Homologs in group_1875

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14005 FBDBKF_14005 79.6 Morganella morganii S1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
EHELCC_11680 EHELCC_11680 79.6 Morganella morganii S2 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
NLDBIP_12020 NLDBIP_12020 79.6 Morganella morganii S4 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
LHKJJB_11880 LHKJJB_11880 79.6 Morganella morganii S3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
HKOGLL_10495 HKOGLL_10495 79.6 Morganella morganii S5 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
F4V73_RS12860 F4V73_RS12860 80.0 Morganella psychrotolerans mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase

Distribution of the homologs in the orthogroup group_1875

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1875

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EUF0 5.95e-174 480 100 0 235 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Proteus mirabilis (strain HI4320)
Q7N841 2.81e-137 387 78 0 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6DC27 1.09e-131 373 79 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D1Z4 6.42e-130 369 77 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JJQ6 3.77e-124 354 77 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B2VE28 1.1e-122 350 74 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4TPX2 1.9e-122 350 75 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis (strain Pestoides F)
Q1CLU1 1.9e-122 350 75 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R1E0 1.9e-122 350 75 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis bv. Antiqua (strain Angola)
Q7CKD4 1.9e-122 350 75 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis
A8G9V3 5.05e-122 348 76 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Serratia proteamaculans (strain 568)
Q1C3X7 1.1e-121 348 75 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis bv. Antiqua (strain Antiqua)
B1JK17 3.55e-121 347 75 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EE6 3.55e-121 347 75 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K553 3.55e-121 347 75 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FM04 3.55e-121 347 75 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C5BAP4 3.72e-119 342 73 0 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Edwardsiella ictaluri (strain 93-146)
A7MGS5 7.16e-118 338 71 0 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Cronobacter sakazakii (strain ATCC BAA-894)
Q2NVP7 1.6e-114 330 68 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Sodalis glossinidius (strain morsitans)
A6T4W3 1.82e-113 327 68 0 229 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5Y1L0 4.51e-113 326 68 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Klebsiella pneumoniae (strain 342)
B7LWC0 3.19e-111 321 68 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A4W6Q6 1.72e-110 320 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Enterobacter sp. (strain 638)
P60217 1.8e-110 319 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P60216 1.8e-110 319 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella typhi
B5BL87 1.8e-110 319 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella paratyphi A (strain AKU_12601)
A9N0Q5 1.8e-110 319 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
C0Q5S0 1.82e-110 319 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella paratyphi C (strain RKS4594)
Q57T48 1.82e-110 319 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella choleraesuis (strain SC-B67)
B5FJ06 6.34e-110 318 69 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella dublin (strain CT_02021853)
B4TXR1 1.26e-109 317 69 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella schwarzengrund (strain CVM19633)
B5F8S1 1.26e-109 317 69 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella agona (strain SL483)
Q5PD46 1.29e-109 317 69 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SUY9 2.23e-109 317 69 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella newport (strain SL254)
B4TK35 2.23e-109 317 69 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella heidelberg (strain SL476)
B5RHE5 2.23e-109 317 69 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3H1 2.23e-109 317 69 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella enteritidis PT4 (strain P125109)
A9MPK2 2.41e-109 317 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8ALC9 7.95e-109 315 69 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A7MXP2 4.11e-106 308 63 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio campbellii (strain ATCC BAA-1116)
Q87SE5 1.53e-105 307 63 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q325Y0 1.97e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella boydii serotype 4 (strain Sb227)
Q6LUR4 2.3e-105 306 63 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Photobacterium profundum (strain SS9)
Q3Z5J8 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella sonnei (strain Ss046)
P0AF15 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella flexneri
Q0T847 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella flexneri serotype 5b (strain 8401)
Q32JU9 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella dysenteriae serotype 1 (strain Sd197)
B2U303 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RG29 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain UTI89 / UPEC)
B1LGW2 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain SMS-3-5 / SECEC)
B6HZD5 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain SE11)
B7N828 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AF12 4.19e-105 306 70 0 229 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain K12)
