Homologs in group_1875

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14005 FBDBKF_14005 92.7 Morganella morganii S1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
EHELCC_11680 EHELCC_11680 92.7 Morganella morganii S2 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
NLDBIP_12020 NLDBIP_12020 92.7 Morganella morganii S4 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
LHKJJB_11880 LHKJJB_11880 92.7 Morganella morganii S3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
HKOGLL_10495 HKOGLL_10495 92.7 Morganella morganii S5 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
PMI_RS01030 PMI_RS01030 80.0 Proteus mirabilis HI4320 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase

Distribution of the homologs in the orthogroup group_1875

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1875

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EUF0 1.14e-133 378 79 0 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Proteus mirabilis (strain HI4320)
Q7N841 2.35e-132 375 77 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6DC27 1.49e-128 365 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D1Z4 1.16e-126 360 77 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1JK17 1.71e-125 357 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EE6 1.71e-125 357 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K553 1.71e-125 357 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FM04 1.71e-125 357 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JJQ6 5.06e-125 356 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A4TPX2 1.28e-124 355 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis (strain Pestoides F)
Q1CLU1 1.28e-124 355 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R1E0 1.28e-124 355 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis bv. Antiqua (strain Angola)
Q7CKD4 1.28e-124 355 78 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis
B2VE28 3.55e-124 354 75 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q1C3X7 5.83e-124 353 77 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Yersinia pestis bv. Antiqua (strain Antiqua)
A8G9V3 1.2e-122 350 77 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Serratia proteamaculans (strain 568)
A7MGS5 4.27e-118 338 72 0 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Cronobacter sakazakii (strain ATCC BAA-894)
A6T4W3 3.35e-117 336 70 0 229 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C5BAP4 4.26e-117 336 76 0 226 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Edwardsiella ictaluri (strain 93-146)
B5Y1L0 3.73e-116 334 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Klebsiella pneumoniae (strain 342)
B4TXR1 1.99e-114 329 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella schwarzengrund (strain CVM19633)
B5F8S1 1.99e-114 329 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella agona (strain SL483)
A9MPK2 4.32e-114 328 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4SUY9 1.07e-113 327 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella newport (strain SL254)
B4TK35 1.07e-113 327 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella heidelberg (strain SL476)
B5RHE5 1.07e-113 327 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3H1 1.07e-113 327 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella enteritidis PT4 (strain P125109)
C0Q5S0 1.11e-113 327 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella paratyphi C (strain RKS4594)
Q57T48 1.11e-113 327 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella choleraesuis (strain SC-B67)
P60217 1.32e-113 327 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P60216 1.32e-113 327 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella typhi
B5BL87 1.32e-113 327 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella paratyphi A (strain AKU_12601)
A9N0Q5 1.32e-113 327 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5FJ06 3.58e-113 326 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella dublin (strain CT_02021853)
A4W6Q6 4.76e-113 326 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Enterobacter sp. (strain 638)
A8ALC9 9.8e-113 325 72 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q5PD46 1.05e-112 325 72 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7LWC0 1.52e-109 317 70 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q2NVP7 1.54e-109 317 67 0 226 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Sodalis glossinidius (strain morsitans)
Q3Z5J8 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella sonnei (strain Ss046)
P0AF15 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella flexneri
Q0T847 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella flexneri serotype 5b (strain 8401)
Q32JU9 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella dysenteriae serotype 1 (strain Sd197)
B2U303 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RG29 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain UTI89 / UPEC)
B1LGW2 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain SMS-3-5 / SECEC)
B6HZD5 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain SE11)
B7N828 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AF12 9.74e-108 312 73 0 229 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain K12)
B1IQI1 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0AF13 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLH2 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7K5 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O1:K1 / APEC
B1XD29 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain K12 / DH10B)
C4ZRQ2 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M1A0 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O8 (strain IAI1)
B7MP21 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O81 (strain ED1a)
B7NIC2 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z0D9 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AF14 9.74e-108 312 73 0 229 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O157:H7
B7LGM1 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli (strain 55989 / EAEC)
B7MBE2 9.74e-108 312 73 0 229 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UIK6 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZHQ1 9.74e-108 312 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O139:H28 (strain E24377A / ETEC)
A7ZWA7 5.86e-107 310 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Escherichia coli O9:H4 (strain HS)
Q325Y0 2.41e-106 309 73 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shigella boydii serotype 4 (strain Sb227)
Q8DEM9 8.33e-105 305 66 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio vulnificus (strain CMCP6)
Q87SE5 2.38e-104 304 66 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MNT0 6.24e-104 303 65 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio vulnificus (strain YJ016)
