Homologs in group_87

Help

11 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06695 FBDBKF_06695 62.0 Morganella morganii S1 - tRNA-dihydrouridine synthase C
FBDBKF_09520 FBDBKF_09520 70.6 Morganella morganii S1 dusC tRNA dihydrouridine(16) synthase DusC
EHELCC_04275 EHELCC_04275 62.0 Morganella morganii S2 - tRNA-dihydrouridine synthase C
EHELCC_04320 EHELCC_04320 70.6 Morganella morganii S2 dusC tRNA dihydrouridine(16) synthase DusC
NLDBIP_04275 NLDBIP_04275 62.0 Morganella morganii S4 - tRNA-dihydrouridine synthase C
NLDBIP_04320 NLDBIP_04320 70.6 Morganella morganii S4 dusC tRNA dihydrouridine(16) synthase DusC
LHKJJB_10105 LHKJJB_10105 62.0 Morganella morganii S3 - tRNA-dihydrouridine synthase C
LHKJJB_14310 LHKJJB_14310 70.6 Morganella morganii S3 dusC tRNA dihydrouridine(16) synthase DusC
HKOGLL_08870 HKOGLL_08870 62.0 Morganella morganii S5 - tRNA-dihydrouridine synthase C
HKOGLL_12225 HKOGLL_12225 70.6 Morganella morganii S5 dusC tRNA dihydrouridine(16) synthase DusC
F4V73_RS00835 F4V73_RS00835 66.8 Morganella psychrotolerans dusC tRNA dihydrouridine(16) synthase DusC

