Homologs in group_1875

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14005 FBDBKF_14005 100.0 Morganella morganii S1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
EHELCC_11680 EHELCC_11680 100.0 Morganella morganii S2 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
LHKJJB_11880 LHKJJB_11880 100.0 Morganella morganii S3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
HKOGLL_10495 HKOGLL_10495 100.0 Morganella morganii S5 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
F4V73_RS12860 F4V73_RS12860 92.7 Morganella psychrotolerans mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
PMI_RS01030 PMI_RS01030 79.6 Proteus mirabilis HI4320 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase

Distribution of the homologs in the orthogroup group_1875

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1875

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N841 4.79e-135 382 78 0 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6DC27 3.14e-132 374 80 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B4EUF0 1.81e-131 372 78 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Proteus mirabilis (strain HI4320)
Q6D1Z4 4.7e-128 364 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VE28 1.9e-125 357 77 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B1JK17 1.37e-124 355 79 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EE6 1.37e-124 355 79 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K553 1.37e-124 355 79 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FM04 1.37e-124 355 79 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8G9V3 3.72e-124 354 80 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Serratia proteamaculans (strain 568)
A4TPX2 9.65e-124 353 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis (strain Pestoides F)
Q1CLU1 9.65e-124 353 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R1E0 9.65e-124 353 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis bv. Antiqua (strain Angola)
Q7CKD4 9.65e-124 353 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis
A1JJQ6 9.75e-124 353 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q1C3X7 3.48e-123 352 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis bv. Antiqua (strain Antiqua)
C5BAP4 2.38e-120 344 77 0 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Edwardsiella ictaluri (strain 93-146)
A7MGS5 1.07e-119 343 73 0 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Cronobacter sakazakii (strain ATCC BAA-894)
B5Y1L0 3.31e-117 337 71 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Klebsiella pneumoniae (strain 342)
A6T4W3 1.71e-116 335 71 0 229 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4W6Q6 1.59e-112 325 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Enterobacter sp. (strain 638)
Q2NVP7 1.98e-112 324 69 0 226 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Sodalis glossinidius (strain morsitans)
A8ALC9 5.53e-112 323 72 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C0Q5S0 1.56e-110 320 72 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella paratyphi C (strain RKS4594)
Q57T48 1.56e-110 320 72 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella choleraesuis (strain SC-B67)
A9MPK2 1.88e-110 319 72 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P60217 2.17e-110 319 72 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P60216 2.17e-110 319 72 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella typhi
B5BL87 2.17e-110 319 72 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella paratyphi A (strain AKU_12601)
A9N0Q5 2.17e-110 319 72 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SUY9 1.73e-109 317 71 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella newport (strain SL254)
B4TK35 1.73e-109 317 71 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella heidelberg (strain SL476)
B5RHE5 1.73e-109 317 71 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3H1 1.73e-109 317 71 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella enteritidis PT4 (strain P125109)
B4TXR1 1.75e-109 317 71 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella schwarzengrund (strain CVM19633)
B5F8S1 1.75e-109 317 71 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella agona (strain SL483)
Q5PD46 2.09e-109 317 71 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7LWC0 6.11e-109 315 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5FJ06 2.04e-108 314 71 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella dublin (strain CT_02021853)
Q3Z5J8 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella sonnei (strain Ss046)
P0AF15 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella flexneri
Q0T847 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella flexneri serotype 5b (strain 8401)
Q32JU9 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella dysenteriae serotype 1 (strain Sd197)
B2U303 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RG29 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain UTI89 / UPEC)
B1LGW2 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain SMS-3-5 / SECEC)
B6HZD5 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain SE11)
B7N828 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AF12 1.07e-105 307 73 0 229 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain K12)
B1IQI1 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0AF13 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLH2 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7K5 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O1:K1 / APEC
B1XD29 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain K12 / DH10B)
C4ZRQ2 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M1A0 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O8 (strain IAI1)
