Homologs in group_1573

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09845 FBDBKF_09845 100.0 Morganella morganii S1 gltA citrate synthase
EHELCC_04645 EHELCC_04645 100.0 Morganella morganii S2 gltA citrate synthase
NLDBIP_04645 NLDBIP_04645 100.0 Morganella morganii S4 gltA citrate synthase
LHKJJB_13985 LHKJJB_13985 100.0 Morganella morganii S3 gltA citrate synthase
F4V73_RS00500 F4V73_RS00500 96.0 Morganella psychrotolerans - citrate synthase
PMI_RS02775 PMI_RS02775 85.9 Proteus mirabilis HI4320 - citrate synthase

Distribution of the homologs in the orthogroup group_1573

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1573

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ABH7 0.0 763 82 0 427 1 gltA Citrate synthase Escherichia coli (strain K12)
P0ABH8 0.0 763 82 0 427 3 gltA Citrate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O68883 0.0 761 81 0 427 3 gltA Citrate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14165 0.0 642 69 0 421 1 gltA Citrate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P51033 0.0 614 66 4 424 3 gltA Citrate synthase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
O33915 0.0 613 68 5 431 3 gltA Citrate synthase Rhizobium meliloti (strain 1021)
P51037 0.0 606 67 5 431 3 ccsA Citrate synthase, chromosomal Rhizobium tropici
P51034 0.0 599 64 5 433 3 gltA Citrate synthase Bartonella quintana (strain Toulouse)
P51038 0.0 598 66 5 431 3 pcsA Citrate synthase, plasmid Rhizobium tropici
P20902 0.0 593 65 3 419 3 gltA Citrate synthase Acinetobacter calcoaceticus subsp. anitratus
P94325 0.0 582 64 4 423 3 gltA Citrate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P18789 0.0 579 63 3 421 3 gltA Citrate synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P20901 0.0 562 60 5 428 1 aarA Citrate synthase Acetobacter aceti
Q1RGV8 0.0 548 60 4 422 3 gltA Citrate synthase Rickettsia bellii (strain RML369-C)
Q59778 0.0 546 60 5 421 3 gltA Citrate synthase Rickettsia sibirica (strain ATCC VR-151 / 246)
Q59776 0.0 546 60 5 421 3 gltA Citrate synthase Rickettsia slovaca (strain 13-B)
P09948 0.0 545 59 5 427 3 gltA Citrate synthase Rickettsia prowazekii (strain Madrid E)
Q59732 0.0 544 59 5 421 3 gltA Citrate synthase Rickettsia africae (strain ESF-5)
P51040 0.0 544 59 5 421 3 gltA Citrate synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P51042 0.0 544 59 5 421 3 gltA Citrate synthase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P51043 0.0 543 58 5 427 3 gltA Citrate synthase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q59734 0.0 533 60 4 409 3 gltA Citrate synthase (Fragment) Rickettsia bellii
Q59759 0.0 530 60 5 409 3 gltA Citrate synthase (Fragment) Rickettsia parkeri
Q59768 0.0 527 59 5 409 3 gltA Citrate synthase (Fragment) Rickettsia rhipicephali
Q59748 0.0 527 59 5 409 3 gltA Citrate synthase (Fragment) Rickettsia massiliae
Q59730 0.0 527 60 5 409 3 gltA Citrate synthase (Fragment) Rickettsia akari
Q59136 0.0 526 59 5 409 3 gltA Citrate synthase (Fragment) Rickettsia conorii subsp. caspia (strain A-167)
