Homologs in group_1573

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09845 FBDBKF_09845 85.9 Morganella morganii S1 gltA citrate synthase
EHELCC_04645 EHELCC_04645 85.9 Morganella morganii S2 gltA citrate synthase
NLDBIP_04645 NLDBIP_04645 85.9 Morganella morganii S4 gltA citrate synthase
LHKJJB_13985 LHKJJB_13985 85.9 Morganella morganii S3 gltA citrate synthase
HKOGLL_12550 HKOGLL_12550 85.9 Morganella morganii S5 gltA citrate synthase
F4V73_RS00500 F4V73_RS00500 86.2 Morganella psychrotolerans - citrate synthase

Distribution of the homologs in the orthogroup group_1573

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1573

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O68883 0.0 780 84 1 426 3 gltA Citrate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0ABH7 0.0 780 85 1 426 1 gltA Citrate synthase Escherichia coli (strain K12)
P0ABH8 0.0 780 85 1 426 3 gltA Citrate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P14165 0.0 637 67 2 428 1 gltA Citrate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P51033 0.0 634 69 3 423 3 gltA Citrate synthase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
P51034 0.0 622 68 3 425 3 gltA Citrate synthase Bartonella quintana (strain Toulouse)
O33915 0.0 620 69 3 423 3 gltA Citrate synthase Rhizobium meliloti (strain 1021)
P51037 0.0 617 69 3 423 3 ccsA Citrate synthase, chromosomal Rhizobium tropici
P51038 0.0 603 67 3 423 3 pcsA Citrate synthase, plasmid Rhizobium tropici
P20902 0.0 600 66 2 415 3 gltA Citrate synthase Acinetobacter calcoaceticus subsp. anitratus
P94325 0.0 586 65 4 423 3 gltA Citrate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P18789 0.0 582 63 2 421 3 gltA Citrate synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P20901 0.0 572 62 3 418 1 aarA Citrate synthase Acetobacter aceti
Q1RGV8 0.0 553 61 3 421 3 gltA Citrate synthase Rickettsia bellii (strain RML369-C)
Q59778 0.0 553 62 4 419 3 gltA Citrate synthase Rickettsia sibirica (strain ATCC VR-151 / 246)
Q59776 0.0 553 62 4 419 3 gltA Citrate synthase Rickettsia slovaca (strain 13-B)
P51040 0.0 552 62 4 419 3 gltA Citrate synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q59732 0.0 551 62 4 419 3 gltA Citrate synthase Rickettsia africae (strain ESF-5)
P51042 0.0 550 61 4 419 3 gltA Citrate synthase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P51043 0.0 548 60 4 426 3 gltA Citrate synthase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P09948 0.0 547 60 4 426 3 gltA Citrate synthase Rickettsia prowazekii (strain Madrid E)
Q59734 0.0 540 62 3 408 3 gltA Citrate synthase (Fragment) Rickettsia bellii
Q59759 0.0 538 62 4 408 3 gltA Citrate synthase (Fragment) Rickettsia parkeri
P51039 0.0 536 62 4 408 3 gltA Citrate synthase (Fragment) Rickettsia australis
Q59768 0.0 535 61 4 408 3 gltA Citrate synthase (Fragment) Rickettsia rhipicephali
Q59748 0.0 535 61 4 408 3 gltA Citrate synthase (Fragment) Rickettsia massiliae
Q59730 0.0 535 62 4 408 3 gltA Citrate synthase (Fragment) Rickettsia akari