B1IQI1 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0AF13 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLH2 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7K5 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O1:K1 / APEC
B1XD29 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain K12 / DH10B)
C4ZRQ2 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M1A0 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O8 (strain IAI1)
B7MP21 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O81 (strain ED1a)
B7NIC2 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z0D9 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AF14 4.19e-105 306 70 0 229 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O157:H7
B7LGM1 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain 55989 / EAEC)
B7MBE2 4.19e-105 306 70 0 229 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UIK6 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZHQ1 4.19e-105 306 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q7MNT0 1.04e-104 305 63 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio vulnificus (strain YJ016)
A7ZWA7 3.82e-104 303 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O9:H4 (strain HS)
Q8DEM9 7.95e-104 303 62 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio vulnificus (strain CMCP6)
C4K6C1 1.28e-103 302 64 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
B5FAL1 6.76e-102 298 62 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aliivibrio fischeri (strain MJ11)
Q5E2X3 6.76e-102 298 62 1 231 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A1IGA8 1.19e-101 297 62 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aliivibrio fischeri
C3LQF1 1.38e-101 297 62 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio cholerae serotype O1 (strain M66-2)
Q9KPI8 1.38e-101 297 62 1 231 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5R2 1.38e-101 297 62 1 231 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B7VJ21 8.93e-101 295 61 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio atlanticus (strain LGP32)
Q0I5K4 2.94e-100 293 61 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Histophilus somni (strain 129Pt)
B0URX4 3.95e-100 293 61 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Histophilus somni (strain 2336)
B6EKZ7 1.57e-97 286 61 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aliivibrio salmonicida (strain LFI1238)
B8F704 3.19e-97 286 61 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Glaesserella parasuis serovar 5 (strain SH0165)
B0BRW3 5.01e-97 285 63 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2N4 2.45e-96 284 63 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2T5 2.45e-96 284 63 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q7VKK0 1.55e-93 276 58 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9CP62 1.21e-91 271 58 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Pasteurella multocida (strain Pm70)
P45113 1.31e-87 261 56 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QL83 2.1e-87 261 55 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus influenzae (strain 86-028NP)
A5UIX8 6.13e-87 259 55 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus influenzae (strain PittGG)
A4SP53 6.41e-87 259 55 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aeromonas salmonicida (strain A449)
A5UCP4 7.63e-87 259 55 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus influenzae (strain PittEE)
A0KIZ1 1.61e-85 256 53 1 230 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q65SB6 5.06e-85 255 58 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VPH1 5.77e-85 254 55 0 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C4LAP0 1.09e-83 251 55 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q3ILJ7 1.04e-82 249 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Pseudoalteromonas translucida (strain TAC 125)
B1YJD6 4.62e-82 248 54 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q5KWV9 3.48e-81 245 52 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Geobacillus kaustophilus (strain HTA426)
B7GIU7 4.15e-80 243 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A1STE7 3.37e-79 240 52 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A8FSA3 3.64e-79 240 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sediminis (strain HAW-EB3)
A4IR66 7.16e-79 239 51 1 235 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Geobacillus thermodenitrificans (strain NG80-2)
B0TIS5 1.42e-78 238 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella halifaxensis (strain HAW-EB4)
B9DNJ2 2.74e-78 238 49 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus carnosus (strain TM300)
C4L559 3.8e-78 238 52 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
O32028 5.33e-78 237 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus subtilis (strain 168)
A8H191 1.54e-77 236 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q31DQ5 2.3e-77 236 49 1 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A7GT52 2.62e-77 235 52 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q634H0 2.68e-77 235 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain ZK / E33L)
B7HQD2 2.68e-77 235 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain AH187)
C1ESR9 2.68e-77 235 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain 03BB102)
Q730G0 2.68e-77 235 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JP64 2.68e-77 235 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain AH820)
Q81LL4 2.68e-77 235 51 1 231 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus anthracis
