Homologs in group_9

Help

20 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05295 FBDBKF_05295 77.8 Morganella morganii S1 oppA oligopeptide ABC transporter substrate-binding protein OppA
FBDBKF_05300 FBDBKF_05300 58.1 Morganella morganii S1 oppA ABC-type oligopeptide transport system, periplasmic component
FBDBKF_05570 FBDBKF_05570 46.9 Morganella morganii S1 oppA ABC-type oligopeptide transport system, periplasmic component
EHELCC_12020 EHELCC_12020 46.9 Morganella morganii S2 oppA ABC-type oligopeptide transport system, periplasmic component
EHELCC_12290 EHELCC_12290 58.1 Morganella morganii S2 oppA ABC-type oligopeptide transport system, periplasmic component
EHELCC_12295 EHELCC_12295 77.8 Morganella morganii S2 oppA oligopeptide ABC transporter substrate-binding protein OppA
NLDBIP_12360 NLDBIP_12360 46.9 Morganella morganii S4 oppA ABC-type oligopeptide transport system, periplasmic component
NLDBIP_12630 NLDBIP_12630 58.1 Morganella morganii S4 oppA ABC-type oligopeptide transport system, periplasmic component
NLDBIP_12635 NLDBIP_12635 77.8 Morganella morganii S4 oppA oligopeptide ABC transporter substrate-binding protein OppA
LHKJJB_12220 LHKJJB_12220 46.9 Morganella morganii S3 oppA ABC-type oligopeptide transport system, periplasmic component
LHKJJB_12490 LHKJJB_12490 58.1 Morganella morganii S3 oppA ABC-type oligopeptide transport system, periplasmic component
LHKJJB_12495 LHKJJB_12495 77.8 Morganella morganii S3 oppA oligopeptide ABC transporter substrate-binding protein OppA
HKOGLL_10835 HKOGLL_10835 46.9 Morganella morganii S5 oppA ABC-type oligopeptide transport system, periplasmic component
HKOGLL_11105 HKOGLL_11105 58.1 Morganella morganii S5 oppA ABC-type oligopeptide transport system, periplasmic component
HKOGLL_11110 HKOGLL_11110 77.8 Morganella morganii S5 oppA oligopeptide ABC transporter substrate-binding protein OppA
F4V73_RS03735 F4V73_RS03735 47.1 Morganella psychrotolerans - peptide ABC transporter substrate-binding protein
F4V73_RS05750 F4V73_RS05750 77.6 Morganella psychrotolerans oppA oligopeptide ABC transporter substrate-binding protein OppA
F4V73_RS05755 F4V73_RS05755 57.0 Morganella psychrotolerans - ABC transporter substrate-binding protein
PMI_RS06600 PMI_RS06600 45.1 Proteus mirabilis HI4320 - peptide ABC transporter substrate-binding protein
PMI_RS07145 PMI_RS07145 56.6 Proteus mirabilis HI4320 - ABC transporter substrate-binding protein