Q59136 0.0 534 62 4 408 3 gltA Citrate synthase (Fragment) Rickettsia conorii subsp. caspia (strain A-167)
Q59741 0.0 532 61 4 408 3 gltA Citrate synthase (Fragment) Rickettsia helvetica
Q59742 0.0 531 61 4 408 3 gltA Citrate synthase (Fragment) Rickettsia japonica
P51041 0.0 531 62 4 397 3 gltA Citrate synthase (Fragment) Rickettsia canadensis
P51032 0.0 511 72 1 320 3 gltA Citrate synthase (Fragment) Bartonella elizabethae
P51036 0.0 510 72 1 318 3 gltA Citrate synthase (Fragment) Bartonella vinsonii
Q59198 6.31e-180 507 73 1 320 3 gltA Citrate synthase (Fragment) Bartonella doshiae
Q59258 1.58e-179 506 72 1 321 3 gltA Citrate synthase (Fragment) Bartonella taylorii
P51031 8.16e-176 496 70 1 320 3 gltA Citrate synthase (Fragment) Bartonella bacilliformis
P9WPD5 3.77e-164 471 52 3 421 1 gltA2 Citrate synthase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPD4 3.77e-164 471 52 3 421 3 gltA2 Citrate synthase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P42457 6.21e-141 412 48 4 422 3 gltA Citrate synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q86AV6 2.63e-134 398 48 6 400 3 gltA Citrate synthase Dictyostelium discoideum
Q8MQU6 8.19e-126 376 47 5 392 2 cshA Citrate synthase, peroxisomal Dictyostelium discoideum
P49299 1.09e-119 361 46 5 390 1 None Citrate synthase, glyoxysomal Cucurbita maxima
Q9SJH7 1.44e-118 358 45 5 386 2 CSY3 Citrate synthase 3, peroxisomal Arabidopsis thaliana
P56062 2.93e-118 354 42 5 411 3 gltA Citrate synthase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZN37 1.98e-117 352 42 5 411 3 gltA Citrate synthase Helicobacter pylori (strain J99 / ATCC 700824)
Q9LXS6 3.05e-117 355 43 6 410 2 CSY2 Citrate synthase 2, peroxisomal Arabidopsis thaliana
Q9LXS7 8.72e-110 334 42 8 408 2 CSY1 Citrate synthase 1, peroxisomal Arabidopsis thaliana
Q59977 4.77e-86 271 37 7 375 3 gltA Citrate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P51045 4.15e-81 258 36 7 385 3 gltA Citrate synthase Acidithiobacillus ferridurans
Q2TXF1 2.84e-72 236 32 4 385 3 oryE Citrate synthase-like protein oryE Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9RWB2 6.48e-69 226 35 6 376 1 gltA Citrate synthase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q53554 5.19e-66 218 34 10 373 1 gltA Citrate synthase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
D4GS06 5.36e-66 218 34 9 381 1 citZ Citrate synthase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P80148 3.14e-64 214 33 4 361 1 gltA Citrate synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P27660 3.62e-62 208 33 7 372 3 ctsA Citrate synthase Heyndrickxia coagulans
P39120 4.39e-61 205 34 8 377 1 citZ Citrate synthase 2 Bacillus subtilis (strain 168)
A0A3G1DJJ8 6.83e-61 207 32 5 382 2 R3 Citrate synthase-like protein Phoma sp. (strain ATCC 20986 / MF5453)
Q59939 1.29e-59 201 32 11 379 3 citZ Citrate synthase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P45858 1.31e-57 196 32 7 374 1 mmgD Citrate/2-methylcitrate synthase Bacillus subtilis (strain 168)
P51035 9.9e-57 185 78 1 111 3 gltA Citrate synthase (Fragment) Bartonella vinsonii subsp. berkhoffii