Q59741 0.0 525 59 5 409 3 gltA Citrate synthase (Fragment) Rickettsia helvetica
Q59742 0.0 524 59 5 409 3 gltA Citrate synthase (Fragment) Rickettsia japonica
P51039 0.0 524 59 5 409 3 gltA Citrate synthase (Fragment) Rickettsia australis
P51041 0.0 521 59 5 408 3 gltA Citrate synthase (Fragment) Rickettsia canadensis
Q59198 2.51e-180 508 73 1 320 3 gltA Citrate synthase (Fragment) Bartonella doshiae
P51032 7.48e-179 504 71 1 320 3 gltA Citrate synthase (Fragment) Bartonella elizabethae
P51036 1.61e-177 501 71 1 318 3 gltA Citrate synthase (Fragment) Bartonella vinsonii
Q59258 3.34e-175 495 70 1 321 3 gltA Citrate synthase (Fragment) Bartonella taylorii
P51031 5.01e-172 487 69 1 320 3 gltA Citrate synthase (Fragment) Bartonella bacilliformis
P9WPD5 4.82e-166 476 54 3 414 1 gltA2 Citrate synthase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPD4 4.82e-166 476 54 3 414 3 gltA2 Citrate synthase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P42457 6.68e-140 410 49 5 421 3 gltA Citrate synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q86AV6 2.68e-131 390 48 5 385 3 gltA Citrate synthase Dictyostelium discoideum
Q8MQU6 1.43e-126 378 47 5 390 2 cshA Citrate synthase, peroxisomal Dictyostelium discoideum
P56062 5.32e-121 361 43 5 411 3 gltA Citrate synthase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZN37 2.63e-120 360 44 5 411 3 gltA Citrate synthase Helicobacter pylori (strain J99 / ATCC 700824)
P49299 1.34e-119 361 46 6 392 1 None Citrate synthase, glyoxysomal Cucurbita maxima
Q9SJH7 2.85e-118 357 45 6 400 2 CSY3 Citrate synthase 3, peroxisomal Arabidopsis thaliana
Q9LXS6 1.08e-117 356 44 5 402 2 CSY2 Citrate synthase 2, peroxisomal Arabidopsis thaliana
Q9LXS7 1.01e-110 337 44 7 394 2 CSY1 Citrate synthase 1, peroxisomal Arabidopsis thaliana
Q59977 1.25e-89 280 38 6 374 3 gltA Citrate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P51045 4.27e-78 250 35 7 393 3 gltA Citrate synthase Acidithiobacillus ferridurans
Q2TXF1 9.77e-72 235 32 4 386 3 oryE Citrate synthase-like protein oryE Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9RWB2 2.55e-69 227 35 6 376 1 gltA Citrate synthase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q53554 5.41e-68 223 35 9 364 1 gltA Citrate synthase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
D4GS06 1.25e-66 220 35 10 388 1 citZ Citrate synthase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P80148 2.15e-66 219 34 4 361 1 gltA Citrate synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A0A3G1DJJ8 1.25e-63 215 32 6 413 2 R3 Citrate synthase-like protein Phoma sp. (strain ATCC 20986 / MF5453)
P39120 2.6e-62 209 34 9 377 1 citZ Citrate synthase 2 Bacillus subtilis (strain 168)
P27660 9.66e-62 207 33 7 374 3 ctsA Citrate synthase Heyndrickxia coagulans
Q59939 3.67e-58 197 33 11 373 3 citZ Citrate synthase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P45858 6.93e-58 197 32 7 374 1 mmgD Citrate/2-methylcitrate synthase Bacillus subtilis (strain 168)
P39119 1.66e-57 196 31 7 372 1 citA Citrate synthase 1 Bacillus subtilis (strain 168)