B7MP21 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O81 (strain ED1a)
B7NIC2 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z0D9 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AF14 1.07e-105 307 73 0 229 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O157:H7
B7LGM1 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain 55989 / EAEC)
B7MBE2 1.07e-105 307 73 0 229 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UIK6 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZHQ1 1.07e-105 307 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O139:H28 (strain E24377A / ETEC)
A7ZWA7 1.1e-104 305 72 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O9:H4 (strain HS)
Q325Y0 3.24e-104 303 72 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella boydii serotype 4 (strain Sb227)
Q7MNT0 7.44e-104 303 65 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio vulnificus (strain YJ016)
Q8DEM9 4.48e-103 301 65 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio vulnificus (strain CMCP6)
Q87SE5 7.25e-103 300 65 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MXP2 5.67e-102 298 65 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio campbellii (strain ATCC BAA-1116)
Q6LUR4 3.13e-101 296 63 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Photobacterium profundum (strain SS9)
B0BRW3 4.85e-99 290 65 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B8F704 2.29e-98 288 62 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Glaesserella parasuis serovar 5 (strain SH0165)
B0URX4 4.75e-98 288 60 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Histophilus somni (strain 2336)
C3LQF1 5.49e-98 288 63 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio cholerae serotype O1 (strain M66-2)
Q9KPI8 5.49e-98 288 63 1 227 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5R2 5.49e-98 288 63 1 227 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B3H2N4 6.41e-98 288 65 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2T5 6.41e-98 288 65 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q7VKK0 7.47e-98 287 61 0 228 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q0I5K4 8.68e-98 287 60 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Histophilus somni (strain 129Pt)
B7VJ21 9.49e-98 287 62 1 228 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio atlanticus (strain LGP32)
C4K6C1 1.28e-97 287 63 0 226 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A1IGA8 1.61e-96 284 63 1 223 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aliivibrio fischeri
B5FAL1 1.96e-96 284 63 1 223 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aliivibrio fischeri (strain MJ11)
Q5E2X3 1.96e-96 284 63 1 223 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B6EKZ7 7.97e-96 282 62 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aliivibrio salmonicida (strain LFI1238)
Q9CP62 1.5e-95 281 60 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Pasteurella multocida (strain Pm70)
A6VPH1 8.88e-91 270 59 0 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
P45113 1.09e-90 269 58 1 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UCP4 1.71e-90 269 57 0 226 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus influenzae (strain PittEE)
Q4QL83 1.89e-90 268 57 1 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus influenzae (strain 86-028NP)
A5UIX8 3.64e-90 268 57 1 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus influenzae (strain PittGG)
Q65SB6 1.42e-88 264 61 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A0KIZ1 6.58e-86 257 55 1 230 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SP53 9.77e-85 254 54 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aeromonas salmonicida (strain A449)
A1STE7 3.93e-82 248 54 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
C4LAP0 2.09e-80 243 54 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B1YJD6 4.69e-78 237 53 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
C4L559 1.15e-77 236 52 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q31DQ5 2.49e-77 235 50 1 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q634H0 5.23e-77 234 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain ZK / E33L)
B7HQD2 5.23e-77 234 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain AH187)
C1ESR9 5.23e-77 234 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain 03BB102)
Q730G0 5.23e-77 234 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JP64 5.23e-77 234 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain AH820)
Q81LL4 5.23e-77 234 53 1 230 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus anthracis
A0RIY7 5.23e-77 234 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus thuringiensis (strain Al Hakam)
C3L5Y0 5.23e-77 234 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P964 5.23e-77 234 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus anthracis (strain A0248)
Q6HDF1 5.52e-77 234 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus thuringiensis subsp. konkukian (strain 97-27)
O32028 1.46e-76 233 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus subtilis (strain 168)
B0TIS5 1.59e-76 233 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella halifaxensis (strain HAW-EB4)
B7IYM7 1.63e-76 233 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain G9842)
B7GIU7 5.28e-76 232 51 2 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q812S1 1.68e-75 231 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HE08 1.68e-75 231 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain B4264)
A9VHZ5 1.77e-75 231 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus mycoides (strain KBAB4)
A8FSA3 1.79e-75 231 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sediminis (strain HAW-EB3)
