlanticus (strain LGP32)
Q9ZEY8 0.0 728 65 2 516 3 leuA 2-isopropylmalate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B6ELK0 0.0 724 66 1 510 3 leuA 2-isopropylmalate synthase Aliivibrio salmonicida (strain LFI1238)
A3QIP0 0.0 720 65 1 514 3 leuA 2-isopropylmalate synthase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q9CJN5 0.0 720 67 2 511 3 leuA 2-isopropylmalate synthase Pasteurella multocida (strain Pm70)
O85070 0.0 717 65 1 506 3 leuA 2-isopropylmalate synthase Buchnera aphidicola subsp. Diuraphis noxia
A8H9A1 0.0 716 64 1 516 3 leuA 2-isopropylmalate synthase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TQM0 0.0 716 65 1 516 3 leuA 2-isopropylmalate synthase Shewanella halifaxensis (strain HAW-EB4)
A1SRG8 0.0 711 64 1 513 3 leuA 2-isopropylmalate synthase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B8CM39 0.0 711 63 1 519 3 leuA 2-isopropylmalate synthase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q9EVH0 0.0 711 65 1 501 3 leuA 2-isopropylmalate synthase (Fragment) Buchnera aphidicola subsp. Uroleucon ambrosiae
Q9EVH6 0.0 711 66 1 493 3 leuA 2-isopropylmalate synthase (Fragment) Buchnera aphidicola subsp. Uroleucon erigeronensis
B1KKZ4 0.0 710 64 1 514 3 leuA 2-isopropylmalate synthase Shewanella woodyi (strain ATCC 51908 / MS32)
A6WIB5 0.0 709 65 2 520 3 leuA 2-isopropylmalate synthase Shewanella baltica (strain OS185)
A1REY0 0.0 708 65 2 520 3 leuA 2-isopropylmalate synthase Shewanella sp. (strain W3-18-1)
Q0HZT4 0.0 708 65 3 523 3 leuA 2-isopropylmalate synthase Shewanella sp. (strain MR-7)
Q0HE65 0.0 708 65 3 523 3 leuA 2-isopropylmalate synthase Shewanella sp. (strain MR-4)
A4Y2M0 0.0 708 65 2 520 3 leuA 2-isopropylmalate synthase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A0L1R0 0.0 706 65 3 523 3 leuA 2-isopropylmalate synthase Shewanella sp. (strain ANA-3)
B0USF6 0.0 706 65 2 511 3 leuA 2-isopropylmalate synthase Histophilus somni (strain 2336)
B8E4K4 0.0 706 65 2 520 3 leuA 2-isopropylmalate synthase Shewanella baltica (strain OS223)
Q0I2G1 0.0 705 65 2 511 3 leuA 2-isopropylmalate synthase Histophilus somni (strain 129Pt)
A3CZK5 0.0 705 65 2 520 3 leuA 2-isopropylmalate synthase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A5UD85 0.0 704 65 1 510 3 leuA 2-isopropylmalate synthase Haemophilus influenzae (strain PittEE)
A9KY13 0.0 704 65 2 520 3 leuA 2-isopropylmalate synthase Shewanella baltica (strain OS195)
Q4QLS4 0.0 702 65 1 510 3 leuA 2-isopropylmalate synthase Haemophilus influenzae (strain 86-028NP)
Q9EVI8 0.0 702 65 1 501 3 leuA 2-isopropylmalate synthase (Fragment) Buchnera aphidicola subsp. Uroleucon sonchi
P43861 0.0 700 65 1 510 3 leuA 2-isopropylmalate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8E9N2 0.0 699 65 3 523 3 leuA 2-isopropylmalate synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A8FQ83 0.0 698 64 1 516 3 leuA 2-isopropylmalate synthase Shewanella sediminis (strain HAW-EB3)
Q9EVG4 0.0 695 63 1 501 3 leuA 2-isopropylmalate synthase (Fragment) Buchnera aphidicola subsp. Macrosiphoniella ludovicianae
Q07WG9 0.0 695 63 2 520 3 leuA 2-isopropylmalate synthase Shewanella frigidimarina (strain NCIMB 400)
Q15QR4 0.0 691 63 1 512 3 leuA 2-isopropylmalate synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q12SE7 0.0 690 65 2 515 3 leuA 2-isopropylmalate synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q7VQJ6 0.0 672 62 1 507 3 leuA 2-isopropylmalate synthase Blochmanniella floridana
Q5WQ01 0.0 664 59 2 515 3 leuA 2-isopropylmalate synthase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
P58898 0.0 637 57 3 507 3 leuA 2-isopropylmalate synthase Buchnera aphidicola subsp. Pemphigus spyrothecae
Q9EVE3 0.0 620 65 1 437 3 leuA 2-isopropylmalate synthase (Fragment) Buchnera aphidicola subsp. Uroleucon rurale
Q5HS76 0.0 610 58 3 511 3 leuA 2-isopropylmalate synthase Campylobacter jejuni (strain RM1221)
Q9PLV9 0.0 610 58 3 511 3 leuA 2-isopropylmalate synthase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FP35 0.0 609 57 3 511 3 leuA 2-isopropylmalate synthase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A7H667 0.0 607 57 2 509 3 leuA 2-isopropylmalate synthase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A1W1X2 0.0 605 57 3 511 3 leuA 2-isopropylmalate synthase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q89A49 0.0 552 64 0 379 5 leuA Putative 2-isopropylmalate synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A4J181 0.0 526 51 2 501 3 leuA 2-isopropylmalate synthase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B0TCR1 6.22e-179 516 51 1 511 3 leuA 2-isopropylmalate synthase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q3AEQ5 1.48e-176 510 49 3 511 3 leuA 2-isopropylmalate synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B1H0A7 3.28e-174 504 50 2 502 3 leuA 2-isopropylmalate synthase Endomicrobium trichonymphae
A5D4W0 8.75e-173 500 50 3 502 3 leuA 2-isopropylmalate synthase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q8U2A2 2.95e-171 496 50 3 502 3 leuA 2-isopropylmalate synthase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q0AGN5 1.93e-169 492 49 2 500 3 leuA 2-isopropylmalate synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
O31287 6.56e-169 485 61 2 359 3 leuA 2-isopropylmalate synthase (Fragment) Buchnera aphidicola subsp. Thelaxes suberi
A1AWA1 7.5e-168 488 50 2 503 3 leuA 2-isopropylmalate synthase Ruthia magnifica subsp. Calyptogena magnifica
Q820M0 3.22e-167 486 49 2 500 3 leuA 2-isopropylmalate synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B1WQQ4 5.43e-167 487 49 7 524 3 leuA 2-isopropylmalate synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q2LWJ3 1.32e-166 485 48 2 508 3 leuA 2-isopropylmalate synthase Syntrophus aciditrophicus (strain SB)