Distribution of the homologs in the orthogroup group_9

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_9

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P06202 0.0 801 71 2 543 1 oppA Periplasmic oligopeptide-binding protein OppA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23843 0.0 784 68 3 544 1 oppA Periplasmic oligopeptide-binding protein OppA Escherichia coli (strain K12)
P71370 0.0 580 53 3 539 3 oppA Periplasmic oligopeptide-binding protein OppA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P77348 2.63e-165 483 47 3 517 1 mppA Periplasmic murein peptide-binding protein MppA Escherichia coli (strain K12)
Q46863 2.31e-146 434 43 4 519 1 ygiS Probable deoxycholate-binding periplasmic protein YgiS Escherichia coli (strain K12)
P24141 4.02e-91 292 34 9 507 1 oppA Oligopeptide-binding protein OppA Bacillus subtilis (strain 168)
P26906 2.85e-73 246 31 14 541 1 dppE Dipeptide-binding protein DppE Bacillus subtilis (strain 168)
P44572 4.86e-65 223 28 9 491 3 HI_0213 Putative binding protein HI_0213 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A2RI74 1.67e-46 174 28 19 551 1 dppA Dipeptide-binding protein Lactococcus lactis subsp. cremoris (strain MG1363)
A0A0H2ZGV7 7.33e-34 138 26 17 516 1 dppA4 Di/tripeptide-binding protein 4 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q32IB6 1.92e-31 130 25 20 544 3 gsiB Glutathione-binding protein GsiB Shigella dysenteriae serotype 1 (strain Sd197)
Q1RE95 2.09e-31 130 25 20 544 3 gsiB Glutathione-binding protein GsiB Escherichia coli (strain UTI89 / UPEC)
Q8CW88 2.09e-31 130 25 20 544 3 gsiB Glutathione-binding protein GsiB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1A968 2.09e-31 130 25 20 544 3 gsiB Glutathione-binding protein GsiB Escherichia coli O1:K1 / APEC
Q8X6V9 7.34e-31 129 25 20 544 3 gsiB Glutathione-binding protein GsiB Escherichia coli O157:H7
Q3Z3V3 8.39e-31 129 25 20 544 3 gsiB Glutathione-binding protein GsiB Shigella sonnei (strain Ss046)
P75797 8.63e-31 129 25 20 545 1 gsiB Glutathione-binding protein GsiB Escherichia coli (strain K12)
Q821B3 9.31e-31 129 25 18 526 3 gsiB Glutathione-binding protein GsiB Shigella flexneri
Q323W4 2.43e-30 127 25 20 544 3 gsiB Glutathione-binding protein GsiB Shigella boydii serotype 4 (strain Sb227)
Q0TJL8 3.72e-30 127 25 20 544 3 gsiB Glutathione-binding protein GsiB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0T6D2 6.27e-30 126 25 18 526 3 gsiB Glutathione-binding protein GsiB Shigella flexneri serotype 5b (strain 8401)
P33950 2.27e-29 125 25 14 467 1 hbpA Heme-binding protein A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P76128 9.12e-29 123 25 15 491 2 ddpA Probable D,D-dipeptide-binding periplasmic protein DdpA Escherichia coli (strain K12)
Q8Z863 2.82e-27 119 23 15 502 3 gsiB Glutathione-binding protein GsiB Salmonella typhi
Q9HVS4 3.09e-27 119 23 15 511 1 PA4497 Tripeptide-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8ZQM3 3.66e-27 118 23 15 502 3 gsiB Glutathione-binding protein GsiB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H2ZGW2 3.97e-27 118 23 15 500 1 dppA2 Di/tripeptide-binding protein 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q57RB1 4.58e-27 118 23 15 502 3 gsiB Glutathione-binding protein GsiB Salmonella choleraesuis (strain SC-B67)
Q5PGP4 7.72e-27 117 23 15 502 3 gsiB Glutathione-binding protein GsiB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9HVS1 1.42e-24 110 21 14 515 1 PA4500 Dipeptide-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZGN2 7.38e-24 108 21 14 501 1 dppA3 Di/tripeptide-binding protein 3 Pseudomonas aeruginosa (strain UCBPP-PA14)
P33590 9.91e-24 108 24 16 501 1 nikA Nickel-binding periplasmic protein Escherichia coli (strain K12)
P23847 1.71e-23 107 23 16 485 1 dppA Dipeptide-binding protein Escherichia coli (strain K12)
A0A0H2ZGV2 1.77e-22 104 22 18 528 1 dppA1 Di/tripeptide-binding protein 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
P36634 1.75e-21 101 24 20 544 2 sapA Peptide transport periplasmic protein SapA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6D3B0 2.12e-21 101 23 15 541 3 gsiB Glutathione-binding protein GsiB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P31306 7.83e-21 100 27 6 265 1 sarA Oligopeptide-binding protein SarA Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