Distribution of the homologs in the orthogroup group_87

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_87

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZGV2 2.06e-169 475 71 0 308 3 dusC tRNA-dihydrouridine(16) synthase Yersinia pestis
Q8FFV5 7.54e-166 466 71 0 310 3 dusC tRNA-dihydrouridine(16) synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P33371 2.06e-165 465 70 0 310 1 dusC tRNA-dihydrouridine(16) synthase Escherichia coli (strain K12)
Q7UC91 4.68e-165 464 70 0 310 3 dusC tRNA-dihydrouridine(16) synthase Shigella flexneri
Q8XEC6 1.53e-164 463 70 0 310 3 dusC tRNA-dihydrouridine(16) synthase Escherichia coli O157:H7
Q8ZNM4 3.12e-160 452 69 0 310 3 dusC tRNA-dihydrouridine(16) synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z5B2 5.1e-160 451 68 0 310 3 dusC tRNA-dihydrouridine(16) synthase Salmonella typhi
Q9CJW1 7.55e-153 433 69 0 296 3 dusC tRNA-dihydrouridine(16) synthase Pasteurella multocida (strain Pm70)
P44606 1.02e-150 427 65 0 303 3 dusC tRNA-dihydrouridine(16) synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7VKU5 8.5e-138 395 61 0 307 3 dusC tRNA-dihydrouridine(16) synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9KT00 2.49e-126 366 56 0 297 3 dusC tRNA-dihydrouridine(16) synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8DAH1 2.23e-124 361 54 1 310 3 dusC tRNA-dihydrouridine(16) synthase Vibrio vulnificus (strain CMCP6)
Q87N01 1.01e-122 357 52 0 308 3 dusC tRNA-dihydrouridine(16) synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8EFG7 3.88e-118 345 53 1 308 3 dusC tRNA-dihydrouridine(16) synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9HZ95 1.53e-85 262 41 2 313 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8XYX1 2.24e-84 259 41 2 311 3 dusC tRNA-dihydrouridine(16) synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9AMN9 3.74e-83 256 40 2 312 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas alcaligenes
Q88LF2 4.16e-81 251 40 2 312 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
O68273 1.8e-79 247 39 2 313 3 dusC tRNA-dihydrouridine(16) synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9JZL5 9.53e-79 246 39 4 313 3 dusC tRNA-dihydrouridine(16) synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JUP6 1.63e-77 242 39 4 316 3 dusC tRNA-dihydrouridine(16) synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q884C6 7.35e-77 240 41 2 300 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q55724 3.27e-41 149 32 9 310 3 dus1 Probable tRNA-dihydrouridine synthase 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P96192 9.65e-36 134 38 5 242 3 dusC tRNA-dihydrouridine(16) synthase Azotobacter vinelandii
P41504 2.78e-34 130 34 5 242 3 dus Probable tRNA-dihydrouridine synthase Rhizobium leguminosarum bv. phaseoli
Q9CLW3 4.77e-34 130 34 7 243 3 dusB tRNA-dihydrouridine synthase B Pasteurella multocida (strain Pm70)
Q7VNP2 1.01e-32 126 32 6 242 3 dusB tRNA-dihydrouridine synthase B Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q87KU1 2e-32 125 29 7 307 3 dusB tRNA-dihydrouridine synthase B Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P44965 5.62e-32 124 33 7 255 3 dusB tRNA-dihydrouridine synthase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HUW1 2.94e-31 122 35 6 234 3 dusB tRNA-dihydrouridine synthase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8PCH1 1.2e-29 118 34 6 231 3 dusB tRNA-dihydrouridine synthase B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PP72 2.64e-29 117 33 6 231 3 dusB tRNA-dihydrouridine synthase B Xanthomonas axonopodis pv. citri (strain 306)
O52533 6.02e-29 116 30 6 254 3 dusB tRNA-dihydrouridine synthase B Proteus vulgaris
Q8ZAX7 7.67e-29 115 36 4 199 3 dusB tRNA-dihydrouridine synthase B Yersinia pestis
O52536 1.04e-28 115 30 9 316 3 dusB tRNA-dihydrouridine synthase B Klebsiella pneumoniae
Q4UNJ4 2.38e-28 114 32 8 250 3 dus Probable tRNA-dihydrouridine synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q92JQ6 5.79e-28 113 32 6 255 3 dus Probable tRNA-dihydrouridine synthase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8CWL2 8.42e-28 113 30 7 297 3 dusB tRNA-dihydrouridine synthase B Vibrio vulnificus (strain CMCP6)
P0ABT5 1.25e-27 112 31 7 264 1 dusB tRNA-dihydrouridine synthase B Escherichia coli (strain K12)
P0ABT6 1.25e-27 112 31 7 264 3 dusB tRNA-dihydrouridine synthase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ABT7 1.25e-27 112 31 7 264 3 dusB tRNA-dihydrouridine synthase B Escherichia coli O157:H7
Q9ZED2 2.52e-27 112 32 5 230 3 dus Probable tRNA-dihydrouridine synthase Rickettsia prowazekii (strain Madrid E)
Q83PZ5 3.67e-27 111 31 7 264 3 dusB tRNA-dihydrouridine synthase B Shigella flexneri
P37567 3.83e-27 111 33 8 238 3 dus1 Probable tRNA-dihydrouridine synthase 1 Bacillus subtilis (strain 168)
Q9KV66 5.03e-27 110 28 7 314 3 dusB tRNA-dihydrouridine synthase B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O25427 6.18e-27 110 38 2 155 3 dus Probable tRNA-dihydrouridine synthase Helicobacter pylori (strain ATCC 700392 / 26695)
Q09504 7.51e-27 109 36 4 168 3 C45G9.2 Uncharacterized tRNA-dihydrouridine synthase-like protein C45G9.2 Caenorhabditis elegans
P0A2R6 8.33e-27 110 31 7 264 3 dusB tRNA-dihydrouridine synthase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2R7 8.33e-27 110 31 7 264 3 dusB tRNA-dihydrouridine synthase B Salmonella typhi
Q68XZ3 1.57e-26 109 32 6 231 3 dus Probable tRNA-dihydrouridine synthase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1RH84 2.47e-26 109 31 9 282 3 dus Probable tRNA-dihydrouridine synthase Rickettsia bellii (strain RML369-C)
Q9ZLB6 3.58e-26 108 38 3 152 3 dus Probable tRNA-dihydrouridine synthase Helicobacter pylori (strain J99 / ATCC 700824)