B8I1T7 8.49e-166 483 49 2 505 3 leuA 2-isopropylmalate synthase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q3J877 1.42e-165 482 50 1 500 3 leuA 2-isopropylmalate synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q31I16 1.73e-165 482 47 2 505 3 leuA 2-isopropylmalate synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q605K7 3.32e-165 481 49 1 501 3 leuA 2-isopropylmalate synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A5CWZ3 5.65e-165 481 48 1 501 3 leuA 2-isopropylmalate synthase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B1I1Y1 4.13e-164 478 48 2 500 3 leuA 2-isopropylmalate synthase Desulforudis audaxviator (strain MP104C)
O67862 4.27e-163 476 48 3 501 3 leuA 2-isopropylmalate synthase Aquifex aeolicus (strain VF5)
B1XLQ9 7.57e-163 476 50 5 517 3 leuA 2-isopropylmalate synthase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B7JYP4 4.36e-162 474 49 5 513 3 leuA 2-isopropylmalate synthase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q47BI0 9.51e-162 473 48 1 500 3 leuA 2-isopropylmalate synthase Dechloromonas aromatica (strain RCB)
Q7UI51 9.81e-162 473 49 1 494 3 leuA 2-isopropylmalate synthase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q8DJ32 2.48e-161 472 48 4 515 3 leuA 2-isopropylmalate synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B5YEF4 7.28e-161 470 48 3 494 3 leuA 2-isopropylmalate synthase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q9RUA9 8.06e-161 471 48 3 497 3 leuA 2-isopropylmalate synthase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q72RL9 7.37e-160 467 47 0 499 3 leuA 2-isopropylmalate synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8F445 7.37e-160 467 47 0 499 1 leuA1 2-isopropylmalate synthase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
B7KJX8 9.66e-160 468 48 7 526 3 leuA 2-isopropylmalate synthase Gloeothece citriformis (strain PCC 7424)
B0JGK2 1.06e-159 468 48 4 522 3 leuA 2-isopropylmalate synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q112U2 1.65e-159 468 47 5 529 3 leuA 2-isopropylmalate synthase Trichodesmium erythraeum (strain IMS101)
B8DM91 2.99e-159 466 46 2 499 3 leuA 2-isopropylmalate synthase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q2YBW0 3.02e-159 466 50 4 501 3 leuA 2-isopropylmalate synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A6LDN1 1.88e-158 464 47 3 498 3 leuA 2-isopropylmalate synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B8E2W9 2.29e-158 463 47 3 494 3 leuA 2-isopropylmalate synthase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q7P0H2 2.3e-158 464 48 3 501 3 leuA 2-isopropylmalate synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P94907 2.43e-158 464 47 4 522 3 leuA 2-isopropylmalate synthase Microcystis aeruginosa
Q5NXN2 3.48e-158 463 48 1 500 3 leuA 2-isopropylmalate synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q89GB0 1.97e-157 462 47 2 499 3 leuA 2-isopropylmalate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q39ED5 3.2e-157 461 48 3 502 3 leuA 2-isopropylmalate synthase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P48575 3.4e-157 461 47 5 527 3 leuA 2-isopropylmalate synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3MBA3 3.63e-157 461 47 5 527 3 leuA 2-isopropylmalate synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B4E5N2 6.7e-157 460 48 3 502 3 leuA 2-isopropylmalate synthase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q21VZ1 1.53e-156 459 47 2 501 3 leuA 2-isopropylmalate synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B9MA32 2.05e-156 459 47 3 503 3 leuA 2-isopropylmalate synthase Acidovorax ebreus (strain TPSY)
Q63VP3 3e-156 459 48 3 504 3 leuA 2-isopropylmalate synthase Burkholderia pseudomallei (strain K96243)
A3N7K7 3e-156 459 48 3 504 3 leuA 2-isopropylmalate synthase Burkholderia pseudomallei (strain 668)
Q3JUB9 3e-156 459 48 3 504 3 leuA 2-isopropylmalate synthase Burkholderia pseudomallei (strain 1710b)
A3NT94 3e-156 459 48 3 504 3 leuA 2-isopropylmalate synthase Burkholderia pseudomallei (strain 1106a)
A3PDH0 6.4e-156 459 45 8 551 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9301)
Q8XXP1 6.85e-156 457 48 2 501 3 leuA 2-isopropylmalate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A1W6T7 7.47e-156 457 47 3 503 3 leuA 2-isopropylmalate synthase Acidovorax sp. (strain JS42)
B2JDN6 1.07e-155 457 47 5 504 3 leuA 2-isopropylmalate synthase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q1BV03 1.23e-155 457 48 3 502 3 leuA 2-isopropylmalate synthase Burkholderia orbicola (strain AU 1054)
B1JVQ1 1.23e-155 457 48 3 502 3 leuA 2-isopropylmalate synthase Burkholderia orbicola (strain MC0-3)
A0K933 1.23e-155 457 48 3 502 3 leuA 2-isopropylmalate synthase Burkholderia cenocepacia (strain HI2424)
Q138Z2 1.59e-155 457 46 2 513 3 leuA 2-isopropylmalate synthase Rhodopseudomonas palustris (strain BisB5)
C5D5M0 1.6e-155 457 47 1 507 3 leuA 2-isopropylmalate synthase Geobacillus sp. (strain WCH70)
B1ZDN3 1.62e-155 457 46 2 502 3 leuA 2-isopropylmalate synthase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B1XUJ3 2.01e-155 456 47 2 508 3 leuA 2-isopropylmalate synthase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A7ZES2 2.86e-155 456 48 5 501 3 leuA 2-isopropylmalate synthase Campylobacter concisus (strain 13826)
Q9UZ08 2.95e-155 455 47 2 486 3 leuA 2-isopropylmalate synthase Pyrococcus abyssi (strain GE5 / Orsay)
A7I0N8 4.23e-155 455 48 4 504 3 leuA 2-isopropylmalate synthase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A4SXR0 7.56e-155 455 47 2 508 3 leuA 2-isopropylmalate synthase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B7GH19 8.9e-155 455 48 1 504 3 leuA 2-isopropylmalate synthase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A1KTV6 1.73e-154 454 46 3 501 3 leuA 2-isopropylmalate synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A2SHL8 2.26e-154 454 48 3 502 3 leuA 2-isopropylmalate synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q9JZG1 3.39e-154 453 46 3 501 1 leuA 2-isopropylmalate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q07PI3 4.45e-154 453 46 1 498 3 leuA 2-isopropylmalate synthase Rhodopseudomonas palustris (strain BisA53)