Q3ILJ7 2.35e-75 230 50 1 234 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Pseudoalteromonas translucida (strain TAC 125)
Q12KE6 2.41e-75 230 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A4IR66 1.04e-74 229 50 1 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Geobacillus thermodenitrificans (strain NG80-2)
Q1LTN6 1.54e-74 228 49 0 226 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Baumannia cicadellinicola subsp. Homalodisca coagulata
A3QBQ0 1.81e-74 228 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8H191 1.89e-74 228 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B1HUJ1 5.63e-74 227 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Lysinibacillus sphaericus (strain C3-41)
A7Z721 3.37e-73 225 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B9DNJ2 4.78e-73 224 45 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus carnosus (strain TM300)
Q5KWV9 8.04e-73 224 50 1 228 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Geobacillus kaustophilus (strain HTA426)
A7GT52 1.18e-72 223 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A0KZQ7 3.73e-72 222 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sp. (strain ANA-3)
Q7A0R5 4.1e-72 222 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain MW2)
A8Z4D8 4.1e-72 222 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8W9 4.1e-72 222 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain MSSA476)
Q7A5B0 4.1e-72 222 48 0 227 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain N315)
Q99TQ0 4.1e-72 222 48 0 227 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHE1 4.1e-72 222 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain Newman)
Q5HFG2 4.1e-72 222 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain COL)
A5ITC6 4.1e-72 222 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain JH9)
Q2FXX8 4.1e-72 222 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGC5 4.1e-72 222 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain USA300)
A6U271 4.1e-72 222 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain JH1)
A7X306 4.1e-72 222 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q0HG72 5.12e-72 222 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sp. (strain MR-4)
A1S3V6 6.54e-72 221 50 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q6GGA2 7.96e-72 221 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain MRSA252)
Q2YT29 8.88e-72 221 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain bovine RF122 / ET3-1)
B1KI32 8.97e-72 221 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella woodyi (strain ATCC 51908 / MS32)
C5D4X9 1.08e-71 221 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Geobacillus sp. (strain WCH70)
Q0HSG5 1.61e-71 221 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sp. (strain MR-7)
A9L5L1 3.03e-71 220 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella baltica (strain OS195)
B8EBS7 3.03e-71 220 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella baltica (strain OS223)
Q8CP08 3.36e-71 219 47 0 221 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNU8 3.36e-71 219 47 0 221 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A1RMF2 3.82e-71 219 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sp. (strain W3-18-1)
A4Y4H9 4.35e-71 219 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WKN2 6.21e-71 219 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella baltica (strain OS185)
Q4L6V0 7.61e-71 219 46 0 224 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus haemolyticus (strain JCSC1435)
A3D1T1 8.25e-71 219 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q5WHL7 7.99e-70 216 45 0 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shouchella clausii (strain KSM-K16)
Q8EHA7 1.48e-69 216 50 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9KDD4 2.83e-69 215 46 0 228 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q65GT9 4.72e-69 214 51 3 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q47UY5 5.2e-69 214 49 2 235 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8CQP2 5.94e-69 214 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q1QVV7 6.96e-69 214 49 1 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A8FFL1 9.37e-69 213 51 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus pumilus (strain SAFR-032)
Q07YV9 1.93e-68 213 49 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella frigidimarina (strain NCIMB 400)
C1KVE1 1.94e-68 213 46 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8Y729 3e-68 212 46 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DE17 3.53e-68 212 45 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria monocytogenes serotype 4a (strain HCC23)
A0AIU3 3.57e-68 212 46 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q71ZH6 5.83e-68 211 45 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria monocytogenes serotype 4b (strain F2365)
Q6AQW7 1.12e-67 211 46 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q8EPT8 1.31e-67 211 42 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q92BL9 1.62e-67 210 45 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q49Y40 4.67e-64 201 47 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A6W3C9 1.9e-62 197 47 1 225 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Marinomonas sp. (strain MWYL1)
C6BU87 1.69e-61 195 45 2 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B8D7B4 8.83e-59 188 38 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D909 8.83e-59 188 38 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57306 2.98e-58 187 38 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AQ7 4.73e-58 187 38 0 225 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O51931 2.08e-55 179 37 0 214 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q0PC20 1.86e-31 118 31 1 222 1 pfs Aminodeoxyfutalosine nucleosidase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P96122 4.2e-30 115 33 6 258 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Treponema pallidum (strain Nichols)
