Homologs in group_85

Help

11 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06695 FBDBKF_06695 100.0 Morganella morganii S1 - tRNA-dihydrouridine synthase C
FBDBKF_09520 FBDBKF_09520 69.5 Morganella morganii S1 dusC tRNA dihydrouridine(16) synthase DusC
EHELCC_04275 EHELCC_04275 100.0 Morganella morganii S2 - tRNA-dihydrouridine synthase C
EHELCC_04320 EHELCC_04320 69.5 Morganella morganii S2 dusC tRNA dihydrouridine(16) synthase DusC
NLDBIP_04275 NLDBIP_04275 100.0 Morganella morganii S4 - tRNA-dihydrouridine synthase C
NLDBIP_04320 NLDBIP_04320 69.5 Morganella morganii S4 dusC tRNA dihydrouridine(16) synthase DusC
LHKJJB_14310 LHKJJB_14310 69.5 Morganella morganii S3 dusC tRNA dihydrouridine(16) synthase DusC
HKOGLL_08870 HKOGLL_08870 100.0 Morganella morganii S5 - tRNA-dihydrouridine synthase C
HKOGLL_12225 HKOGLL_12225 69.5 Morganella morganii S5 dusC tRNA dihydrouridine(16) synthase DusC
F4V73_RS00835 F4V73_RS00835 81.8 Morganella psychrotolerans dusC tRNA dihydrouridine(16) synthase DusC
PMI_RS03060 PMI_RS03060 62.0 Proteus mirabilis HI4320 dusC tRNA dihydrouridine(16) synthase DusC