C0Z9C8 5.63e-154 452 47 2 495 3 leuA 2-isopropylmalate synthase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q6N858 6.44e-154 453 46 2 513 3 leuA 2-isopropylmalate synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B3QCX5 6.51e-154 453 46 2 513 3 leuA 2-isopropylmalate synthase Rhodopseudomonas palustris (strain TIE-1)
Q9JUK6 9.93e-154 452 46 3 501 3 leuA 2-isopropylmalate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
D3EBC1 1.09e-153 452 44 5 504 3 leuA 2-isopropylmalate synthase Geobacillus sp. (strain Y412MC10)
A1VN06 1.6e-153 451 48 4 502 3 leuA 2-isopropylmalate synthase Polaromonas naphthalenivorans (strain CJ2)
Q9K8E8 1.88e-153 451 46 1 494 3 leuA 2-isopropylmalate synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0KCT8 2.05e-153 451 47 2 501 3 leuA 2-isopropylmalate synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A5MZ76 2.91e-153 451 46 2 501 3 leuA 2-isopropylmalate synthase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E371 2.91e-153 451 46 2 501 3 leuA 2-isopropylmalate synthase Clostridium kluyveri (strain NBRC 12016)
Q3SHE7 2.93e-153 451 47 1 500 3 leuA 2-isopropylmalate synthase Thiobacillus denitrificans (strain ATCC 25259)
Q1LPX2 4.49e-153 450 47 2 501 3 leuA 2-isopropylmalate synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B3DX88 1.04e-152 449 46 4 499 3 leuA 2-isopropylmalate synthase Methylacidiphilum infernorum (isolate V4)
Q212A9 1.25e-152 449 46 2 499 3 leuA 2-isopropylmalate synthase Rhodopseudomonas palustris (strain BisB18)
Q2IUT4 2.56e-152 449 46 1 497 3 leuA 2-isopropylmalate synthase Rhodopseudomonas palustris (strain HaA2)
Q5F8D4 4.31e-152 451 46 3 501 3 leuA 2-isopropylmalate synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q473V1 6.21e-152 447 47 2 501 3 leuA 2-isopropylmalate synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A5GM47 1.37e-151 447 47 6 496 3 leuA 2-isopropylmalate synthase Synechococcus sp. (strain WH7803)
A9AJN4 2.84e-151 446 48 3 502 3 leuA 2-isopropylmalate synthase Burkholderia multivorans (strain ATCC 17616 / 249)
B1XYA8 3.64e-151 446 47 3 502 3 leuA 2-isopropylmalate synthase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q7NI93 7.63e-151 446 46 4 514 3 leuA 2-isopropylmalate synthase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q5KWJ3 7.8e-151 445 46 1 509 3 leuA 2-isopropylmalate synthase Geobacillus kaustophilus (strain HTA426)
A1TRT4 8.14e-151 444 46 2 501 3 leuA 2-isopropylmalate synthase Paracidovorax citrulli (strain AAC00-1)
P48576 1.12e-150 445 47 6 522 3 leuA 2-isopropylmalate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A5GRZ0 1.65e-150 445 48 4 494 3 leuA 2-isopropylmalate synthase Synechococcus sp. (strain RCC307)
A8FFW5 2.44e-150 444 44 2 507 3 leuA 2-isopropylmalate synthase Bacillus pumilus (strain SAFR-032)
Q0BDB9 2.78e-150 443 47 3 502 3 leuA 2-isopropylmalate synthase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YTR7 3.49e-150 443 47 3 502 3 leuA 2-isopropylmalate synthase Burkholderia ambifaria (strain MC40-6)
Q1QJV3 3.93e-150 443 45 2 499 3 leuA 2-isopropylmalate synthase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q5WEN3 4.33e-150 443 45 3 510 3 leuA 2-isopropylmalate synthase Shouchella clausii (strain KSM-K16)
B6JB87 5.05e-150 443 44 1 497 3 leuA 2-isopropylmalate synthase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A2C3L7 5.15e-150 444 46 6 515 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain NATL1A)
A4JGE0 6.76e-150 442 48 3 502 3 leuA 2-isopropylmalate synthase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q12B47 8.13e-150 442 47 5 503 3 leuA 2-isopropylmalate synthase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B0T0G9 8.14e-150 442 46 3 512 3 leuA 2-isopropylmalate synthase Caulobacter sp. (strain K31)
Q46K01 8.3e-150 443 46 6 515 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain NATL2A)
A8G5D5 1.04e-149 443 46 5 496 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9215)
B8CX21 1.2e-149 442 45 3 505 3 leuA 2-isopropylmalate synthase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A2BRP4 1.25e-149 443 44 7 543 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain AS9601)
Q0IBI3 1.63e-149 442 47 6 496 3 leuA 2-isopropylmalate synthase Synechococcus sp. (strain CC9311)
Q8RL85 4.01e-149 440 45 1 512 3 leuA 2-isopropylmalate synthase Geobacillus stearothermophilus
C5CYP2 5.67e-149 440 46 2 501 3 leuA 2-isopropylmalate synthase Variovorax paradoxus (strain S110)
A4IRH8 5.99e-149 440 46 1 509 3 leuA 2-isopropylmalate synthase Geobacillus thermodenitrificans (strain NG80-2)
Q31AF9 7.99e-149 441 46 5 496 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9312)
Q7VBG1 4.45e-148 438 46 5 511 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A4YZ76 1.73e-147 436 44 2 499 3 leuA 2-isopropylmalate synthase Bradyrhizobium sp. (strain ORS 278)
A1WNY5 1.85e-147 436 46 3 503 3 leuA 2-isopropylmalate synthase Verminephrobacter eiseniae (strain EF01-2)
A0RQK7 2.13e-147 436 45 4 500 3 leuA 2-isopropylmalate synthase Campylobacter fetus subsp. fetus (strain 82-40)
Q7U892 1.08e-146 435 47 6 515 3 leuA 2-isopropylmalate synthase Parasynechococcus marenigrum (strain WH8102)
A5EP79 2.08e-146 434 44 2 499 3 leuA 2-isopropylmalate synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B8IHS8 3.17e-146 433 44 2 500 3 leuA 2-isopropylmalate synthase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q3AIA2 3.71e-146 434 46 6 512 3 leuA 2-isopropylmalate synthase Synechococcus sp. (strain CC9605)
A3DF94 4.49e-146 432 45 2 490 3 leuA 2-isopropylmalate synthase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q7V121 4.74e-146 434 46 5 496 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q7M9W4 1.14e-145 432 46 8 522 3 leuA 2-isopropylmalate synthase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B8DBU4 1.28e-145 431 45 3 491 3 leuA 2-isopropylmalate synthase Listeria monocytogenes serotype 4a (strain HCC23)
P94565 1.42e-145 431 45 1 493 3 leuA 2-isopropylmalate synthase Bacillus subtilis (strain 168)