Q9ZMY2 1.13e-28 110 33 4 220 1 mtnN Aminodeoxyfutalosine nucleosidase Helicobacter pylori (strain J99 / ATCC 700824)
O24915 4.81e-27 106 31 2 219 1 mtnN Aminodeoxyfutalosine nucleosidase Helicobacter pylori (strain ATCC 700392 / 26695)
P9WJM3 2.9e-20 89 27 4 241 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJM2 2.9e-20 89 27 4 241 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67657 2.9e-20 89 27 4 241 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9X0L3 2.2e-12 67 29 6 179 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9R4A1 1.15e-09 55 74 0 35 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase (Fragment) Klebsiella pneumoniae
P0DX75 3.12e-09 60 27 5 204 1 cap17 ATP nucleosidase Cap17 Escherichia coli
P0DX71 3.12e-09 60 27 5 204 1 cap17 ATP nucleosidase Cap17 Escherichia coli (strain KTE188)
P50389 3.68e-07 52 28 8 171 1 SSO2706 Purine nucleoside phosphorylase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9T0I8 6.26e-07 52 27 5 174 1 MTN1 5'-methylthioadenosine nucleosidase Arabidopsis thaliana
C4LAY8 2.6e-06 50 24 3 185 3 deoD Purine nucleoside phosphorylase DeoD-type Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B8D865 2.98e-06 50 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57606 2.98e-06 50 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9W3 3.31e-06 50 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P27711 3.91e-06 50 22 6 201 1 None Fibril protein Spiroplasma citri
Q7XA67 4.04e-06 50 27 6 175 1 MTN2 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Arabidopsis thaliana
Q03Q52 7.97e-06 48 25 3 165 3 deoD Purine nucleoside phosphorylase DeoD-type Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P47295 1.05e-05 48 26 2 149 3 deoD Purine nucleoside phosphorylase DeoD-type Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
B2G592 2.16e-05 47 25 4 165 3 deoD Purine nucleoside phosphorylase DeoD-type Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHR2 2.16e-05 47 25 4 165 3 deoD Purine nucleoside phosphorylase DeoD-type Limosilactobacillus reuteri (strain DSM 20016)
Q3YU09 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Shigella sonnei (strain Ss046)
Q31SV5 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Shigella boydii serotype 4 (strain Sb227)
B2TZR7 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LNS4 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LEI9 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli (strain SMS-3-5 / SECEC)
B6I6N1 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli (strain SE11)
B7NH52 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ABP8 4.45e-05 47 21 4 196 1 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli (strain K12)
A8A8B3 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli O9:H4 (strain HS)
B1XFJ4 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli (strain K12 / DH10B)
C4ZT66 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli (strain K12 / MC4100 / BW2952)
B7LXU6 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli O8 (strain IAI1)
B5Z4R6 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABP9 4.45e-05 47 21 4 196 1 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli O157:H7
B7LEN0 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli (strain 55989 / EAEC)
B7MNJ1 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZVS7 4.45e-05 47 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli O139:H28 (strain E24377A / ETEC)
Q327L2 5.79e-05 46 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Shigella dysenteriae serotype 1 (strain Sd197)
Q83P00 6.3e-05 46 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Shigella flexneri
Q0SX27 6.3e-05 46 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Shigella flexneri serotype 5b (strain 8401)
B1IS35 6.3e-05 46 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FA51 6.3e-05 46 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0T8S9 6.3e-05 46 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N2V8 6.3e-05 46 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli O81 (strain ED1a)
B7NW64 6.3e-05 46 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UR12 6.3e-05 46 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P75053 6.33e-05 46 24 2 149 3 deoD Purine nucleoside phosphorylase DeoD-type Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
B0K6Y4 0.000108 45 24 4 173 3 deoD Purine nucleoside phosphorylase DeoD-type Thermoanaerobacter sp. (strain X514)
B0K889 0.000108 45 24 4 173 3 deoD Purine nucleoside phosphorylase DeoD-type Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q5DYV8 0.000188 45 23 5 188 1 deoD3 Purine nucleoside phosphorylase DeoD-type Aliivibrio fischeri (strain ATCC 700601 / ES114)
A2RF09 0.000362 43 24 3 164 3 deoD Purine nucleoside phosphorylase DeoD-type Streptococcus pyogenes serotype M5 (strain Manfredo)
B9DUK0 0.000615 43 25 3 164 3 deoD Purine nucleoside phosphorylase DeoD-type Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B5Y274 0.000821 43 21 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Klebsiella pneumoniae (strain 342)
Q483Q8 0.001 42 27 4 166 3 deoD Purine nucleoside phosphorylase DeoD-type Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q7NRT2 0.001 42 24 3 185 3 deoD Purine nucleoside phosphorylase DeoD-type Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_12020
Feature type CDS
Gene mtnN
Product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
Location 184166 - 184867 (strand: 1)
Length 702 (nucleotides) / 233 (amino acids)