Distribution of the homologs in the orthogroup group_85

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_85

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8FFV5 5.83e-106 310 76 1 197 3 dusC tRNA-dihydrouridine(16) synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7UC91 6.57e-106 310 76 1 197 3 dusC tRNA-dihydrouridine(16) synthase Shigella flexneri
P33371 7.66e-106 310 76 1 197 1 dusC tRNA-dihydrouridine(16) synthase Escherichia coli (strain K12)
Q8XEC6 2.39e-104 306 75 1 197 3 dusC tRNA-dihydrouridine(16) synthase Escherichia coli O157:H7
Q8ZGV2 4.26e-101 297 73 1 199 3 dusC tRNA-dihydrouridine(16) synthase Yersinia pestis
Q8ZNM4 6.96e-101 297 73 1 197 3 dusC tRNA-dihydrouridine(16) synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z5B2 3.96e-99 292 72 1 197 3 dusC tRNA-dihydrouridine(16) synthase Salmonella typhi
Q9CJW1 1.16e-87 263 64 1 197 3 dusC tRNA-dihydrouridine(16) synthase Pasteurella multocida (strain Pm70)
P44606 2.77e-79 242 58 1 193 3 dusC tRNA-dihydrouridine(16) synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7VKU5 3.98e-79 242 58 1 202 3 dusC tRNA-dihydrouridine(16) synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9KT00 9.61e-72 223 57 1 199 3 dusC tRNA-dihydrouridine(16) synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8DAH1 3.51e-71 221 56 1 197 3 dusC tRNA-dihydrouridine(16) synthase Vibrio vulnificus (strain CMCP6)
Q87N01 4.85e-68 214 50 1 199 3 dusC tRNA-dihydrouridine(16) synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8EFG7 1.93e-52 173 43 2 202 3 dusC tRNA-dihydrouridine(16) synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8XYX1 2.93e-35 129 38 5 206 3 dusC tRNA-dihydrouridine(16) synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
O68273 7.31e-35 128 37 3 208 3 dusC tRNA-dihydrouridine(16) synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9AMN9 4.59e-34 126 36 4 204 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas alcaligenes
Q9JUP6 7.8e-34 125 36 5 205 3 dusC tRNA-dihydrouridine(16) synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JZL5 2.13e-33 124 36 5 206 3 dusC tRNA-dihydrouridine(16) synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9HZ95 1.33e-31 119 36 3 199 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88LF2 1.57e-31 119 33 3 204 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q884C6 6.96e-28 110 33 3 199 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P37567 5.59e-20 89 42 4 121 3 dus1 Probable tRNA-dihydrouridine synthase 1 Bacillus subtilis (strain 168)
Q92JQ6 6.11e-19 86 38 3 121 3 dus Probable tRNA-dihydrouridine synthase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q55724 6.18e-19 86 31 6 213 3 dus1 Probable tRNA-dihydrouridine synthase 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O25427 1.26e-18 85 38 2 134 3 dus Probable tRNA-dihydrouridine synthase Helicobacter pylori (strain ATCC 700392 / 26695)
Q7VNP2 1.31e-18 85 35 3 121 3 dusB tRNA-dihydrouridine synthase B Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9CLW3 1.78e-18 85 36 3 121 3 dusB tRNA-dihydrouridine synthase B Pasteurella multocida (strain Pm70)
P44965 4.47e-18 84 39 4 122 3 dusB tRNA-dihydrouridine synthase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P41504 4.78e-18 83 40 3 121 3 dus Probable tRNA-dihydrouridine synthase Rhizobium leguminosarum bv. phaseoli
O52533 6.42e-18 83 37 3 121 3 dusB tRNA-dihydrouridine synthase B Proteus vulgaris
Q8ZAX7 6.89e-18 83 36 4 149 3 dusB tRNA-dihydrouridine synthase B Yersinia pestis
Q9ZLB6 8.69e-18 83 37 2 134 3 dus Probable tRNA-dihydrouridine synthase Helicobacter pylori (strain J99 / ATCC 700824)
Q4UNJ4 1.37e-17 82 35 3 121 3 dus Probable tRNA-dihydrouridine synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
O52536 6.13e-17 80 31 8 207 3 dusB tRNA-dihydrouridine synthase B Klebsiella pneumoniae
Q9ZED2 7.03e-17 80 34 3 129 3 dus Probable tRNA-dihydrouridine synthase Rickettsia prowazekii (strain Madrid E)
Q68XZ3 2.74e-16 79 34 3 129 3 dus Probable tRNA-dihydrouridine synthase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
O52539 7.14e-16 77 36 3 121 3 dusB tRNA-dihydrouridine synthase B Pectobacterium carotovorum
Q9HUW1 1.67e-15 76 33 4 148 3 dusB tRNA-dihydrouridine synthase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87KU1 1.68e-15 76 37 3 121 3 dusB tRNA-dihydrouridine synthase B Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P45672 1.93e-15 76 36 3 121 3 dus Probable tRNA-dihydrouridine synthase Azospirillum brasilense
Q8PP72 2.4e-15 76 38 3 121 3 dusB tRNA-dihydrouridine synthase B Xanthomonas axonopodis pv. citri (strain 306)
P0A2R6 3.15e-15 75 28 7 206 3 dusB tRNA-dihydrouridine synthase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2R7 3.15e-15 75 28 7 206 3 dusB tRNA-dihydrouridine synthase B Salmonella typhi
Q83PZ5 6.92e-15 75 29 7 206 3 dusB tRNA-dihydrouridine synthase B Shigella flexneri
Q1RH84 7.05e-15 75 35 3 121 3 dus Probable tRNA-dihydrouridine synthase Rickettsia bellii (strain RML369-C)
P0ABT5 7.57e-15 74 29 7 206 1 dusB tRNA-dihydrouridine synthase B Escherichia coli (strain K12)
P0ABT6 7.57e-15 74 29 7 206 3 dusB tRNA-dihydrouridine synthase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ABT7 7.57e-15 74 29 7 206 3 dusB tRNA-dihydrouridine synthase B Escherichia coli O157:H7
Q88DK5 8.59e-15 74 35 3 121 3 dusB tRNA-dihydrouridine synthase B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q32M08 9.35e-15 74 26 7 195 2 Dus4l tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+]-like Mus musculus
O67533 1.63e-14 73 31 3 121 3 dus Probable tRNA-dihydrouridine synthase Aquifex aeolicus (strain VF5)
Q8PCH1 1.94e-14 73 38 3 121 3 dusB tRNA-dihydrouridine synthase B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8CWL2 2.92e-13 70 33 4 154 3 dusB tRNA-dihydrouridine synthase B Vibrio vulnificus (strain CMCP6)
Q8EJR8 3.7e-13 70 37 2 96 3 dusB tRNA-dihydrouridine synthase B Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
O95620 5e-13 69 33 3 123 1 DUS4L tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+]-like Homo sapiens
O52532 5.99e-13 69 29 7 182 3 dusB tRNA-dihydrouridine synthase B Serratia marcescens
Q8K582 3.33e-11 65 30 6 178 2 Dus1l tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like Rattus norvegicus
Q50049 5.69e-11 64 29 8 189 3 dus Probable tRNA-dihydrouridine synthase Mycobacterium leprae (strain TN)
Q87VS1 8.37e-11 63 35 2 96 3 dusB tRNA-dihydrouridine synthase B Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8C2P3 1.01e-10 63 29 6 178 2 Dus1l tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like Mus musculus
Q9KV66 1.2e-10 62 35 2 96 3 dusB tRNA-dihydrouridine synthase B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6P1R4 3.41e-10 62 35 2 101 1 DUS1L tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like Homo sapiens
Q09504 3.72e-10 61 31 3 123 3 C45G9.2 Uncharacterized tRNA-dihydrouridine synthase-like protein C45G9.2 Caenorhabditis elegans
P9WNS7 8.48e-10 60 30 7 170 1 dus Probable tRNA-dihydrouridine synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNS6 8.48e-10 60 30 7 170 3 dus Probable tRNA-dihydrouridine synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O74553 9.78e-10 60 28 3 123 1 dus4 tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+] Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54CU9 2.78e-09 59 27 3 121 3 dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Dictyostelium discoideum
P53759 4.55e-09 58 25 5 183 1 DUS1 tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q87L85 7.55e-08 54 27 8 179 3 dusA tRNA-dihydrouridine(20/20a) synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9HGN6 1.13e-07 54 25 6 168 1 dus1 tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)] Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q08111 2.41e-07 53 38 3 121 3 dus Probable tRNA-dihydrouridine synthase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q28BT8 4.09e-07 53 33 5 109 2 dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Xenopus tropicalis
A8NZY7 5.85e-07 52 31 5 113 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
O83945 1.83e-06 50 34 5 129 3 dus Probable tRNA-dihydrouridine synthase Treponema pallidum (strain Nichols)
P0CN28 5.75e-06 49 26 6 151 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CN29 5.75e-06 49 26 6 151 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q8ZJ14 7.33e-06 48 26 8 178 3 dusA tRNA-dihydrouridine(20/20a) synthase Yersinia pestis
Q4P1U2 1.94e-05 48 28 5 148 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Ustilago maydis (strain 521 / FGSC 9021)
Q5ALL3 1.99e-05 48 26 4 138 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Candida albicans (strain SC5314 / ATCC MYA-2876)
P96192 6.54e-05 46 32 2 90 3 dusC tRNA-dihydrouridine(16) synthase Azotobacter vinelandii
Q7XT07 9e-05 46 30 6 113 2 Os04g0117600 tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Oryza sativa subsp. japonica
A3LUK5 0.000106 45 27 6 142 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q8NYV4 0.000114 45 30 4 118 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain MW2)
Q6GD38 0.000114 45 30 4 118 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain MSSA476)
Q5HJT5 0.000114 45 30 4 118 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain COL)
O31546 0.000116 45 27 3 111 3 dus2 Probable tRNA-dihydrouridine synthase 2 Bacillus subtilis (strain 168)
P67717 0.000117 45 30 4 118 1 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain N315)
P67716 0.000117 45 30 4 118 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GKK9 0.000125 45 30 4 118 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain MRSA252)
Q5HKD5 0.000212 44 30 3 103 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CU07 0.000216 44 30 3 103 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q757E3 0.000219 45 26 6 141 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q06063 0.000276 44 25 3 125 1 DUS4 tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A5DBS1 0.000342 44 25 6 142 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
A8PTG4 0.000389 44 25 4 136 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Malassezia globosa (strain ATCC MYA-4612 / CBS 7966)
Q6CWM0 0.000613 43 25 4 122 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_10105
Feature type CDS
Gene -
Product tRNA-dihydrouridine synthase C
Location 183673 - 184287 (strand: -1)
Length 615 (nucleotides) / 204 (amino acids)
In genomic island GI50