A2BX52 2.55e-145 432 45 5 498 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9515)
B8H607 3.71e-145 431 44 3 512 3 leuA 2-isopropylmalate synthase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A823 3.71e-145 431 44 3 512 3 leuA 2-isopropylmalate synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A0AK92 4.06e-145 430 45 3 491 3 leuA 2-isopropylmalate synthase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8EN67 6.83e-145 429 45 2 496 3 leuA 2-isopropylmalate synthase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q3SQ49 8.85e-145 429 45 2 499 3 leuA 2-isopropylmalate synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A9BB43 1.01e-144 430 47 4 494 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9211)
Q71Y35 1.05e-144 429 45 3 491 1 leuA 2-isopropylmalate synthase Listeria monocytogenes serotype 4b (strain F2365)
C1KWT1 1.05e-144 429 45 3 491 3 leuA 2-isopropylmalate synthase Listeria monocytogenes serotype 4b (strain CLIP80459)
B1HR98 1.19e-144 429 44 3 494 3 leuA 2-isopropylmalate synthase Lysinibacillus sphaericus (strain C3-41)
Q92A28 4.13e-144 427 45 3 491 3 leuA 2-isopropylmalate synthase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A6Q4V5 4.91e-144 427 46 4 501 3 leuA 2-isopropylmalate synthase Nitratiruptor sp. (strain SB155-2)
Q8Y5R9 7.26e-144 427 44 3 491 3 leuA 2-isopropylmalate synthase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B9KB95 9.12e-144 427 45 3 494 3 leuA 2-isopropylmalate synthase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q3AYY2 1.23e-142 425 47 8 521 3 leuA 2-isopropylmalate synthase Synechococcus sp. (strain CC9902)
Q65GI8 1.51e-142 424 44 1 493 3 leuA 2-isopropylmalate synthase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B2SNG9 3.52e-142 423 44 3 501 3 leuA 2-isopropylmalate synthase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P761 3.52e-142 423 44 3 501 3 leuA 2-isopropylmalate synthase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P58900 3.55e-142 423 44 3 496 3 leuA 2-isopropylmalate synthase Xanthomonas axonopodis pv. citri (strain 306)
A7Z7B8 4.18e-142 422 44 1 493 3 leuA 2-isopropylmalate synthase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q3BPJ9 4.81e-142 422 44 3 496 3 leuA 2-isopropylmalate synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5H4C6 4.54e-141 420 43 3 501 3 leuA 2-isopropylmalate synthase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
A5IJM2 1.52e-140 418 44 3 494 3 leuA 2-isopropylmalate synthase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
E1QWZ1 2.19e-140 418 44 5 514 3 leuA 2-isopropylmalate synthase Olsenella uli (strain ATCC 49627 / DSM 7084 / CCUG 31166 / CIP 109912 / JCM 12494 / LMG 11480 / NCIMB 702895 / VPI D76D-27C)
P58901 2.51e-140 418 44 3 501 3 leuA 2-isopropylmalate synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RP28 2.51e-140 418 44 3 501 3 leuA 2-isopropylmalate synthase Xanthomonas campestris pv. campestris (strain B100)
Q4UYG1 2.51e-140 418 44 3 501 3 leuA 2-isopropylmalate synthase Xanthomonas campestris pv. campestris (strain 8004)
A2C859 5.78e-140 418 47 5 495 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9303)
B1L8U2 3.63e-139 415 44 3 494 3 leuA 2-isopropylmalate synthase Thermotoga sp. (strain RQ2)
Q9WZ23 3.63e-139 415 44 3 494 3 leuA 2-isopropylmalate synthase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q7TUV5 5.68e-139 415 46 4 494 3 leuA 2-isopropylmalate synthase Prochlorococcus marinus (strain MIT 9313)
Q87CL8 1.18e-138 414 44 4 497 3 leuA 2-isopropylmalate synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I596 1.18e-138 414 44 4 497 3 leuA 2-isopropylmalate synthase Xylella fastidiosa (strain M23)
Q9PCG3 2.31e-138 413 44 4 497 3 leuA 2-isopropylmalate synthase Xylella fastidiosa (strain 9a5c)
D5HB86 3.31e-137 411 42 5 538 3 leuA 2-isopropylmalate synthase Salinibacter ruber (strain M8)
A8ES07 4.46e-136 407 43 6 501 3 leuA 2-isopropylmalate synthase Aliarcobacter butzleri (strain RM4018)
B4SI67 5.55e-136 407 43 6 508 3 leuA 2-isopropylmalate synthase Stenotrophomonas maltophilia (strain R551-3)
E1R5X1 8.24e-136 406 43 5 501 3 leuA 2-isopropylmalate synthase Sediminispirochaeta smaragdinae (strain DSM 11293 / JCM 15392 / SEBR 4228)
A0RBL2 1.2e-135 405 44 5 511 3 leuA 2-isopropylmalate synthase Bacillus thuringiensis (strain Al Hakam)
B7JFY5 2.02e-135 405 44 5 510 3 leuA 2-isopropylmalate synthase Bacillus cereus (strain AH820)
B2FT78 2.27e-135 405 43 5 504 3 leuA 2-isopropylmalate synthase Stenotrophomonas maltophilia (strain K279a)
Q63DX8 2.68e-135 405 44 5 511 3 leuA 2-isopropylmalate synthase Bacillus cereus (strain ZK / E33L)
C1EMA9 2.71e-135 405 44 5 510 3 leuA 2-isopropylmalate synthase Bacillus cereus (strain 03BB102)
Q6HLF3 3.29e-135 404 44 5 510 3 leuA 2-isopropylmalate synthase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B9IUZ0 4.66e-135 404 44 5 511 3 leuA 2-isopropylmalate synthase Bacillus cereus (strain Q1)
Q73BA0 4.66e-135 404 44 5 511 3 leuA 2-isopropylmalate synthase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81T68 5.15e-134 401 43 5 510 3 leuA 2-isopropylmalate synthase Bacillus anthracis
C3L9Q7 5.15e-134 401 43 5 510 3 leuA 2-isopropylmalate synthase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P4Z6 5.15e-134 401 43 5 510 3 leuA 2-isopropylmalate synthase Bacillus anthracis (strain A0248)
A9VLG7 5.21e-134 401 44 5 510 3 leuA 2-isopropylmalate synthase Bacillus mycoides (strain KBAB4)
C4XPA8 8.08e-134 401 42 4 513 3 leuA 2-isopropylmalate synthase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
O04973 1.54e-132 400 44 10 526 2 IPMSA 2-isopropylmalate synthase A Solanum pennellii
A7GMU1 4.81e-132 396 42 3 507 3 leuA 2-isopropylmalate synthase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
P63477 8.6e-132 396 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain N315)
P63476 8.6e-132 396 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IUK3 8.6e-132 396 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain JH9)