P0A4G1 2.07e-19 95 30 7 230 1 aliB Oligopeptide-binding protein AliB Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4G0 2.07e-19 95 30 7 230 3 aliB Oligopeptide-binding protein AliB Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q47622 3.58e-19 94 24 21 552 3 sapA Probable ABC transporter periplasmic-binding protein SapA Escherichia coli (strain K12)
A0A0H2ZI72 6.96e-19 93 21 13 463 1 dppA5 Probable di/tripeptide-binding protein 5 Pseudomonas aeruginosa (strain UCBPP-PA14)
P06109 6.16e-17 87 24 21 487 3 xp55 Protein XP55 Streptomyces lividans
P35592 2.1e-16 86 32 6 178 3 aliA Oligopeptide-binding protein AliA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P18791 1.75e-14 80 26 5 213 1 amiA Oligopeptide-binding protein AmiA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9CEK0 2.52e-11 70 24 23 479 3 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. lactis (strain IL1403)
Q2YJK2 4.2e-11 68 20 15 458 3 BAB2_1049 Putative peptide-binding periplasmic protein BAB2_1049 Brucella abortus (strain 2308)
Q8VQK3 4.2e-11 68 20 15 458 3 BruAb2_1030 Putative peptide-binding periplasmic protein BruAb2_1030 Brucella abortus biovar 1 (strain 9-941)
P55691 5.79e-11 68 20 18 484 3 NGR_a00920 Uncharacterized protein y4wM Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8FUX2 8.25e-11 68 20 19 545 3 BRA1090 Putative peptide-binding periplasmic protein BRA1090/BS1330_II1082 Brucella suis biovar 1 (strain 1330)
Q8YDG6 9.41e-11 67 20 19 545 3 BMEII0210 Putative peptide-binding periplasmic protein BMEII0210 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P42061 1.03e-09 64 24 13 355 1 appA Oligopeptide-binding protein AppA Bacillus subtilis (strain 168)
Q02VA9 2.07e-09 63 22 21 487 3 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. cremoris (strain SK11)
Q07741 6.87e-09 62 22 20 490 1 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. lactis
Q2FVE7 5.51e-08 59 21 20 546 1 cntA Metal-staphylopine-binding protein CntA Staphylococcus aureus (strain NCTC 8325 / PS 47)
A9CIN5 1.29e-07 58 26 11 250 3 yepA Peptidoglycan-binding protein YepA Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9X4Y1 2.22e-07 57 23 10 294 2 agpA Periplasmic alpha-galactoside-binding protein Rhizobium meliloti (strain 1021)
P45285 4.27e-07 56 21 12 367 3 sapA Peptide transport periplasmic protein SapA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H3JTL0 7.49e-07 55 20 20 546 1 cntA Metal-staphylopine-binding protein CntA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YKJ5 8.35e-06 52 23 9 239 3 BAB2_0664 Putative binding protein BAB2_0664 Brucella abortus (strain 2308)
Q577X5 8.35e-06 52 23 9 239 3 BruAb2_0648 Putative binding protein BruAb2_0648 Brucella abortus biovar 1 (strain 9-941)
Q8YC41 9.18e-06 52 23 9 239 3 BMEII0691 Putative binding protein BMEII0691 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FW84 9.19e-06 52 23 9 239 3 BRA0576 Putative binding protein BRA0576/BS1330_II0571 Brucella suis biovar 1 (strain 1330)
Q8YBP0 3.77e-05 50 23 11 317 3 BMEII0859 Putative ABC transporter peptide-binding protein BMEII0859 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FWN7 4.15e-05 50 23 11 317 3 BRA0409 Putative ABC transporter peptide-binding protein BRA0409/BS1330_II0406 Brucella suis biovar 1 (strain 1330)
Q2YK66 4.15e-05 50 23 11 317 3 BAB2_0812 Putative ABC transporter peptide-binding protein BAB2_0812 Brucella abortus (strain 2308)
Q577J8 4.15e-05 50 23 11 317 3 BruAb2_0792 Putative ABC transporter peptide-binding protein BruAb2_0792 Brucella abortus biovar 1 (strain 9-941)
A5VU91 4.15e-05 50 23 11 317 3 BOV_A0352 Putative ABC transporter peptide-binding protein BOV_A0352 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q9RU24 8.34e-05 49 20 16 388 1 DR_1571 Probable ABC transporter-binding protein DR_1571 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q2G2P5 0.000149 48 24 11 350 1 nikA Nickel-binding protein NikA Staphylococcus aureus (strain NCTC 8325 / PS 47)
P9WL77 0.000822 45 19 15 474 1 Rv2585c Uncharacterized lipoprotein Rv2585c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07140
Feature type CDS
Gene oppA
Product oligopeptide ABC transporter substrate-binding protein OppA
Location 1558636 - 1560273 (strand: -1)
Length 1638 (nucleotides) / 545 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_9
Orthogroup size 21
N. genomes 7