A0RIY7 2.68e-77 235 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus thuringiensis (strain Al Hakam)
C3L5Y0 2.68e-77 235 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P964 2.68e-77 235 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus anthracis (strain A0248)
Q6HDF1 3.06e-77 235 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B1HUJ1 4.68e-77 234 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Lysinibacillus sphaericus (strain C3-41)
A9VHZ5 6.28e-77 234 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus mycoides (strain KBAB4)
B7IYM7 1.04e-76 234 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain G9842)
Q812S1 1.6e-76 233 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HE08 1.6e-76 233 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain B4264)
Q8CP08 2.54e-76 233 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNU8 2.54e-76 233 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1LTN6 4.43e-76 232 50 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q9KDD4 1.89e-75 231 47 0 228 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A1S3V6 2.08e-75 230 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q7A0R5 4.99e-75 229 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain MW2)
A8Z4D8 4.99e-75 229 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8W9 4.99e-75 229 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain MSSA476)
Q7A5B0 4.99e-75 229 48 0 227 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain N315)
Q99TQ0 4.99e-75 229 48 0 227 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHE1 4.99e-75 229 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain Newman)
Q5HFG2 4.99e-75 229 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain COL)
A5ITC6 4.99e-75 229 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain JH9)
Q2FXX8 4.99e-75 229 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGC5 4.99e-75 229 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain USA300)
A6U271 4.99e-75 229 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain JH1)
A7X306 4.99e-75 229 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain Mu3 / ATCC 700698)
C5D4X9 8.41e-75 229 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Geobacillus sp. (strain WCH70)
Q6GGA2 9.6e-75 229 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain MRSA252)
Q2YT29 9.81e-75 229 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A8FFL1 2.27e-74 228 52 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus pumilus (strain SAFR-032)
A7Z721 3.63e-74 227 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B1KI32 6.68e-74 227 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella woodyi (strain ATCC 51908 / MS32)
Q4L6V0 8.23e-74 226 47 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus haemolyticus (strain JCSC1435)
A0KZQ7 9.04e-74 226 49 1 234 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sp. (strain ANA-3)
Q12KE6 9.58e-74 226 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1RMF2 2.82e-73 225 50 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sp. (strain W3-18-1)
A4Y4H9 2.98e-73 225 50 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q0HG72 3.81e-73 225 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sp. (strain MR-4)
Q0HSG5 4.16e-73 225 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sp. (strain MR-7)
A3QBQ0 1.1e-72 224 48 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q1QVV7 1.85e-72 223 48 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A9L5L1 2.16e-72 223 49 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella baltica (strain OS195)
B8EBS7 2.16e-72 223 49 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella baltica (strain OS223)
Q5WHL7 2.47e-72 223 46 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shouchella clausii (strain KSM-K16)
Q07YV9 3.35e-72 222 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella frigidimarina (strain NCIMB 400)
Q8EHA7 3.41e-72 223 49 1 234 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A6WKN2 5.33e-72 222 49 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella baltica (strain OS185)
A3D1T1 7.47e-72 222 49 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q65GT9 1.85e-71 221 51 3 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q47UY5 1.95e-70 218 49 1 236 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8CQP2 2.18e-70 218 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q8EPT8 3.92e-70 217 42 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q6AQW7 5.3e-70 217 46 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q49Y40 8.06e-70 216 50 0 224 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
C1KVE1 6.94e-69 214 46 2 235 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q71ZH6 9.42e-69 214 46 2 235 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria monocytogenes serotype 4b (strain F2365)
B8DE17 1.33e-68 213 45 2 235 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria monocytogenes serotype 4a (strain HCC23)
A0AIU3 2.4e-68 213 46 2 235 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y729 6.83e-68 211 45 2 235 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92BL9 1.5e-67 211 45 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A6W3C9 2.85e-65 205 49 1 225 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Marinomonas sp. (strain MWYL1)
C6BU87 3.32e-62 197 44 2 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B8D7B4 5.74e-60 191 37 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D909 5.74e-60 191 37 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q89AQ7 7.13e-60 192 36 0 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P57306 7.54e-59 188 37 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O51931 1.29e-57 185 39 0 214 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P96122 3.35e-34 126 34 6 255 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Treponema pallidum (strain Nichols)