A6U3E2 8.6e-132 396 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain JH1)
A7X4N1 8.6e-132 396 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8Z4W0 1.26e-131 395 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain USA300 / TCH1516)
A6QIQ3 1.26e-131 395 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain Newman)
Q5HEE4 1.26e-131 395 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain COL)
Q2FWK3 1.26e-131 395 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF67 1.26e-131 395 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain USA300)
C7M0E4 1.42e-131 395 44 5 508 3 leuA 2-isopropylmalate synthase Acidimicrobium ferrooxidans (strain DSM 10331 / JCM 15462 / NBRC 103882 / ICP)
P58899 1.98e-131 395 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain MW2)
Q6G7Q1 1.98e-131 395 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain MSSA476)
Q6GF16 2.48e-131 395 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain MRSA252)
Q8CNL3 7.73e-131 394 42 2 496 3 leuA 2-isopropylmalate synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMF9 7.73e-131 394 42 2 496 3 leuA 2-isopropylmalate synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2YUF2 1.07e-130 393 42 2 499 3 leuA 2-isopropylmalate synthase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9LPR4 1.34e-130 397 42 9 543 1 IPMS1 2-isopropylmalate synthase 1, chloroplastic Arabidopsis thaliana
Q9C550 4.63e-130 395 43 9 526 1 IPMS2 2-isopropylmalate synthase 2, chloroplastic Arabidopsis thaliana
B9DMJ6 1.55e-129 390 41 2 493 3 leuA 2-isopropylmalate synthase Staphylococcus carnosus (strain TM300)
Q4L7U0 3.45e-129 389 41 2 496 3 leuA 2-isopropylmalate synthase Staphylococcus haemolyticus (strain JCSC1435)
Q8RDK3 6.67e-128 382 49 0 375 3 leuA1 2-isopropylmalate synthase 1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
O04974 6.91e-127 387 41 11 544 2 IPMSB 2-isopropylmalate synthase B Solanum pennellii
Q02YX5 2.21e-126 382 41 5 493 3 leuA 2-isopropylmalate synthase Lactococcus lactis subsp. cremoris (strain SK11)
Q49Z12 2.84e-126 382 41 2 496 3 leuA 2-isopropylmalate synthase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
D3HCJ2 1.89e-123 375 41 3 494 3 leuA 2-isopropylmalate synthase Streptococcus gallolyticus (strain UCN34)
Q02141 2.44e-119 364 41 4 491 3 leuA 2-isopropylmalate synthase Lactococcus lactis subsp. lactis (strain IL1403)
Q58595 1.32e-117 360 41 7 506 1 leuA 2-isopropylmalate synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8TYB1 4.05e-113 347 40 8 508 3 leuA Probable 2-isopropylmalate synthase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
P0DO77 5.38e-112 345 44 4 390 1 MAM1-1 Methylthioalkylmalate synthase 1-1, chloroplastic Eutrema japonicum
Q9FN52 1.44e-111 343 44 4 390 1 MAM3 Methylthioalkylmalate synthase 3, chloroplastic Arabidopsis thaliana
Q9FG67 3.34e-111 343 45 4 390 1 MAM1 Methylthioalkylmalate synthase 1, chloroplastic Arabidopsis thaliana
Q39891 5.78e-111 344 40 8 529 2 GMN56 Probable 2-isopropylmalate synthase Glycine max
O27525 2.73e-108 335 39 8 506 3 leuA Probable 2-isopropylmalate synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8VX04 7.9e-108 334 44 4 390 2 MAM2 Methylthioalkylmalate synthase 2, chloroplastic Arabidopsis thaliana
P0DO78 8.12e-107 332 44 4 390 1 MAM1-2 Methylthioalkylmalate synthase 1-2, chloroplastic Eutrema japonicum
Q58787 1.38e-104 325 39 8 498 1 cimA (R)-citramalate synthase CimA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O30020 2.02e-101 318 36 7 505 3 leuA Probable 2-isopropylmalate synthase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P58968 1.99e-96 305 37 12 512 3 leuA Probable 2-isopropylmalate synthase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
O29305 1.46e-95 302 37 8 500 3 cimA Putative (R)-citramalate synthase CimA Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8THA5 7.03e-95 301 36 11 509 3 leuA Probable 2-isopropylmalate synthase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A8AB61 2.65e-94 296 46 4 346 3 leuA Probable 2-isopropylmalate synthase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
O26819 3.53e-94 298 37 7 502 3 cimA Putative (R)-citramalate synthase CimA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8TJJ1 2.76e-92 293 35 8 498 3 cimA Putative (R)-citramalate synthase CimA Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P58966 1.03e-90 289 35 8 499 3 cimA Putative (R)-citramalate synthase CimA Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q974X3 7.93e-90 284 43 5 365 3 leuA 2-isopropylmalate synthase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q8ZW35 2.18e-89 282 43 5 352 3 leuA Probable 2-isopropylmalate synthase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
B8GEI1 4.05e-89 286 36 5 492 3 cimA Putative (R)-citramalate synthase CimA Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
Q4JA78 8.31e-89 281 42 5 378 1 Saci_0940 2-isopropylmalate synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q8TYM1 1.47e-87 282 36 6 503 3 cimA Putative (R)-citramalate synthase CimA Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
A3CUF2 2.13e-87 281 36 5 496 3 cimA Putative (R)-citramalate synthase CimA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q97W36 1.57e-84 270 41 6 370 3 leuA 2-isopropylmalate synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q56216 1.56e-77 250 44 3 305 2 leuA 2-isopropylmalate synthase (Fragment) Thermus thermophilus
Q8TW28 1.04e-75 248 39 4 379 3 aksA Homocitrate synthase AksA Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q57926 2.01e-71 236 40 6 354 1 aksA Homocitrate synthase AksA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P58967 7.78e-68 227 36 8 397 3 aksA Homocitrate synthase AksA Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
O27667 2.85e-67 225 40 6 356 3 aksA Homocitrate synthase AksA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8TKQ6 3.6e-67 225 35 9 398 3 aksA Homocitrate synthase AksA Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8RCF9 8.32e-64 216 36 4 341 3 leuA2 2-isopropylmalate synthase 2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