P21553 6.51e-57 195 32 8 373 1 gltA Citrate synthase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
P51035 6.98e-54 178 75 1 111 3 gltA Citrate synthase (Fragment) Bartonella vinsonii subsp. berkhoffii
A0A345BJN4 1.86e-50 179 32 6 343 1 clz17 Citrate synthase-like protein clz17 Cochliobolus lunatus
Q8NSL1 2.1e-48 172 31 7 362 1 prpC2 2-methylcitrate synthase 2 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
O34002 4.55e-48 171 30 9 398 1 gltA 2-methylcitrate synthase Antarctic bacterium DS2-3R
Q8NSH7 7.17e-48 171 29 6 380 1 prpC1 2-methylcitrate synthase 1 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q56063 6.46e-47 169 31 10 371 1 prpC 2-methylcitrate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q937N9 1.45e-45 165 30 7 350 1 prpC 2-methylcitrate synthase Cupriavidus necator
Q8EJW2 1.53e-45 164 28 9 382 3 prpC 2-methylcitrate synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P31660 6.64e-45 163 31 9 363 1 prpC 2-methylcitrate synthase Escherichia coli (strain K12)
B8MKZ3 2.81e-44 163 28 7 383 1 tstJ Alkylcitrate synthase tstJ Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
P26491 9.22e-44 160 29 8 375 3 gltA Citrate synthase Mycolicibacterium smegmatis
A0A348HAY5 1.5e-40 153 27 7 397 1 phiJ Alkylcitrate synthase phiJ Fungal sp. (strain ATCC 74256)
I6Y9Q3 4.89e-38 145 29 7 356 1 prpC 2-methylcitrate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
H8F0D7 4.89e-38 145 29 7 356 1 gltA1 2-methylcitrate synthase Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
P9WPD3 2.01e-32 129 27 11 387 1 citA Putative citrate synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPD2 2.01e-32 129 27 11 387 3 citA Putative citrate synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63778 2.01e-32 129 27 11 387 1 citA Putative citrate synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0QHL3 9.9e-30 123 26 15 403 2 None Probable citrate synthase, mitochondrial Glossina morsitans morsitans
Q28DK1 3.34e-29 122 27 14 390 2 cs Citrate synthase, mitochondrial Xenopus tropicalis
Q54KL0 1.89e-28 119 25 16 422 3 DDB_G0287281 Citrate synthase-related protein DDB_G0287281 Dictyostelium discoideum
Q9W401 1.66e-27 117 26 16 403 2 Cs1 Probable citrate synthase, mitochondrial Drosophila melanogaster
Q7ZWZ5 4.63e-27 115 26 14 390 2 cs Citrate synthase, mitochondrial Xenopus laevis
Q7ZVY5 7.72e-27 115 26 15 388 2 cs Citrate synthase, mitochondrial Danio rerio
P0C1Z2 7.95e-27 115 26 14 390 2 CS Citrate synthase, mitochondrial Macaca fascicularis
Q17GM7 1.09e-26 115 27 20 399 3 AAEL002956 Probable citrate synthase 1, mitochondrial Aedes aegypti
Q16P20 1.46e-26 114 27 20 399 3 AAEL011789 Probable citrate synthase 2, mitochondrial Aedes aegypti
Q29RK1 5.4e-26 112 26 14 390 1 CS Citrate synthase, mitochondrial Bos taurus
Q9CZU6 6.36e-26 112 26 14 390 1 Cs Citrate synthase, mitochondrial Mus musculus
Q553V1 9.63e-26 112 24 13 411 3 cs Citrate synthase, mitochondrial Dictyostelium discoideum
Q6S9V6 1.64e-25 111 26 15 388 2 cs Citrate synthase, mitochondrial Xiphias gladius