Q0PC20 7e-34 124 31 1 229 1 pfs Aminodeoxyfutalosine nucleosidase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
O24915 2.39e-30 115 31 2 229 1 mtnN Aminodeoxyfutalosine nucleosidase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZMY2 1.39e-29 113 30 2 229 1 mtnN Aminodeoxyfutalosine nucleosidase Helicobacter pylori (strain J99 / ATCC 700824)
P9WJM3 1.03e-23 98 28 4 239 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJM2 1.03e-23 98 28 4 239 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67657 1.03e-23 98 28 4 239 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9X0L3 5.41e-14 71 30 6 179 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P0DX75 1.56e-09 60 27 6 208 1 cap17 ATP nucleosidase Cap17 Escherichia coli
P0DX71 1.56e-09 60 27 6 208 1 cap17 ATP nucleosidase Cap17 Escherichia coli (strain KTE188)
P27711 8.68e-08 55 23 5 187 1 None Fibril protein Spiroplasma citri
P75053 2.74e-07 53 24 4 167 3 deoD Purine nucleoside phosphorylase DeoD-type Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
A0A1X7TVA9 4.57e-07 53 25 8 234 1 109585858 Death domain-containing ATP nucleosidase Amphimedon queenslandica
Q9T0I8 5.12e-07 52 25 7 199 1 MTN1 5'-methylthioadenosine nucleosidase Arabidopsis thaliana
Q9R4A1 5.3e-07 48 60 0 35 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase (Fragment) Klebsiella pneumoniae
B8D9W3 1.76e-06 50 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B8D865 1.81e-06 50 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57606 1.81e-06 50 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q7XA67 3.3e-06 50 26 7 186 1 MTN2 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Arabidopsis thaliana
B2G592 6.18e-06 49 26 4 165 3 deoD Purine nucleoside phosphorylase DeoD-type Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHR2 6.18e-06 49 26 4 165 3 deoD Purine nucleoside phosphorylase DeoD-type Limosilactobacillus reuteri (strain DSM 20016)
B7GKU4 2.79e-05 47 22 4 192 3 deoD Purine nucleoside phosphorylase DeoD-type Anoxybacillus flavithermus (strain DSM 21510 / WK1)
P77835 3.15e-05 47 22 4 192 1 deoD Purine nucleoside phosphorylase DeoD-type Geobacillus stearothermophilus
Q6LUH1 3.44e-05 47 24 6 212 3 deoD1 Purine nucleoside phosphorylase DeoD-type 1 Photobacterium profundum (strain SS9)
Q03Q52 4.88e-05 46 23 4 188 3 deoD Purine nucleoside phosphorylase DeoD-type Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q87M25 0.000102 45 21 5 207 3 deoD1 Purine nucleoside phosphorylase DeoD-type 1 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P47295 0.000113 45 24 4 167 3 deoD Purine nucleoside phosphorylase DeoD-type Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
A7Z5M8 0.000128 45 23 4 179 3 deoD Purine nucleoside phosphorylase DeoD-type Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A7MIG7 0.00019 45 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Cronobacter sakazakii (strain ATCC BAA-894)
Q65IE9 0.000257 44 22 4 179 3 deoD Purine nucleoside phosphorylase DeoD-type Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B5R9V2 0.000306 44 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9N7E3 0.000453 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5R2J9 0.000453 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella enteritidis PT4 (strain P125109)
B5FTC8 0.000453 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella dublin (strain CT_02021853)
Q57G38 0.000453 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella choleraesuis (strain SC-B67)
Q8ZJV7 0.00047 43 22 4 196 1 deoD Purine nucleoside phosphorylase DeoD-type Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TH02 0.00047 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella heidelberg (strain SL476)
Q8Z0U2 0.000488 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella typhi
B4TU44 0.000488 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella schwarzengrund (strain CVM19633)
B5BAK0 0.000488 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella paratyphi A (strain AKU_12601)
Q5PK20 0.000488 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T4H3 0.000488 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella newport (strain SL254)
B5F527 0.000488 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella agona (strain SL483)
A4W6A1 0.000495 43 23 5 198 3 deoD Purine nucleoside phosphorylase DeoD-type Enterobacter sp. (strain 638)
B2VH53 0.00054 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q9KPM0 0.000688 43 21 5 217 1 deoD1 Purine nucleoside phosphorylase DeoD-type 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B5Y274 0.000701 43 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Klebsiella pneumoniae (strain 342)
A9MRA4 0.000741 43 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8ALX7 0.000884 43 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q0I1K5 0.000896 43 19 4 200 3 deoD Purine nucleoside phosphorylase DeoD-type Histophilus somni (strain 129Pt)
Q5E7J4 0.001 42 20 5 216 3 deoD1 Purine nucleoside phosphorylase DeoD-type 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS01030
Feature type CDS
Gene mtnN
Product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
Location 253382 - 254089 (strand: -1)
Length 708 (nucleotides) / 235 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1875
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01048 Phosphorylase superfamily