O66682 3.91e-58 205 28 14 525 3 cimA (R)-citramalate synthase Aquifex aeolicus (strain VF5)
C3MPM7 1.17e-57 202 32 10 400 3 LS215_1332 Homocitrate synthase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C3NDV7 1.54e-57 201 32 10 400 3 YG5714_1230 Homocitrate synthase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NHU6 1.54e-57 201 32 10 400 3 YN1551_1618 Homocitrate synthase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MYM1 1.54e-57 201 32 10 400 3 M1425_1245 Homocitrate synthase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C4KGW9 1.54e-57 201 32 10 400 3 M164_1229 Homocitrate synthase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3N5A3 1.54e-57 201 32 10 400 3 M1627_1295 Homocitrate synthase Sulfolobus islandicus (strain M.16.27)
Q971S5 5.17e-57 200 33 7 356 1 STK_13010 Homocitrate synthase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
P58637 6.17e-56 195 33 8 388 3 nifV2 Homocitrate synthase 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q44290 2.15e-54 191 35 8 349 3 nifV1 Homocitrate synthase 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9WZ22 5.11e-54 194 28 15 561 3 cimA (R)-citramalate synthase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q97ZE0 3.29e-53 190 33 10 400 3 SSO0977 Homocitrate synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P05342 1.36e-52 186 35 7 350 3 nifV Homocitrate synthase Azotobacter vinelandii
Q4J989 2.19e-52 188 33 7 356 1 Saci_1304 Homocitrate synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q8F8T4 1.84e-51 184 33 7 351 1 leuA2 2-isopropylmalate synthase 2 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
O59390 7.48e-50 178 28 5 347 3 PH1727 Homocitrate synthase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9V1J1 5.03e-49 176 30 7 348 3 PYRAB04360 Homocitrate synthase Pyrococcus abyssi (strain GE5 / Orsay)
P23122 7.68e-45 165 34 11 354 3 nifV Homocitrate synthase Azotobacter chroococcum mcd 1
Q74C76 1.29e-44 168 27 13 519 1 cimA (R)-citramalate synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
P05345 1.86e-42 159 30 7 385 3 nifV Homocitrate synthase Klebsiella pneumoniae
P0DO96 2.56e-42 159 32 12 366 1 cbdbA1708 Citrate (Re)-synthase Dehalococcoides mccartyi (strain CBDB1)
Q9Y823 5.2e-42 159 31 7 377 1 lys4 Homocitrate synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q01181 6.24e-42 157 32 6 378 3 nifV Homocitrate synthase Cereibacter sphaeroides
Q8F3Q1 7.82e-42 160 27 13 518 1 cimA (R)-citramalate synthase CimA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q0ZQ46 8.97e-42 157 30 7 362 1 frbC 2-phosphonomethylmalate synthase Streptomyces rubellomurinus (strain ATCC 31215)
P74269 1.17e-41 160 28 15 536 3 cimA (R)-citramalate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P54610 2.27e-41 156 33 11 365 3 nifV Homocitrate synthase Frankia sp. (strain FaC1)
Q4J6H1 7.73e-41 157 25 13 517 1 cimA (R)-citramalate synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
O87198 3.04e-40 152 29 9 367 1 lys20 Homocitrate synthase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q47884 7.58e-40 151 33 7 349 3 nifV Homocitrate synthase Frankia alni
Q52070 1.37e-39 151 30 6 345 3 nifV Homocitrate synthase Enterobacter agglomerans
Q07179 3.12e-39 150 32 6 356 3 nifV Homocitrate synthase Rhodobacter capsulatus
O86511 2.09e-38 151 26 15 538 3 cimA (R)-citramalate synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q12122 6.63e-38 147 29 7 385 1 LYS21 Homocitrate synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P48570 7.76e-38 147 29 7 386 1 LYS20 Homocitrate synthase, cytosolic isozyme Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O94225 5.58e-35 140 28 5 360 1 lys1 Homocitrate synthase, mitochondrial Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
E3PVH7 7.74e-35 141 25 12 534 3 leuA 2-isopropylmalate synthase Acetoanaerobium sticklandii (strain ATCC 12662 / DSM 519 / JCM 1433 / CCUG 9281 / NCIMB 10654 / HF)
A8FAK7 1.84e-33 137 25 15 522 3 leuA 2-isopropylmalate synthase Bacillus pumilus (strain SAFR-032)
P70728 2.95e-33 133 31 7 322 3 nifV Homocitrate synthase Azospirillum brasilense
Q2RT17 4.7e-33 136 26 13 528 3 leuA 2-isopropylmalate synthase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q12726 1.45e-32 133 28 6 374 3 LYS1 Homocitrate synthase, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
A7HP03 1.74e-32 134 27 18 531 3 leuA 2-isopropylmalate synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A8L551 7.28e-32 132 26 17 538 3 leuA 2-isopropylmalate synthase Parafrankia sp. (strain EAN1pec)
A5CRB9 8.96e-32 132 26 18 543 3 leuA 2-isopropylmalate synthase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
B0RCQ8 1.26e-31 132 26 16 542 3 leuA 2-isopropylmalate synthase Clavibacter sepedonicus
A0LBW3 1.28e-31 132 26 12 519 3 leuA 2-isopropylmalate synthase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q24PE3 1.55e-31 131 24 13 535 3 leuA 2-isopropylmalate synthase Desulfitobacterium hafniense (strain Y51)
Q98HN3 3.99e-31 130 25 17 531 3 leuA 2-isopropylmalate synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q12166 4.49e-31 130 25 16 552 1 LEU9 2-isopropylmalate synthase 2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B2SXZ9 1.19e-30 129 27 19 537 3 leuA 2-isopropylmalate synthase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A6VSA9 1.47e-30 129 24 15 531 3 leuA 2-isopropylmalate synthase Marinomonas sp. (strain MWYL1)
Q31EF5 1.88e-30 128 24 14 517 3 leuA 2-isopropylmalate synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q97MC5 1.96e-30 128 23 14 532 3 leuA 2-isopropylmalate synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B0KRD9 2.22e-30 128 25 14 534 3 leuA 2-isopropylmalate synthase Pseudomonas putida (strain GB-1)
B1JDI2 3.4e-30 127 24 14 534 3 leuA 2-isopropylmalate synthase Pseudomonas putida (strain W619)