O75390 2.6e-25 110 25 13 401 1 CS Citrate synthase, mitochondrial Homo sapiens
Q8VHF5 6.7e-25 109 25 14 390 1 Cs Citrate synthase, mitochondrial Rattus norvegicus
P34085 9.5e-25 109 27 12 347 2 cit-1 Citrate synthase, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q6S9V8 1.23e-24 108 26 15 388 2 cs Citrate synthase, mitochondrial Thunnus obesus
Q6S9V9 1.23e-24 108 26 15 388 2 cs Citrate synthase, mitochondrial Thunnus albacares
Q6S9V5 1.25e-24 108 26 15 386 2 cs Citrate synthase, mitochondrial Kajikia audax
P00889 1.92e-24 108 25 14 390 1 CS Citrate synthase, mitochondrial Sus scrofa
Q61JF9 2e-24 108 26 15 399 3 cts-1 Probable citrate synthase, mitochondrial Caenorhabditis briggsae
Q6S9V7 2.06e-24 108 26 15 388 2 cs Citrate synthase, mitochondrial Katsuwonus pelamis
P34575 2.51e-24 108 26 15 399 3 cts-1 Probable citrate synthase, mitochondrial Caenorhabditis elegans
P23007 2.86e-24 107 25 15 421 1 CS Citrate synthase, mitochondrial Gallus gallus
Q0GNE0 3.12e-24 107 25 13 401 2 CS Citrate synthase, mitochondrial Iguana iguana
Q4S5X1 1.49e-23 105 25 15 388 3 cs Citrate synthase, mitochondrial Tetraodon nigroviridis
Q0GNE1 2.44e-23 105 25 13 401 2 CS Citrate synthase, mitochondrial Amblyrhynchus cristatus
C7C436 1.35e-22 103 27 17 390 1 mcsA 2-methylcitrate synthase, mitochondrial Gibberella moniliformis
P08679 2.49e-22 102 27 16 367 1 CIT2 Citrate synthase, peroxisomal Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O00098 3.84e-22 101 26 13 383 2 citA Citrate synthase, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P24118 1.09e-21 100 26 16 368 1 None Citrate synthase, mitochondrial Tetrahymena thermophila
Q6C793 1.24e-21 100 25 13 382 1 YALI0E02684g 2-methylcitrate synthase, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
C7C435 2.66e-21 99 26 17 390 1 mcsA 2-methylcitrate synthase, mitochondrial Fusarium solani
P79024 2.99e-21 99 26 12 349 3 CIT Citrate synthase, mitochondrial Candida tropicalis
O80433 1.21e-20 97 24 12 348 2 CS Citrate synthase, mitochondrial Daucus carota
P00890 1.52e-20 97 25 13 384 1 CIT1 Citrate synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4QDX3 1.63e-20 97 27 17 361 3 LmjF18.0680 Probable citrate synthase, mitochondrial Leishmania major
P49298 9.9e-20 94 23 13 392 2 CIT Citrate synthase, mitochondrial Citrus maxima
Q9TEM3 1.05e-19 94 26 17 394 1 mcsA 2-methylcitrate synthase, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A4HXU4 2.75e-19 93 27 17 359 3 LinJ18.0690 Probable citrate synthase, mitochondrial Leishmania infantum
A0A0S3QTD0 1.27e-18 91 26 16 392 1 gltA Citrate synthase Thermosulfidibacter takaii (strain DSM 17441 / JCM 13301 / NBRC 103674 / ABI70S6)
Q0QEL7 1.9e-18 87 30 8 221 1 CS Citrate synthase, mitochondrial (Fragment) Mesocricetus auratus
P51044 1.91e-18 90 25 10 347 2 cit-1 Citrate synthase, mitochondrial Aspergillus niger
Q10306 2.48e-18 90 26 13 395 3 cit1 Probable citrate synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q50I20 7.41e-18 89 26 17 394 1 mcsA 2-methylcitrate synthase, mitochondrial Aspergillus fumigatus