Contig

Accession ZDB_526
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1875
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01048 Phosphorylase superfamily

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0775 Nucleotide transport and metabolism (F)
Coenzyme transport and metabolism (H)
FH Nucleoside phosphorylase/nucleosidase, includes 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase MtnN and futalosine hydrolase MqnB

Kegg Ortholog Annotation(s)

Protein Sequence

MKVGIIGAMEQEVTLLRDQITNMQTLRHGGCEIYTGQINGVDVALLKSGIGKVAAAIGTTLLLELCKPDVVINTGSAGGLAPHLNVGDIVVSSEVRYHDADVTAFGYEPGQMAQCPPAFIADAGLIALTEKCIQTLGLNAVRGLICSGDAFINGAEPLARIRATFPSVIAVEMECAAVGHVCHQYQVPFVVVRAISDVADKASHLSFDEFLPLAAKQSSLMVAEILANIDSLK

Flanking regions ( +/- flanking 50bp)

TGCTAATCCGTTAATATGCAGTTCAATTTCTATTCAGGGAGTATGACATAATGAAAGTCGGTATCATAGGTGCGATGGAGCAGGAAGTAACCCTGCTGCGTGATCAGATTACCAACATGCAGACCCTCCGCCACGGCGGCTGCGAAATCTATACCGGTCAGATTAACGGTGTTGATGTTGCATTGCTCAAATCCGGTATCGGCAAAGTCGCCGCAGCGATCGGTACCACTCTGCTGCTGGAGCTGTGCAAACCGGACGTGGTGATTAATACCGGTTCTGCCGGTGGCCTCGCCCCGCATCTGAATGTCGGCGATATTGTTGTCTCCTCGGAAGTCCGTTATCACGATGCGGATGTTACTGCCTTCGGTTATGAACCGGGCCAGATGGCACAATGCCCGCCGGCCTTTATTGCTGATGCCGGTCTTATCGCACTGACTGAAAAATGCATTCAGACCCTCGGACTGAACGCCGTGCGCGGCCTGATTTGCAGCGGTGATGCCTTTATCAACGGCGCAGAGCCGCTGGCGCGTATCCGTGCCACCTTCCCGTCAGTAATAGCCGTGGAAATGGAATGTGCGGCTGTCGGCCATGTGTGCCATCAGTATCAGGTACCGTTTGTGGTGGTCCGCGCTATCTCTGACGTGGCGGATAAAGCCTCGCACCTCAGCTTTGATGAGTTTCTGCCGCTGGCAGCAAAGCAATCATCTCTGATGGTGGCGGAAATCCTCGCCAATATTGATTCACTGAAATGATAAAATCGTCATTGCGCCTCGCCGGACTACTGCTTCTGCTGGCAGCCTGC