A5VZB6 4.06e-30 127 25 14 529 3 leuA 2-isopropylmalate synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9X7L2 4.76e-30 127 24 13 541 3 leuA 2-isopropylmalate synthase Rhizobium meliloti (strain 1021)
Q88P28 5.48e-30 127 25 14 529 3 leuA 2-isopropylmalate synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B2UJY9 6.45e-30 127 26 18 538 3 leuA 2-isopropylmalate synthase Ralstonia pickettii (strain 12J)
Q47RM9 1.07e-29 126 26 17 538 3 leuA 2-isopropylmalate synthase Thermobifida fusca (strain YX)
A9HW07 1.08e-29 126 26 15 532 3 leuA 2-isopropylmalate synthase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A1KBD3 1.65e-29 125 26 16 541 3 leuA 2-isopropylmalate synthase Azoarcus sp. (strain BH72)
A6WDF2 1.78e-29 125 26 15 545 3 leuA 2-isopropylmalate synthase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q00853 1.99e-29 120 35 3 243 3 nifV-ALPHA Homocitrate synthase subunit alpha Clostridium pasteurianum
P06208 2.55e-29 125 24 10 544 1 LEU4 2-isopropylmalate synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q13WM0 3.03e-29 125 26 19 562 3 leuA 2-isopropylmalate synthase Paraburkholderia xenovorans (strain LB400)
B2AHM5 1.34e-28 123 26 15 529 3 leuA 2-isopropylmalate synthase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q8UD63 2.51e-28 122 24 14 530 3 leuA 2-isopropylmalate synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6AED3 3.17e-28 122 25 15 545 3 leuA 2-isopropylmalate synthase Leifsonia xyli subsp. xyli (strain CTCB07)
Q8FZC4 4.02e-28 121 24 15 531 3 leuA 2-isopropylmalate synthase Brucella suis biovar 1 (strain 1330)
Q1MDH6 9.42e-28 120 25 14 530 3 leuA 2-isopropylmalate synthase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1I5K2 1.47e-27 120 24 15 529 3 leuA 2-isopropylmalate synthase Pseudomonas entomophila (strain L48)
Q8XSZ5 1.7e-27 120 25 16 534 3 leuA 2-isopropylmalate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A4VNV6 2.34e-27 119 24 14 529 3 leuA 2-isopropylmalate synthase Stutzerimonas stutzeri (strain A1501)
Q8YIJ3 4.25e-27 118 24 15 531 3 leuA 2-isopropylmalate synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
S3D9F8 4.57e-27 119 28 5 326 1 gloH Isopropyl malate synthase gloH Glarea lozoyensis (strain ATCC 20868 / MF5171)
Q4K6V7 7.66e-27 117 25 14 531 3 leuA 2-isopropylmalate synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3K7C3 7.87e-27 117 24 13 531 3 leuA 2-isopropylmalate synthase Pseudomonas fluorescens (strain Pf0-1)
Q48LY5 1.02e-26 117 24 14 529 3 leuA 2-isopropylmalate synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A4XY24 1.18e-26 117 25 15 529 3 leuA 2-isopropylmalate synthase Pseudomonas mendocina (strain ymp)
D8J0Q1 2.88e-26 116 24 15 539 3 leuA 2-isopropylmalate synthase Herbaspirillum seropedicae (strain SmR1)
Q886Y1 4.22e-26 115 24 14 538 3 leuA 2-isopropylmalate synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZX14 5.31e-26 115 24 14 529 3 leuA 2-isopropylmalate synthase Pseudomonas syringae pv. syringae (strain B728a)
A0PVE6 1.16e-25 114 26 16 540 3 leuA 2-isopropylmalate synthase Mycobacterium ulcerans (strain Agy99)
Q7VH30 2.65e-25 113 23 13 533 3 leuA 2-isopropylmalate synthase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A4QAP0 2.8e-25 113 25 13 535 3 leuA 2-isopropylmalate synthase Corynebacterium glutamicum (strain R)
Q82BV3 3.63e-25 112 24 17 543 3 leuA 2-isopropylmalate synthase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
C3K1K7 5.25e-25 112 24 14 537 3 leuA 2-isopropylmalate synthase Pseudomonas fluorescens (strain SBW25)
O31046 1.4e-24 111 24 16 542 3 leuA 2-isopropylmalate synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O59736 2.96e-24 110 23 12 536 3 leu3 2-isopropylmalate synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P42455 3.12e-24 110 24 13 535 1 leuA 2-isopropylmalate synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
C1DE40 5.9e-24 108 24 15 529 3 leuA 2-isopropylmalate synthase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B2GHT7 6e-24 109 23 13 547 3 leuA 2-isopropylmalate synthase Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
B7GT76 6.27e-24 109 25 18 566 3 leuA 2-isopropylmalate synthase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
D2ATJ4 8.61e-24 108 27 9 373 3 leuA 2-isopropylmalate synthase Streptosporangium roseum (strain ATCC 12428 / DSM 43021 / JCM 3005 / KCTC 9067 / NCIMB 10171 / NRRL 2505 / NI 9100)
A1R6V4 1.6e-23 107 24 14 546 3 leuA 2-isopropylmalate synthase Paenarthrobacter aurescens (strain TC1)
B8H8Q9 1.93e-23 107 24 13 543 3 leuA 2-isopropylmalate synthase Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
C9K7B8 8.59e-23 105 26 7 375 2 AMT7 Isopropyl malate synthase AMT7 Alternaria alternata
A9WML8 1.23e-22 105 26 18 551 3 leuA 2-isopropylmalate synthase Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q8FU05 1.81e-22 104 25 15 538 3 leuA 2-isopropylmalate synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q0VLR3 6.44e-22 102 25 16 527 3 leuA 2-isopropylmalate synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A0JX36 1.78e-21 101 23 13 543 3 leuA 2-isopropylmalate synthase Arthrobacter sp. (strain FB24)
A6W1X1 3.49e-21 98 28 10 296 3 Mmwyl1_3801 4-hydroxy-2-oxovalerate aldolase Marinomonas sp. (strain MWYL1)
C7QJN7 5.27e-21 100 25 19 548 3 leuA 2-isopropylmalate synthase Catenulispora acidiphila (strain DSM 44928 / JCM 14897 / NBRC 102108 / NRRL B-24433 / ID139908)
A6V0X2 1.3e-20 99 24 17 531 3 leuA 2-isopropylmalate synthase Pseudomonas aeruginosa (strain PA7)
Q9HXK5 3.48e-20 97 24 17 531 3 leuA 2-isopropylmalate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9CB76 4.59e-20 97 25 16 533 3 leuA 2-isopropylmalate synthase Mycobacterium leprae (strain TN)
K0E4E5 6.16e-20 97 28 11 374 1 htyA Isopropyl malate synthase htyA Aspergillus rugulosus
A5N6T4 1e-19 95 26 11 359 1 CKL_0973 Citrate (Re)-synthase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