Q88DK5 4.6e-26 108 33 6 231 3 dusB tRNA-dihydrouridine synthase B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
O52539 3.14e-25 106 30 8 267 3 dusB tRNA-dihydrouridine synthase B Pectobacterium carotovorum
O95620 4.01e-24 103 30 7 239 1 DUS4L tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+]-like Homo sapiens
P45672 2.05e-23 101 31 6 233 3 dus Probable tRNA-dihydrouridine synthase Azospirillum brasilense
Q32M08 2.92e-23 100 29 7 239 2 Dus4l tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+]-like Mus musculus
Q8EJR8 3.33e-23 100 32 7 233 3 dusB tRNA-dihydrouridine synthase B Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q87VS1 3.79e-23 100 32 6 231 3 dusB tRNA-dihydrouridine synthase B Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5HKD5 2.49e-22 98 31 9 238 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8NYV4 4.11e-22 97 30 9 238 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain MW2)
Q6GD38 4.11e-22 97 30 9 238 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain MSSA476)
Q5HJT5 4.11e-22 97 30 9 238 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain COL)
Q6GKK9 4.46e-22 97 30 9 238 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain MRSA252)
Q08111 5.31e-22 97 35 6 230 3 dus Probable tRNA-dihydrouridine synthase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O52532 6.74e-22 97 28 9 315 3 dusB tRNA-dihydrouridine synthase B Serratia marcescens
P67717 6.86e-22 97 29 9 238 1 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain N315)
P67716 6.86e-22 97 29 9 238 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8CU07 1.27e-21 96 31 9 238 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O74553 2.56e-21 95 28 6 239 1 dus4 tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+] Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O83945 7.23e-21 94 31 7 241 3 dus Probable tRNA-dihydrouridine synthase Treponema pallidum (strain Nichols)
O67533 2.18e-20 92 26 10 275 3 dus Probable tRNA-dihydrouridine synthase Aquifex aeolicus (strain VF5)
P9WNS7 6.06e-20 92 25 8 319 1 dus Probable tRNA-dihydrouridine synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNS6 6.06e-20 92 25 8 319 3 dus Probable tRNA-dihydrouridine synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O31546 7.97e-19 88 29 6 235 3 dus2 Probable tRNA-dihydrouridine synthase 2 Bacillus subtilis (strain 168)
Q50049 4.68e-18 87 31 6 177 3 dus Probable tRNA-dihydrouridine synthase Mycobacterium leprae (strain TN)
Q9KUX9 3.51e-17 84 32 8 225 3 dusA tRNA-dihydrouridine(20/20a) synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P53759 7.46e-17 84 27 5 199 1 DUS1 tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q96G46 2.51e-16 82 31 12 237 1 DUS3L tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Homo sapiens
Q8C2P3 3.28e-16 82 27 8 247 2 Dus1l tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like Mus musculus
Q54CU9 6.4e-16 81 29 4 156 3 dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Dictyostelium discoideum
Q8K582 6.63e-16 81 27 8 247 2 Dus1l tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like Rattus norvegicus
Q5ALL3 8.77e-16 81 28 4 159 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Candida albicans (strain SC5314 / ATCC MYA-2876)
Q7ZWS1 1.97e-15 80 29 12 237 2 dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Xenopus laevis
Q6P1R4 2.11e-15 79 27 8 235 1 DUS1L tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like Homo sapiens
Q8CWK7 2.3e-15 78 32 5 181 3 dusA tRNA-dihydrouridine(20/20a) synthase Vibrio vulnificus (strain CMCP6)
Q28BT8 1.13e-14 77 29 12 237 2 dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Xenopus tropicalis
Q87L85 1.16e-14 76 31 5 179 3 dusA tRNA-dihydrouridine(20/20a) synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q91XI1 1.56e-14 77 30 12 228 1 Dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Mus musculus
Q4P1U2 1.88e-14 77 30 7 213 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Ustilago maydis (strain 521 / FGSC 9021)
Q3KRC5 2.65e-14 76 30 12 228 2 Dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Rattus norvegicus
P72872 4.42e-14 75 28 7 241 3 dus2 tRNA-dihydrouridine(20/20a) synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A5DBS1 7.73e-14 75 28 5 159 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
A8NZY7 1.06e-13 75 27 9 219 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
A5DTS1 1.36e-13 74 28 5 160 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q8P3X4 4.23e-13 72 29 5 201 3 dusA tRNA-dihydrouridine(20/20a) synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8ZJ14 5.94e-13 72 30 6 181 3 dusA tRNA-dihydrouridine(20/20a) synthase Yersinia pestis
Q6BS64 6.99e-13 72 26 4 159 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q9D7B1 7.04e-13 72 26 9 245 1 Dus2 tRNA-dihydrouridine(20) synthase [NAD(P)+]-like Mus musculus
Q88KX0 8.66e-13 71 27 6 222 3 dusA tRNA-dihydrouridine(20/20a) synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8EAJ0 9.72e-13 71 28 7 222 3 dusA tRNA-dihydrouridine(20/20a) synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A3LUK5 1.36e-12 71 27 4 159 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q9UTH9 1.64e-12 71 30 5 160 1 dus3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9I048 1.79e-12 70 26 7 226 3 dusA tRNA-dihydrouridine(20/20a) synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A8PTG4 2.13e-12 71 26 7 218 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Malassezia globosa (strain ATCC MYA-4612 / CBS 7966)
Q1E2F4 4.23e-12 70 29 8 179 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Coccidioides immitis (strain RS)