P39119 8.35e-56 191 31 7 375 1 citA Citrate synthase 1 Bacillus subtilis (strain 168)
P21553 2.78e-55 191 31 8 373 1 gltA Citrate synthase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q8NSH7 1.06e-50 178 31 8 382 1 prpC1 2-methylcitrate synthase 1 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8EJW2 6.96e-50 176 29 9 379 3 prpC 2-methylcitrate synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
O34002 5.5e-49 174 31 8 391 1 gltA 2-methylcitrate synthase Antarctic bacterium DS2-3R
A0A345BJN4 1.45e-47 171 32 6 342 1 clz17 Citrate synthase-like protein clz17 Cochliobolus lunatus
Q8NSL1 1.67e-46 167 31 6 355 1 prpC2 2-methylcitrate synthase 2 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q937N9 2.86e-45 164 30 8 362 1 prpC 2-methylcitrate synthase Cupriavidus necator
Q56063 3.12e-45 164 31 9 365 1 prpC 2-methylcitrate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P31660 4.64e-45 164 31 9 369 1 prpC 2-methylcitrate synthase Escherichia coli (strain K12)
P26491 1.52e-44 162 29 7 376 3 gltA Citrate synthase Mycolicibacterium smegmatis
B8MKZ3 3.02e-42 157 29 10 388 1 tstJ Alkylcitrate synthase tstJ Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
I6Y9Q3 3.06e-38 145 27 6 374 1 prpC 2-methylcitrate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
H8F0D7 3.06e-38 145 27 6 374 1 gltA1 2-methylcitrate synthase Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
A0A348HAY5 4.97e-37 143 25 7 402 1 phiJ Alkylcitrate synthase phiJ Fungal sp. (strain ATCC 74256)
P9WPD3 2.34e-31 126 28 16 396 1 citA Putative citrate synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPD2 2.34e-31 126 28 16 396 3 citA Putative citrate synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63778 2.34e-31 126 28 16 396 1 citA Putative citrate synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0QHL3 9.2e-30 123 28 13 352 2 None Probable citrate synthase, mitochondrial Glossina morsitans morsitans
Q9W401 2.65e-28 119 26 15 403 2 Cs1 Probable citrate synthase, mitochondrial Drosophila melanogaster
Q28DK1 7.01e-28 118 27 12 351 2 cs Citrate synthase, mitochondrial Xenopus tropicalis
Q54KL0 7.88e-28 117 25 17 434 3 DDB_G0287281 Citrate synthase-related protein DDB_G0287281 Dictyostelium discoideum
Q17GM7 4.91e-27 115 27 14 351 3 AAEL002956 Probable citrate synthase 1, mitochondrial Aedes aegypti
Q16P20 5.26e-27 115 27 14 351 3 AAEL011789 Probable citrate synthase 2, mitochondrial Aedes aegypti
C7C436 1.29e-26 114 28 17 393 1 mcsA 2-methylcitrate synthase, mitochondrial Gibberella moniliformis
P34085 1.62e-26 114 27 11 348 2 cit-1 Citrate synthase, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q553V1 2.54e-26 113 25 14 413 3 cs Citrate synthase, mitochondrial Dictyostelium discoideum
P00889 3.69e-26 113 27 12 351 1 CS Citrate synthase, mitochondrial Sus scrofa
P0C1Z2 6.5e-26 112 26 12 351 2 CS Citrate synthase, mitochondrial Macaca fascicularis
Q6S9V6 9.71e-26 112 26 13 352 2 cs Citrate synthase, mitochondrial Xiphias gladius