P9WQB3 1.62e-19 95 29 8 314 1 leuA 2-isopropylmalate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQB2 1.62e-19 95 29 8 314 3 leuA 2-isopropylmalate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TVV6 4.11e-19 94 29 8 314 3 leuA 2-isopropylmalate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A8H4E9 8.44e-19 91 28 8 292 3 Spea_2116 4-hydroxy-2-oxovalerate aldolase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TTS9 6.86e-18 88 27 8 292 3 Shal_2088 4-hydroxy-2-oxovalerate aldolase Shewanella halifaxensis (strain HAW-EB4)
P51017 1.26e-17 87 27 8 292 3 nahM 4-hydroxy-2-oxovalerate aldolase Pseudomonas putida
Q9ZI56 8.71e-17 85 26 8 292 3 nahM 4-hydroxy-2-oxovalerate aldolase Stutzerimonas stutzeri
Q5YVA5 1.87e-16 85 24 7 377 3 leuA 2-isopropylmalate synthase Nocardia farcinica (strain IFM 10152)
Q0A5T5 1.9e-16 84 27 10 278 3 Mlg_2462 4-hydroxy-2-oxovalerate aldolase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1TDB7 1.37e-15 81 29 8 257 3 Mvan_4391 4-hydroxy-2-oxovalerate aldolase 2 Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q3IEQ9 5.95e-15 79 27 9 292 3 mhpE 4-hydroxy-2-oxovalerate aldolase Pseudoalteromonas translucida (strain TAC 125)
A2SL35 1.22e-14 79 26 7 272 3 Mpe_A3321 4-hydroxy-2-oxovalerate aldolase 2 Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q3ACM0 1.34e-14 78 26 12 295 3 mhpE 4-hydroxy-2-oxovalerate aldolase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A1W2K3 1.89e-14 78 28 9 295 3 Ajs_0224 4-hydroxy-2-oxovalerate aldolase Acidovorax sp. (strain JS42)
Q2RHL3 2.46e-14 77 27 16 376 3 Moth_1775 4-hydroxy-2-oxovalerate aldolase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A1K6L9 3.78e-14 77 26 9 279 3 lapG 4-hydroxy-2-oxovalerate aldolase 1 Azoarcus sp. (strain BH72)
Q2LTE1 7.99e-14 77 22 8 372 1 SYN_02536 Citrate (Re)-synthase Syntrophus aciditrophicus (strain SB)
Q0PHX9 1.37e-13 75 27 10 287 3 None 4-hydroxy-2-oxovalerate aldolase Spirochaeta aurantia
C1DN55 3.5e-13 74 26 8 272 3 lapG 4-hydroxy-2-oxovalerate aldolase 3 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q764S0 3.9e-13 74 26 11 300 3 nahM 4-hydroxy-2-oxovalerate aldolase Geobacillus genomosp. 3
A5D523 5.56e-13 73 26 11 309 3 PTH_0483 4-hydroxy-2-oxovalerate aldolase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q0RWN1 8.79e-13 73 29 7 255 3 RHA1_ro10112 4-hydroxy-2-oxovalerate aldolase 7 Rhodococcus jostii (strain RHA1)
A8GG86 9.29e-13 73 26 8 291 3 mhpE 4-hydroxy-2-oxovalerate aldolase Serratia proteamaculans (strain 568)
B8G187 1.76e-12 72 25 10 293 3 Dhaf_1245 4-hydroxy-2-oxovalerate aldolase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q99PZ1 4.17e-12 71 27 10 293 3 SCP1.301 4-hydroxy-2-oxovalerate aldolase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B0VXM7 5.5e-12 70 23 10 342 3 pheE 4-hydroxy-2-oxovalerate aldolase Geobacillus stearothermophilus
B1VRH5 7.44e-12 70 26 10 302 3 SGR_564 4-hydroxy-2-oxovalerate aldolase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A3NML2 1.17e-11 69 26 9 264 3 mhpE 4-hydroxy-2-oxovalerate aldolase Burkholderia pseudomallei (strain 668)
A3P825 1.17e-11 69 26 9 264 3 BURPS1106A_A2454 4-hydroxy-2-oxovalerate aldolase Burkholderia pseudomallei (strain 1106a)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_02900
Feature type CDS
Gene leuA
Product 2-isopropylmalate synthase
Location 152700 - 154313 (strand: 1)
Length 1614 (nucleotides) / 537 (amino acids)
In genomic island -

Contig

Accession ZDB_360
Length 302856 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_938
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00682 HMGL-like
PF08502 LeuA allosteric (dimerisation) domain
PF22617 Homocitrate synthase post-HMGL domain-like

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0119 Amino acid transport and metabolism (E) E Isopropylmalate/homocitrate/citramalate synthases

Kegg Ortholog Annotation(s)

Protein Sequence

MSDNVIIFDTTLRDGEQALQASLSVKEKLQIAFQLERMGVDIIEAGFPVSSPGDFQSVQTIAREIKNSRIAALSRCVIGDIDAAAESLKVAEAFRLHMVLATSGIHVKTKLRKTFADIIDMAVGSIKHARRFTDDVEFSCEDAGRTDIDDLCRIVEAAINAGATTVNIPDTVGYTTPYQFGGIISELFNRVPNIDKTIISVHCHDDLGMSVANSITAVQAGARQIEGTINGLGERAGNCALEEVIMAIKVREKMLGVRTGINHKEIYRTSQLVSQLCNTPVPPNKAVVGSNAFSHSSGIHQDGVIKNRETYEIMTPDSIGLKDNLINLTSRSGRAAVKHRMAEMGYQEGDYNLDELYADFLQLADKKGQVFDYDLEALVFMKQQHQEPEHFSLAFLNTQSGTGVKASAMVRMQAGDDIISESAQGNGPVDAAYEAIRRIAGYPLTLAAYQLTAKGQGTDALGQVNIVVEYEGRKFHGMGLATDIVESSAQAMIHAINSIWRAGQVKEEKRRIQSDNNMHNDTHNDTHNNNTETKEAV

Flanking regions ( +/- flanking 50bp)

ATACCTGCAAACCGGAAAACAGAACAAGAAATAACCGAGAGGATCACAACATGAGCGATAACGTCATCATTTTTGATACCACACTGCGTGACGGGGAGCAGGCATTACAGGCCAGTCTCAGTGTCAAAGAGAAGTTACAGATTGCTTTCCAGCTCGAACGCATGGGGGTTGATATTATTGAGGCCGGTTTCCCTGTCTCCTCTCCCGGTGATTTTCAGTCAGTGCAGACTATCGCCCGCGAAATCAAAAACAGCCGTATCGCGGCATTATCCCGCTGTGTGATCGGCGATATTGATGCCGCAGCGGAATCCCTGAAAGTCGCGGAAGCCTTCCGGTTGCATATGGTGCTCGCCACCTCCGGTATTCACGTCAAAACCAAACTGCGCAAGACCTTTGCTGACATCATCGATATGGCGGTCGGCTCGATTAAACATGCCCGCCGCTTTACCGATGACGTCGAGTTTTCCTGCGAAGATGCCGGGCGCACCGATATCGATGATTTATGCCGTATTGTGGAAGCCGCGATCAACGCCGGTGCCACCACGGTCAATATTCCGGACACCGTCGGTTACACCACACCGTACCAGTTCGGCGGCATTATCAGTGAATTGTTCAACCGCGTGCCGAATATCGACAAAACCATCATTTCTGTCCACTGCCATGATGATTTGGGCATGTCTGTTGCCAACTCCATCACCGCCGTACAGGCCGGTGCCCGCCAGATTGAAGGTACGATCAACGGGTTAGGCGAACGCGCCGGGAACTGTGCGCTGGAAGAAGTGATTATGGCGATTAAAGTGCGGGAAAAAATGCTGGGCGTGCGCACCGGGATCAATCACAAAGAGATTTACCGCACCAGCCAGCTGGTCAGCCAGTTATGCAACACCCCGGTACCGCCGAACAAGGCCGTGGTCGGCAGCAATGCCTTCTCCCACTCCTCCGGTATTCACCAGGACGGCGTGATTAAAAACCGCGAAACCTACGAAATCATGACGCCGGACAGCATCGGCCTGAAAGATAACTTAATCAACCTGACCTCCCGTTCCGGCCGCGCGGCGGTGAAACACCGGATGGCGGAAATGGGTTATCAGGAAGGTGACTATAACCTGGATGAATTATACGCCGACTTCCTGCAACTGGCGGACAAGAAAGGTCAGGTTTTCGATTACGACCTGGAAGCGCTGGTGTTTATGAAGCAGCAGCACCAGGAGCCGGAACATTTCTCGCTGGCGTTCCTCAACACCCAGTCAGGTACCGGCGTCAAAGCCTCCGCGATGGTCAGAATGCAGGCCGGGGATGACATTATCTCGGAATCCGCCCAGGGGAACGGCCCGGTTGATGCGGCTTATGAAGCTATCCGCCGTATCGCGGGTTACCCGCTGACCCTCGCCGCCTATCAGCTGACTGCCAAAGGTCAGGGAACGGATGCACTGGGTCAGGTGAATATCGTGGTGGAGTATGAAGGCCGTAAATTCCACGGTATGGGGCTGGCGACCGATATTGTTGAATCCTCCGCCCAGGCCATGATCCACGCCATCAACAGCATCTGGCGCGCCGGACAGGTAAAAGAAGAAAAACGGCGTATACAGTCAGATAACAACATGCACAACGATACTCATAACGATACTCATAACAACAATACAGAGACAAAGGAAGCGGTGTAATTATGTCGGAACAATTTCATATTGCAGTTTTACCGGGCGACGGAATCGGC