Q9NX74 5.08e-12 69 26 9 281 1 DUS2 tRNA-dihydrouridine(20) synthase [NAD(P)+]-like Homo sapiens
Q884G7 7.39e-12 68 27 7 206 3 dusA tRNA-dihydrouridine(20/20a) synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8PFF8 2.92e-11 67 28 6 245 3 dusA tRNA-dihydrouridine(20/20a) synthase Xanthomonas axonopodis pv. citri (strain 306)
Q9CL29 3.51e-11 66 27 5 184 3 dusA tRNA-dihydrouridine(20/20a) synthase Pasteurella multocida (strain Pm70)
O74731 4.37e-11 67 24 11 281 1 dus2 tRNA-dihydrouridine(20) synthase [NAD(P)+] Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7XT07 7.02e-11 66 28 12 241 2 Os04g0117600 tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Oryza sativa subsp. japonica
P0CN28 1.13e-10 65 26 10 242 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CN29 1.14e-10 65 26 10 242 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
A6QYC6 1.5e-10 65 23 10 261 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Ajellomyces capsulatus (strain NAm1 / WU24)
Q5SMC7 1.67e-10 64 31 6 180 1 dus tRNA-dihydrouridine(20/20a) synthase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q0CZL3 2.88e-10 64 26 6 186 3 dus3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q757E3 3.05e-10 64 27 6 192 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q9T0J6 4.01e-10 64 25 12 243 1 At4g38890 tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Arabidopsis thaliana
Q8FB30 4.43e-10 63 24 11 319 3 dusA tRNA-dihydrouridine(20/20a) synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1CNY3 4.6e-10 63 27 7 179 3 dus3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
P32695 5.79e-10 63 24 10 319 1 dusA tRNA-dihydrouridine(20/20a) synthase Escherichia coli (strain K12)
Q8X5V6 5.79e-10 63 24 10 319 3 dusA tRNA-dihydrouridine(20/20a) synthase Escherichia coli O157:H7
Q6CWM0 6.45e-10 63 28 5 162 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q8Z1T1 6.57e-10 62 26 7 244 3 dusA tRNA-dihydrouridine(20/20a) synthase Salmonella typhi
P44794 7.23e-10 62 27 5 180 3 dusA tRNA-dihydrouridine(20/20a) synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HGN6 7.31e-10 62 25 5 170 1 dus1 tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)] Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8ZKH4 1.1e-09 62 29 6 181 3 dusA tRNA-dihydrouridine(20/20a) synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A1D1U0 1.84e-09 62 26 7 179 3 dus3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q7UBC5 2.25e-09 61 24 10 319 3 dusA tRNA-dihydrouridine(20/20a) synthase Shigella flexneri
Q6FJ14 2.54e-09 61 24 7 217 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A6RMI1 2.95e-09 61 24 6 208 3 dus3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Botryotinia fuckeliana (strain B05.10)
A7EKL8 3.12e-09 61 25 7 208 3 dus3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q7SG01 3.21e-09 61 25 7 178 3 dus-3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A2QAU6 4.12e-09 61 26 7 188 3 dus3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q5BF62 4.95e-09 60 23 7 214 3 dus3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q06063 5e-09 60 29 4 149 1 DUS4 tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A4RLF4 5.06e-09 60 28 7 181 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q0U9D6 5.06e-09 60 25 7 204 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q6C4K3 5.28e-09 60 26 6 181 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Yarrowia lipolytica (strain CLIB 122 / E 150)
Q7VNV2 6.34e-09 59 25 5 179 3 dusA tRNA-dihydrouridine(20/20a) synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q4WRX4 7.75e-09 60 26 7 179 3 dus3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q2UL89 1.78e-08 59 25 7 186 3 dus3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q2HDP2 2.01e-08 58 23 7 206 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
P53720 2.3e-08 58 29 7 180 1 SMM1 tRNA-dihydrouridine(20) synthase [NAD(P)+] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q06053 4.1e-08 58 25 6 167 1 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A7A1S5 4.1e-08 58 25 6 167 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Saccharomyces cerevisiae (strain YJM789)
A7TQ73 5.4e-07 54 25 6 167 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q9PGB5 6.2e-06 50 29 6 179 3 dusA tRNA-dihydrouridine(20/20a) synthase Xylella fastidiosa (strain 9a5c)
Q87AY2 3.03e-05 48 27 5 181 3 dusA tRNA-dihydrouridine(20/20a) synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2G5A3 5.3e-05 47 25 6 167 3 pyrD Dihydroorotate dehydrogenase A (fumarate) Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHS3 5.3e-05 47 25 6 167 3 pyrD Dihydroorotate dehydrogenase A (fumarate) Limosilactobacillus reuteri (strain DSM 20016)
Q9V0Y6 5.57e-05 47 28 8 178 3 pyrD Dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit Pyrococcus abyssi (strain GE5 / Orsay)
Q5JHR7 9.02e-05 47 27 8 176 3 pyrD Dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8CWG1 0.000179 46 27 7 162 3 pyrD Dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5FJB5 0.001 43 26 6 152 3 pyrD Dihydroorotate dehydrogenase A (fumarate) Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS03060
Feature type CDS
Gene dusC
Product tRNA dihydrouridine(16) synthase DusC
Location 674541 - 675473 (strand: 1)
Length 933 (nucleotides) / 310 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_87
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF01207 Dihydrouridine synthase (Dus)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0042 Translation, ribosomal structure and biogenesis (J) J tRNA-dihydrouridine synthase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05541 tRNA-dihydrouridine synthase C [EC:1.-.-.-] - -