Contig

Accession ZDB_366
Length 191897 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_85
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF01207 Dihydrouridine synthase (Dus)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0042 Translation, ribosomal structure and biogenesis (J) J tRNA-dihydrouridine synthase

Protein Sequence

MLLKDPELIYQGTKAIREAVPAHLPVSVKVRLGWSSNAHQFEIADAVAQGGATEVTVHGRTKEAGYRADLIDWPAIAAIRQRLSIPVIANGEVRDWQSAQQCLAMTGCDAVMLGRGALNVPNLSCVVKYNAPFMPWPEVVALLYRYTQLEKQGDTGLYHVARIKQWFSYLHKAYPQEADELFAVIRPLKDSASIAQAIARAQGA

Flanking regions ( +/- flanking 50bp)

TAAACTTTGCCTGCCCGTCCAAAACAGTGAACGGCAGCGGCGGCGGGGCGATGCTTCTTAAAGACCCGGAGCTGATTTATCAGGGCACCAAAGCTATCCGTGAAGCGGTACCGGCACATCTGCCGGTGTCGGTGAAAGTGCGGCTCGGCTGGAGCAGCAATGCGCACCAGTTTGAAATCGCCGATGCGGTGGCACAAGGCGGGGCAACCGAGGTCACGGTGCACGGGCGCACCAAAGAAGCAGGCTATCGCGCGGATCTGATTGACTGGCCGGCGATCGCAGCTATCCGTCAGCGGCTCTCCATTCCGGTGATTGCCAACGGCGAAGTCCGTGACTGGCAGAGTGCGCAGCAATGCCTGGCCATGACCGGCTGTGATGCGGTGATGCTCGGGCGCGGAGCGCTCAATGTGCCGAACCTGAGCTGTGTGGTTAAATATAACGCGCCCTTTATGCCGTGGCCGGAAGTGGTGGCATTACTGTACCGCTACACGCAGCTGGAAAAGCAGGGTGATACCGGGCTGTACCATGTGGCACGTATCAAACAGTGGTTCAGCTATCTGCACAAAGCCTATCCGCAGGAAGCGGATGAGCTTTTTGCTGTGATCCGCCCGCTGAAGGATTCTGCCTCTATAGCACAGGCGATTGCCCGGGCTCAGGGCGCATAAAATTTGCTTTTTTTGCCATATCGCACTTTAATTGACAGGTGAGCCGGATT