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0775 Nucleotide transport and metabolism (F)
Coenzyme transport and metabolism (H)		 FH Nucleoside phosphorylase/nucleosidase, includes 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase MtnN and futalosine hydrolase MqnB

Kegg Ortholog Annotation(s)

Protein Sequence

MRVGVIGAMEQEVKLLREQIENCEIVSRGGCEIYTGKINGVDVALLKSGIGKVAAAIGTTLLLEHFRPDVVINTGSAGGLDAKLNVGDIVVSTEVRYHDADVTAFGYEPGQMAQCPPAFIADPKLVNIAQECIGSLKLNAVRGLICSGDAFINGAEPLARIRRTFPEVVAVEMESTAIGHVCHQFDTPFVVVRAISDVADKESHLSFDEFLSVAAQQSSLMVTTMLDKLKTETQF

Flanking regions ( +/- flanking 50bp)

AACTCTTGGTTAACGCTATATATTATTAACCTACAAGGGAGTATGACACAATGAGAGTTGGCGTAATAGGTGCAATGGAACAAGAAGTCAAACTTCTGCGTGAACAAATTGAAAACTGCGAAATAGTCTCTCGTGGTGGTTGTGAAATTTATACTGGCAAAATCAATGGTGTAGATGTTGCATTACTAAAATCAGGCATTGGTAAAGTGGCAGCCGCCATCGGTACCACACTATTACTTGAACATTTTCGCCCTGATGTTGTGATCAACACCGGCTCTGCAGGTGGGTTAGATGCAAAATTAAATGTTGGCGATATTGTCGTATCAACAGAAGTACGTTATCACGATGCCGACGTTACTGCTTTCGGTTATGAACCAGGACAAATGGCACAATGCCCGCCGGCATTTATTGCCGATCCCAAACTGGTCAATATTGCTCAAGAGTGTATTGGATCACTAAAATTAAATGCCGTGCGTGGATTAATCTGTAGTGGCGATGCTTTTATTAATGGTGCCGAGCCATTAGCACGTATTCGTCGTACTTTTCCAGAAGTCGTCGCTGTTGAGATGGAATCAACCGCTATTGGACATGTTTGCCATCAATTTGATACACCTTTTGTTGTTGTTCGTGCCATTTCAGATGTGGCAGATAAAGAATCGCATTTAAGTTTTGATGAGTTTTTATCTGTTGCCGCACAACAATCAAGCTTAATGGTCACTACTATGCTTGATAAATTAAAAACAGAGACTCAGTTTTAATTTATTTAATCGATAAGCCGCTTAACAAACCCGTCTCTCTTTTAGCTCAG