Protein Sequence

MRVLLAPMEGVLDPLVRDLLTAINHYDLCITEFIRVVDSLLPPKAFYRLCPELHTQSRTQSGTLVRVQLLGQNPQWLAENAFRAVSLGSWGVDLNCGCPSKTVNGNGGGASLLKQPETIYQATKAMRGAVPADLPVSVKVRLGWDCSSYCHEIADAVEQGGATEITIHGRTKEDGYRADKINWQAIGEIRQKLTIPVIANGEIWCREDAISCLKITGCDAIMIGRGAMHTPNLSNVIKGIEEKMPWSQVIQLLKRYIRLEKQGDTTYYHASRIKQWLGYLRKEYQDADALFSQIRTLKTSPEIAKIIEAL

Flanking regions ( +/- flanking 50bp)

ATAATCAAAATCCTTGGTCAAAAGCTAGAAAAGAATTTTGAGGCTAAACTGTGCGAGTCCTATTAGCGCCAATGGAGGGGGTGTTAGACCCCCTTGTGAGAGATCTACTGACGGCGATTAATCATTACGATCTCTGTATCACGGAATTTATTCGCGTTGTTGATTCATTATTACCGCCAAAAGCATTTTATCGTTTATGCCCTGAATTACACACCCAAAGCCGCACGCAAAGTGGCACTTTGGTGCGGGTACAATTATTAGGGCAAAATCCACAATGGTTGGCAGAAAACGCTTTTCGAGCCGTCTCTTTAGGTTCATGGGGGGTTGATCTTAATTGTGGTTGTCCTTCTAAAACCGTCAATGGTAATGGTGGTGGTGCCTCGTTATTAAAACAACCAGAAACGATTTATCAAGCAACTAAAGCGATGCGTGGTGCTGTACCTGCGGATTTACCTGTTTCTGTAAAGGTACGATTAGGGTGGGATTGTTCATCTTATTGCCATGAAATTGCCGATGCTGTAGAACAAGGTGGCGCGACAGAAATTACTATCCACGGTAGAACAAAAGAAGATGGTTATCGTGCTGATAAGATAAACTGGCAAGCGATTGGTGAAATTCGCCAAAAATTGACTATTCCCGTTATCGCTAACGGTGAGATTTGGTGTCGAGAAGATGCTATCTCTTGTTTAAAGATAACCGGCTGTGATGCGATTATGATAGGTCGCGGGGCGATGCATACGCCCAATTTAAGTAATGTGATAAAAGGTATTGAAGAAAAAATGCCTTGGTCACAAGTGATCCAATTACTTAAACGCTATATTCGTCTAGAAAAGCAAGGGGATACCACTTATTACCATGCTTCCCGTATAAAACAGTGGTTGGGATATTTAAGAAAAGAGTATCAAGATGCTGATGCACTTTTTAGTCAAATTAGAACGCTAAAAACCTCACCTGAAATAGCCAAAATAATAGAAGCGTTATAATAACCACAATAGGTTATTAATAGCCAAAACCAGCATTAATAATAAGGTGC