B0YD89 7.41e-18 89 26 17 394 1 mcsA 2-methylcitrate synthase, mitochondrial Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
P20115 1.09e-17 88 23 11 348 1 CSY4 Citrate synthase 4, mitochondrial Arabidopsis thaliana
P83372 3.2e-17 87 27 10 263 1 MCSI Citrate synthase, mitochondrial Fragaria ananassa
Q43175 3.77e-17 86 27 9 268 2 None Citrate synthase, mitochondrial Solanum tuberosum
Q9M1D3 9.11e-17 85 23 15 393 1 CSY5 Citrate synthase 5, mitochondrial Arabidopsis thaliana
A4H9H8 2.19e-16 84 29 13 272 3 LbrM18_V2.0760 Probable citrate synthase, mitochondrial Leishmania braziliensis
P43635 7.14e-16 83 25 15 399 1 CIT3 Citrate synthase 3, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_12550
Feature type CDS
Gene gltA
Product citrate synthase
Location 66585 - 67880 (strand: 1)
Length 1296 (nucleotides) / 431 (amino acids)
In genomic island -

Contig

Accession ZDB_690
Length 144397 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1573
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00285 Citrate synthase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0372 Energy production and conversion (C) C Citrate synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MSNTKAELTLNGVRVTDLDILSPTLGQPVVDVRTLGGKGYYTFDPGFTSTASCESKITYIDGDEGILLHRGFPIEELAMKSDYLEVCYILLYGEAPDQKEYDEFKETVKRHTMIHEQITRLFNGFRRDSHPMAVLCGVTGALAAFYHDSLDVNNPRHREIAAYRLLSKMPTVAAMCYKYSVGQPFVYPKNNLSYAGNFLRMMFATPCEEYVVNPVLERAMDRILILHADHEQNASTSTVRTAGSSGANPFACIAAGIASLWGPAHGGANEACLRMLEEIQTVDHIPAFIERAKDKNDSFRLMGFGHRVYKNHDPRAKVMRETCHEVLNELGLNDSLLEVAMELERIALNDPYFIEKKLYPNVDFYSGIILKALGIPSNMFTVIFAIGRTIGWIAHWSEMHDDGLKIARPRQLYTGYTERPFETKVAKRCSS

Flanking regions ( +/- flanking 50bp)

TATCACAATAAGATTGAAAAACAAATAATAAATGCGCTAAGGAGACCTACATGTCTAATACAAAGGCGGAGCTGACACTAAACGGCGTCAGGGTTACTGATCTGGATATCCTGAGCCCGACTCTCGGCCAGCCCGTAGTTGATGTCCGGACGCTCGGCGGAAAAGGCTACTACACCTTTGATCCCGGCTTCACCTCCACTGCGTCCTGTGAATCAAAGATCACGTATATCGACGGTGATGAAGGTATCCTGTTACATCGCGGCTTCCCGATTGAAGAGCTGGCGATGAAATCTGATTATCTGGAAGTGTGCTATATCCTGCTGTATGGCGAAGCGCCTGATCAGAAAGAGTATGACGAATTTAAAGAAACCGTAAAACGCCACACCATGATCCACGAGCAGATCACCCGCTTATTCAACGGGTTCCGCCGTGACTCTCACCCGATGGCCGTGCTCTGCGGCGTGACCGGCGCACTGGCTGCGTTCTACCATGACTCGCTGGATGTGAACAATCCGCGCCACCGCGAAATTGCGGCCTACCGTCTGCTCTCCAAAATGCCGACCGTCGCGGCAATGTGTTACAAATATTCTGTCGGGCAGCCGTTTGTCTATCCGAAGAACAACCTTTCCTACGCCGGTAACTTCCTGCGTATGATGTTTGCCACCCCGTGTGAAGAGTATGTGGTTAATCCGGTGCTGGAACGTGCCATGGACAGAATCCTGATCCTGCACGCAGACCACGAACAAAACGCCTCCACTTCCACTGTCCGGACCGCCGGTTCCTCCGGTGCCAACCCGTTCGCCTGTATCGCAGCCGGTATTGCCTCCCTGTGGGGACCTGCTCACGGCGGCGCGAACGAAGCCTGCCTGCGTATGCTGGAAGAGATCCAGACCGTCGATCACATCCCGGCCTTTATTGAGCGCGCGAAAGATAAAAATGACTCTTTCCGTCTGATGGGCTTCGGCCACCGCGTGTACAAAAACCATGACCCGCGTGCCAAAGTGATGCGTGAAACCTGTCACGAAGTACTGAACGAACTGGGTCTGAATGACAGCCTGCTCGAAGTGGCGATGGAGCTGGAACGTATCGCACTGAACGACCCGTACTTCATCGAGAAGAAACTCTACCCGAACGTGGATTTCTACTCCGGTATCATCCTGAAAGCACTGGGTATTCCGTCAAATATGTTCACGGTGATCTTTGCCATCGGCCGCACCATCGGCTGGATCGCCCACTGGAGCGAAATGCACGACGACGGCCTGAAAATCGCCCGTCCGCGCCAGCTTTATACCGGTTACACTGAGCGTCCGTTTGAAACCAAAGTCGCCAAACGCTGTTCATCGTGACAATACCGTATTAATCCTTATAAAACCCTCTCCGGAGGGTTTTTTTATGC