C7C435 1.27e-25 112 27 17 393 1 mcsA 2-methylcitrate synthase, mitochondrial Fusarium solani
P24118 1.59e-25 111 26 17 440 1 None Citrate synthase, mitochondrial Tetrahymena thermophila
Q6S9V5 1.79e-25 111 26 12 348 2 cs Citrate synthase, mitochondrial Kajikia audax
P08679 1.84e-25 111 26 15 384 1 CIT2 Citrate synthase, peroxisomal Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0GNE0 2.19e-25 111 27 13 351 2 CS Citrate synthase, mitochondrial Iguana iguana
Q7ZVY5 3.28e-25 110 26 12 350 2 cs Citrate synthase, mitochondrial Danio rerio
Q6S9V8 3.44e-25 110 26 12 349 2 cs Citrate synthase, mitochondrial Thunnus obesus
Q6S9V9 3.44e-25 110 26 12 349 2 cs Citrate synthase, mitochondrial Thunnus albacares
Q29RK1 3.48e-25 110 27 12 351 1 CS Citrate synthase, mitochondrial Bos taurus
O75390 4.26e-25 110 27 14 352 1 CS Citrate synthase, mitochondrial Homo sapiens
Q6S9V7 5.14e-25 110 26 12 349 2 cs Citrate synthase, mitochondrial Katsuwonus pelamis
Q9CZU6 6.56e-25 109 26 13 351 1 Cs Citrate synthase, mitochondrial Mus musculus
P00890 8.47e-25 109 27 12 383 1 CIT1 Citrate synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P23007 1.02e-24 108 25 12 388 1 CS Citrate synthase, mitochondrial Gallus gallus
Q61JF9 1.24e-24 108 25 15 399 3 cts-1 Probable citrate synthase, mitochondrial Caenorhabditis briggsae
P34575 1.3e-24 108 25 15 399 3 cts-1 Probable citrate synthase, mitochondrial Caenorhabditis elegans
Q7ZWZ5 1.37e-24 108 26 13 351 2 cs Citrate synthase, mitochondrial Xenopus laevis
Q0GNE1 1.41e-24 108 27 13 351 2 CS Citrate synthase, mitochondrial Amblyrhynchus cristatus
Q6C793 3.65e-24 107 27 11 347 1 YALI0E02684g 2-methylcitrate synthase, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
O80433 4.84e-24 107 26 14 352 2 CS Citrate synthase, mitochondrial Daucus carota
Q8VHF5 6.26e-24 107 26 12 351 1 Cs Citrate synthase, mitochondrial Rattus norvegicus
O00098 6.53e-24 107 27 12 346 2 citA Citrate synthase, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4S5X1 1.18e-23 106 25 12 350 3 cs Citrate synthase, mitochondrial Tetraodon nigroviridis
P49298 1.21e-23 106 25 11 348 2 CIT Citrate synthase, mitochondrial Citrus maxima
P79024 1.74e-23 105 26 9 349 3 CIT Citrate synthase, mitochondrial Candida tropicalis
Q9TEM3 3.46e-23 104 27 15 387 1 mcsA 2-methylcitrate synthase, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4QDX3 2.88e-22 102 27 16 366 3 LmjF18.0680 Probable citrate synthase, mitochondrial Leishmania major
P20115 4.27e-22 101 25 13 348 1 CSY4 Citrate synthase 4, mitochondrial Arabidopsis thaliana
A4HXU4 5.26e-22 101 27 18 367 3 LinJ18.0690 Probable citrate synthase, mitochondrial Leishmania infantum
Q9M1D3 8.16e-22 100 26 13 342 1 CSY5 Citrate synthase 5, mitochondrial Arabidopsis thaliana
P51044 2.69e-21 99 27 13 348 2 cit-1 Citrate synthase, mitochondrial Aspergillus niger
Q50I20 7.91e-21 97 26 15 391 1 mcsA 2-methylcitrate synthase, mitochondrial Aspergillus fumigatus
B0YD89 7.91e-21 97 26 15 391 1 mcsA 2-methylcitrate synthase, mitochondrial Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