A7MXP2 8.58e-104 302 66 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio campbellii (strain ATCC BAA-1116)
Q6LUR4 4.09e-102 298 63 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Photobacterium profundum (strain SS9)
Q0I5K4 4.35e-102 298 62 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Histophilus somni (strain 129Pt)
B0URX4 8.95e-102 297 62 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Histophilus somni (strain 2336)
Q7VKK0 3.98e-101 296 64 0 228 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0BRW3 1.8e-100 294 66 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2N4 7.07e-100 293 65 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2T5 7.07e-100 293 65 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q9CP62 2.86e-99 291 62 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Pasteurella multocida (strain Pm70)
A1IGA8 8.84e-99 290 64 1 223 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aliivibrio fischeri
B8F704 1.14e-98 289 62 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Glaesserella parasuis serovar 5 (strain SH0165)
B5FAL1 1.18e-98 289 64 1 223 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aliivibrio fischeri (strain MJ11)
Q5E2X3 1.18e-98 289 64 1 223 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B7VJ21 4e-98 288 62 1 228 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio atlanticus (strain LGP32)
C3LQF1 1e-97 287 62 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio cholerae serotype O1 (strain M66-2)
Q9KPI8 1e-97 287 62 1 227 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5R2 1e-97 287 62 1 227 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B6EKZ7 3.77e-97 286 62 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aliivibrio salmonicida (strain LFI1238)
C4K6C1 4.77e-97 285 64 0 226 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
P45113 1.08e-93 277 59 1 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UCP4 1.39e-93 276 59 0 226 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus influenzae (strain PittEE)
Q4QL83 2.51e-93 276 59 1 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus influenzae (strain 86-028NP)
A5UIX8 6.77e-93 275 59 1 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Haemophilus influenzae (strain PittGG)
A6VPH1 2.24e-91 271 59 0 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q65SB6 6.17e-89 265 61 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A0KIZ1 2.36e-86 258 54 1 230 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A1STE7 1.09e-85 256 57 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A4SP53 1.61e-85 256 54 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Aeromonas salmonicida (strain A449)
C4LAP0 2.31e-78 238 53 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
C4L559 7.1e-78 237 52 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
B1YJD6 9.64e-78 236 53 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q634H0 2.87e-77 235 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain ZK / E33L)
B7HQD2 2.87e-77 235 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain AH187)
C1ESR9 2.87e-77 235 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain 03BB102)
Q730G0 2.87e-77 235 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JP64 2.87e-77 235 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain AH820)
Q81LL4 2.87e-77 235 52 1 230 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus anthracis
A0RIY7 2.87e-77 235 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus thuringiensis (strain Al Hakam)
C3L5Y0 2.87e-77 235 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P964 2.87e-77 235 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus anthracis (strain A0248)
Q6HDF1 3.42e-77 235 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B0TIS5 5.01e-77 234 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella halifaxensis (strain HAW-EB4)
B9DNJ2 5.71e-77 234 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus carnosus (strain TM300)
O32028 8.74e-77 234 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus subtilis (strain 168)
B7IYM7 1.21e-76 234 52 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain G9842)
B1HUJ1 1.94e-76 233 54 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Lysinibacillus sphaericus (strain C3-41)
B7GIU7 6.43e-76 232 52 2 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A9VHZ5 1.02e-75 231 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus mycoides (strain KBAB4)
A7GT52 1.02e-75 231 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q7A0R5 1.17e-75 231 50 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain MW2)
A8Z4D8 1.17e-75 231 50 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8W9 1.17e-75 231 50 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain MSSA476)
Q7A5B0 1.17e-75 231 50 0 227 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain N315)
Q99TQ0 1.17e-75 231 50 0 227 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHE1 1.17e-75 231 50 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain Newman)
Q5HFG2 1.17e-75 231 50 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain COL)
A5ITC6 1.17e-75 231 50 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain JH9)
Q2FXX8 1.17e-75 231 50 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGC5 1.17e-75 231 50 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain USA300)
A6U271 1.17e-75 231 50 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain JH1)
A7X306 1.17e-75 231 50 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q812S1 1.38e-75 231 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HE08 1.38e-75 231 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus cereus (strain B4264)
A8FSA3 2.09e-75 230 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sediminis (strain HAW-EB3)
Q6GGA2 2.26e-75 230 50 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain MRSA252)
Q2YT29 2.46e-75 230 50 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q1LTN6 3.16e-75 230 50 0 226 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Baumannia cicadellinicola subsp. Homalodisca coagulata
A8H191 6.29e-75 229 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q12KE6 6.64e-75 229 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q31DQ5 1.05e-74 229 49 1 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q3ILJ7 1.85e-74 228 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Pseudoalteromonas translucida (strain TAC 125)
A3QBQ0 2.57e-74 228 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A4IR66 1.47e-73 226 48 1 232 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Geobacillus thermodenitrificans (strain NG80-2)
Q5KWV9 7.05e-73 224 48 1 234 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Geobacillus kaustophilus (strain HTA426)
Q8CP08 9.71e-73 223 48 0 221 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNU8 9.71e-73 223 48 0 221 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