Actions

Genomic region

Domains

PF00496 Bacterial extracellular solute-binding proteins, family 5 Middle

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4166 Amino acid transport and metabolism (E) E ABC-type oligopeptide transport system, periplasmic component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15580 oligopeptide transport system substrate-binding protein beta-Lactam resistance
ABC transporters
Quorum sensing
-

Protein Sequence

MINVTKKSALAIAIGTIFGFTALNATAAVVPDGVKLADKQELVRNNGSEPQSLDPHKIEGVPESALARDLFEGITIVGPDGEILPGSATSWENKDFTVWTFKIREDAKWSNGDPVTAQDFVYSWQRLADPNTASPYESYLQYAHIVNIDDIIAGKKKPTELGVKALDNNTLEITLSEAVPYLPKLLAHSSMSPVNQKVIEKFGEKWTQPANFVGNGAYVLKNWTVNERIELERSPTYWDNKNTVINKVTFLPISSEVTDVNRYRAGEIDMTYSNLPIEFFQKLKKEIPDELRISPYLCTYYYEINNEKAPFDDPRVREALKLSMDRDIITYKVKNQGDIPAYGFTPPFTDGIKESKPEWFASWTQEQRNEKARQLLEEAGYNKANPLKFKLLYNTSDLHKKVAIAASSIWKKNLGAEVSLENQEWKTFLDTRHQGNYDVARAGWCADYNEPSSFLNMMLSYSSNNTVHYKNKQFDAYMKESLRVKSDDERAEIYQKAEGVLDKDSAIVPLYYYVNTRLVKPYVGGYSGKDPLDNLHTKDLYIIAK

Flanking regions ( +/- flanking 50bp)

ACAGGAAGGCCGAACAATGGCCGACTCACTAACTGGGAGTATTTGATAAGATGATAAATGTAACTAAAAAAAGTGCGCTAGCGATCGCCATTGGTACTATCTTTGGTTTTACGGCGCTCAATGCTACTGCGGCTGTTGTGCCTGATGGGGTAAAACTGGCTGATAAACAAGAGTTAGTGCGTAATAATGGCTCTGAGCCACAATCACTTGATCCTCATAAAATTGAGGGTGTACCTGAATCTGCATTGGCACGAGATCTATTTGAAGGGATCACGATTGTAGGGCCTGATGGTGAAATTCTACCGGGCTCTGCGACTAGCTGGGAAAATAAAGATTTTACTGTTTGGACGTTCAAAATTCGTGAAGACGCGAAATGGTCAAACGGTGACCCTGTAACAGCGCAAGACTTTGTTTATAGCTGGCAACGTTTAGCAGATCCGAATACAGCATCACCTTATGAAAGTTATCTACAATATGCCCATATTGTTAATATTGACGATATTATCGCCGGTAAGAAAAAACCGACGGAACTAGGTGTTAAAGCGCTTGATAATAATACCTTAGAAATCACATTATCAGAGGCCGTACCTTATTTACCTAAATTGCTAGCTCACTCCTCGATGTCGCCAGTGAATCAAAAAGTGATTGAAAAATTTGGTGAAAAGTGGACGCAACCTGCGAACTTTGTCGGCAATGGTGCTTATGTACTGAAAAATTGGACGGTAAACGAACGTATTGAATTAGAGCGTAGTCCAACCTATTGGGACAATAAAAATACGGTTATCAATAAAGTCACTTTTTTACCTATCTCATCAGAAGTCACCGATGTAAACCGCTATCGTGCGGGTGAAATCGATATGACTTATAGCAATCTGCCGATTGAATTTTTCCAAAAATTGAAAAAAGAGATCCCAGATGAATTACGTATCAGTCCATACTTATGTACTTATTATTATGAAATTAATAATGAGAAAGCTCCCTTTGACGATCCACGAGTACGTGAAGCACTAAAACTATCTATGGATAGAGATATCATCACCTATAAAGTGAAAAACCAAGGTGATATCCCTGCTTACGGATTTACACCGCCTTTCACCGATGGCATTAAAGAGAGTAAACCAGAGTGGTTCGCTTCTTGGACCCAAGAGCAACGTAATGAAAAGGCGCGCCAATTATTAGAAGAGGCGGGTTATAACAAAGCCAATCCATTAAAATTCAAGTTACTGTATAACACCTCTGATCTACATAAAAAAGTCGCGATTGCGGCCTCTTCTATTTGGAAGAAAAACTTAGGTGCTGAGGTTTCTCTTGAAAACCAAGAGTGGAAAACGTTCTTAGATACACGTCACCAAGGTAATTATGATGTTGCACGTGCAGGATGGTGTGCAGATTATAACGAACCTTCTTCATTCCTTAACATGATGCTGTCTTACAGCAGTAATAATACCGTTCACTATAAAAACAAACAATTTGATGCGTATATGAAAGAATCTTTACGCGTGAAATCGGATGATGAACGTGCAGAAATTTATCAAAAAGCAGAAGGTGTATTAGATAAAGATTCTGCCATTGTTCCACTTTACTACTACGTAAACACCCGTTTGGTTAAACCTTATGTCGGTGGTTATTCTGGTAAAGATCCACTGGATAATTTACATACTAAAGACTTGTATATTATTGCTAAATAATCGGGCGAGACCTTGCTTAAGTTAAGCGAGGTCTTTTTATCACCACGCCT