Q43175 9.87e-21 97 25 14 354 2 None Citrate synthase, mitochondrial Solanum tuberosum
Q10306 4.48e-20 95 26 11 350 3 cit1 Probable citrate synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P83372 8.58e-20 94 29 11 272 1 MCSI Citrate synthase, mitochondrial Fragaria ananassa
A0A0S3QTD0 3.04e-19 92 26 14 349 1 gltA Citrate synthase Thermosulfidibacter takaii (strain DSM 17441 / JCM 13301 / NBRC 103674 / ABI70S6)
Q0QEL7 7.5e-18 85 30 9 217 1 CS Citrate synthase, mitochondrial (Fragment) Mesocricetus auratus
P43635 1.76e-17 87 25 17 362 1 CIT3 Citrate synthase 3, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A4H9H8 3.63e-17 86 24 15 366 3 LbrM18_V2.0760 Probable citrate synthase, mitochondrial Leishmania braziliensis

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS02775
Feature type CDS
Gene -
Product citrate synthase
Location 608354 - 609637 (strand: -1)
Length 1284 (nucleotides) / 427 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1573
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00285 Citrate synthase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0372 Energy production and conversion (C) C Citrate synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MADNKAKLTIGETSVDLDVLSPTLGSKVIDIRTLGSKGYYTYDPGFTSTASCESKITYIDGNNGILLHRGFPIGQLATESTYLEVCYILLYGEAPTQEQYDKFKTTVTRHTMIHEQITRLFHGFRRDSHPMAVLCGVTGALAAFYHDALDVSNPVHRDITAYRLLSKMPTVAAMCYKYSIGQPFVYPRNDLSYAGNFLHMMFATPCEEYVVNPVLERAMDRIFILHADHEQNASTSTVRTAGSSGANPFACIAAGIASLWGPAHGGANEACLRMLEEIKTVEHIPEFIKRAKDKNDSFRLMGFGHRVYKNYDPRATVMRETCHEVLKELNLNDSLLEVAMELERIALNDPYFIEKKLYPNVDFYSGIILKALGIPSNMFTVIFAIARTIGWIAHWNEMHEDGLKIARPRQLYTGYNERKFHSELKNK

Flanking regions ( +/- flanking 50bp)

GATACCCTCGACTTTGTTAGGAGACATAATAAGCGCTAAGGAGATTATAAATGGCTGATAACAAAGCTAAGTTAACGATTGGTGAAACTTCTGTGGACTTGGACGTTCTCTCCCCTACACTCGGTTCCAAAGTCATTGATATTCGTACTCTCGGCTCCAAAGGTTATTACACCTATGATCCAGGCTTTACCTCAACGGCATCTTGTGAATCGAAAATTACCTATATCGACGGTAATAACGGTATTTTACTGCACCGCGGTTTCCCAATTGGGCAATTGGCTACTGAGTCAACCTACTTAGAAGTATGTTATATCCTGCTTTATGGCGAAGCACCGACCCAAGAGCAATACGATAAATTTAAAACAACCGTCACTCGCCATACCATGATCCATGAGCAAATCACCCGACTGTTCCATGGTTTCCGTCGTGACTCACACCCGATGGCTGTACTTTGTGGTGTGACAGGAGCTTTAGCTGCCTTTTACCATGATGCGCTTGATGTCTCTAATCCAGTTCACCGTGATATCACAGCATATCGTTTACTGTCTAAGATGCCTACTGTAGCCGCAATGTGTTACAAGTACTCCATAGGACAACCTTTTGTTTATCCAAGAAACGATCTGTCTTATGCAGGTAACTTCCTACATATGATGTTTGCCACACCTTGTGAAGAGTATGTGGTTAACCCAGTTCTTGAACGTGCGATGGATAGGATCTTTATTCTTCATGCCGACCATGAACAAAATGCTTCAACATCTACTGTACGTACTGCAGGCTCTTCAGGTGCAAATCCATTTGCCTGTATTGCTGCGGGTATTGCTTCACTATGGGGACCTGCTCATGGTGGTGCTAACGAAGCTTGTTTACGTATGTTGGAAGAGATCAAAACCGTTGAACATATTCCTGAATTTATTAAACGCGCAAAAGACAAGAATGACTCTTTCCGTTTAATGGGCTTTGGTCACCGTGTATATAAAAACTACGATCCGCGTGCAACAGTCATGCGCGAAACTTGTCACGAAGTGTTAAAAGAACTGAATCTCAATGACAGTTTACTTGAAGTGGCAATGGAATTAGAACGCATCGCCTTAAATGACCCGTATTTTATTGAGAAAAAACTCTATCCTAACGTCGATTTCTATTCAGGTATTATTCTAAAAGCGCTAGGTATTCCATCAAATATGTTTACGGTCATTTTCGCTATTGCACGTACTATCGGTTGGATTGCTCACTGGAATGAAATGCATGAAGATGGACTGAAAATTGCACGTCCTCGTCAGTTATATACTGGCTATAACGAGCGTAAATTCCATAGTGAACTTAAAAATAAATAAATCGATTTAAACACGATTTATTGACTGGCTAAGCCCCGTTTTTGCGGGGC