C5D4X9 1.82e-72 223 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Geobacillus sp. (strain WCH70)
Q0HG72 3.21e-72 223 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sp. (strain MR-4)
Q4L6V0 3.96e-72 222 48 0 224 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus haemolyticus (strain JCSC1435)
A0KZQ7 5.84e-72 222 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sp. (strain ANA-3)
Q0HSG5 9.64e-72 221 50 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sp. (strain MR-7)
A7Z721 1.16e-71 221 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A9L5L1 1.32e-71 221 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella baltica (strain OS195)
B8EBS7 1.32e-71 221 51 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella baltica (strain OS223)
A1RMF2 1.99e-71 220 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella sp. (strain W3-18-1)
A4Y4H9 1.99e-71 220 51 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B1KI32 3.35e-71 220 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella woodyi (strain ATCC 51908 / MS32)
A6WKN2 3.76e-71 220 50 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella baltica (strain OS185)
A3D1T1 4.58e-71 219 50 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q65GT9 4.7e-71 219 51 3 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A1S3V6 7.59e-71 219 49 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q9KDD4 7.93e-71 219 47 0 228 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A8FFL1 2.75e-70 218 51 1 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Bacillus pumilus (strain SAFR-032)
Q8EPT8 3.2e-70 217 44 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8Y729 3.76e-70 217 47 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
C1KVE1 4.53e-70 217 47 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria monocytogenes serotype 4b (strain CLIP80459)
A0AIU3 6.01e-70 217 47 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B8DE17 8.24e-70 216 46 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZH6 1.13e-69 216 46 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria monocytogenes serotype 4b (strain F2365)
Q07YV9 1.15e-69 216 49 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella frigidimarina (strain NCIMB 400)
Q47UY5 1.38e-69 216 48 2 235 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q8EHA7 1.9e-69 215 49 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B8CQP2 6.34e-69 214 50 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q92BL9 7.44e-69 214 46 1 233 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q6AQW7 3.89e-68 212 46 1 230 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q1QVV7 7.56e-68 211 48 1 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q49Y40 1.42e-67 210 48 0 227 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5WHL7 1.47e-67 211 45 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Shouchella clausii (strain KSM-K16)
A6W3C9 3.4e-63 199 47 1 225 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Marinomonas sp. (strain MWYL1)
C6BU87 1.94e-62 197 44 2 231 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B8D7B4 9.1e-61 193 40 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D909 9.1e-61 193 40 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57306 3.54e-60 192 40 0 229 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AQ7 3.65e-59 190 40 0 225 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O51931 2.88e-54 177 38 0 214 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P96122 1.47e-30 117 33 7 258 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Treponema pallidum (strain Nichols)
Q9ZMY2 2.74e-29 112 32 4 220 1 mtnN Aminodeoxyfutalosine nucleosidase Helicobacter pylori (strain J99 / ATCC 700824)
Q0PC20 1.04e-28 110 30 1 225 1 pfs Aminodeoxyfutalosine nucleosidase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
O24915 2.02e-27 107 29 2 219 1 mtnN Aminodeoxyfutalosine nucleosidase Helicobacter pylori (strain ATCC 700392 / 26695)
P9WJM3 1.86e-19 87 28 5 239 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJM2 1.86e-19 87 28 5 239 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67657 1.86e-19 87 28 5 239 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9X0L3 4.47e-13 69 28 6 212 3 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9R4A1 1.63e-09 55 74 0 35 1 mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase (Fragment) Klebsiella pneumoniae
P0DX75 1.8e-08 57 26 6 224 1 cap17 ATP nucleosidase Cap17 Escherichia coli
P0DX71 1.8e-08 57 26 6 224 1 cap17 ATP nucleosidase Cap17 Escherichia coli (strain KTE188)
Q9T0I8 3.29e-07 53 26 5 174 1 MTN1 5'-methylthioadenosine nucleosidase Arabidopsis thaliana
P27711 4.33e-06 50 23 6 201 1 None Fibril protein Spiroplasma citri
Q7XA67 2.39e-05 47 25 6 178 1 MTN2 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase Arabidopsis thaliana
B8D9W3 2.68e-05 47 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B8D865 2.7e-05 47 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57606 2.7e-05 47 22 4 196 3 deoD Purine nucleoside phosphorylase DeoD-type Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5DYV8 2.97e-05 47 21 3 185 1 deoD3 Purine nucleoside phosphorylase DeoD-type Aliivibrio fischeri (strain ATCC 700601 / ES114)
P47295 4.19e-05 47 25 2 149 3 deoD Purine nucleoside phosphorylase DeoD-type Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P75053 8.3e-05 45 24 2 149 3 deoD Purine nucleoside phosphorylase DeoD-type Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8EKK0 8.45e-05 45 22 5 207 3 deoD1 Purine nucleoside phosphorylase DeoD-type 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
C4LAY8 0.000202 44 24 3 185 3 deoD Purine nucleoside phosphorylase DeoD-type Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q6LUH1 0.000386 43 22 6 210 3 deoD1 Purine nucleoside phosphorylase DeoD-type 1 Photobacterium profundum (strain SS9)
Q0I1K5 0.000442 43 20 5 220 3 deoD Purine nucleoside phosphorylase DeoD-type Histophilus somni (strain 129Pt)
A1S477 0.000532 43 23 3 176 3 deoD Purine nucleoside phosphorylase DeoD-type Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q87M25 0.000587 43 23 3 176 3 deoD1 Purine nucleoside phosphorylase DeoD-type 1 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P50389 0.000717 43 28 8 167 1 SSO2706 Purine nucleoside phosphorylase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q03Q52 0.001 42 24 3 164 3 deoD Purine nucleoside phosphorylase DeoD-type Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS12860
Feature type CDS
Gene mtnN
Product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
Location 176973 - 177674 (strand: 1)
Length 702 (nucleotides) / 233 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1875
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01048 Phosphorylase superfamily

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0775 Nucleotide transport and metabolism (F)
Coenzyme transport and metabolism (H)		 FH Nucleoside phosphorylase/nucleosidase, includes 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase MtnN and futalosine hydrolase MqnB

Kegg Ortholog Annotation(s)

Protein Sequence

MKVGIIGAMEQEVTLLRDQITNMQTLSHGGCEIYTGQINGTDVALLKSGIGKVAAAIGTTLLLELCKPDVVINTGSAGGLATHLNVGDIVISTEVRYHDADVTAFGYEPGQMAQCPPAFIADAGLIALTEKCIKTTGLNAVRGLICSGDAFINGAEPLARIRANFPSVVAVEMESTAIGHVCYQYNVPFVVVRAISDVADKASHLSFDEFLPLAAKQSSLMVTEILANIDTLR

Flanking regions ( +/- flanking 50bp)

TGCTGATTCGTTATTCTGTAGTTCAATTTCTATTCAGGGAGTATGACATAATGAAAGTCGGTATCATAGGTGCGATGGAGCAGGAAGTAACCCTGCTGCGTGATCAGATTACCAACATGCAAACCCTCAGTCACGGCGGTTGTGAGATCTATACCGGTCAGATTAACGGTACAGACGTGGCGCTGCTGAAATCCGGTATCGGTAAAGTTGCCGCCGCTATCGGCACAACGTTGCTGCTGGAACTGTGCAAACCGGATGTGGTCATTAATACCGGCTCTGCTGGCGGTCTGGCAACACATCTGAATGTCGGCGATATCGTCATCTCCACTGAAGTACGTTATCACGATGCGGATGTCACCGCATTCGGTTATGAACCGGGTCAGATGGCACAATGCCCGCCGGCATTTATTGCCGATGCCGGTCTTATCGCACTGACAGAAAAATGCATTAAGACAACAGGACTGAATGCTGTCCGTGGTCTGATTTGCAGCGGTGATGCCTTTATTAACGGCGCAGAGCCGCTGGCACGTATCCGCGCAAACTTCCCGTCCGTGGTTGCCGTTGAGATGGAATCCACCGCGATTGGTCATGTCTGCTATCAGTACAATGTGCCGTTTGTGGTTGTGCGCGCAATCTCTGATGTGGCGGATAAAGCGTCTCATCTCAGTTTTGATGAATTCCTGCCTCTGGCAGCAAAGCAGTCCTCCCTGATGGTGACAGAGATCCTCGCCAATATTGATACACTGAGATGATCCCGGTTTCCGGTTTTGTCCGCCGTCTGTGCCTTCCGCTGTTGCTGCTC