Homologs in group_1520

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09825 FBDBKF_09825 100.0 Morganella morganii S1 sdhB Succinate dehydrogenase/fumarate reductase, Fe-S protein subunit
EHELCC_04625 EHELCC_04625 100.0 Morganella morganii S2 sdhB Succinate dehydrogenase/fumarate reductase, Fe-S protein subunit
NLDBIP_04625 NLDBIP_04625 100.0 Morganella morganii S4 sdhB Succinate dehydrogenase/fumarate reductase, Fe-S protein subunit
HKOGLL_12530 HKOGLL_12530 100.0 Morganella morganii S5 sdhB Succinate dehydrogenase/fumarate reductase, Fe-S protein subunit
F4V73_RS00520 F4V73_RS00520 96.2 Morganella psychrotolerans - succinate dehydrogenase iron-sulfur subunit
PMI_RS02795 PMI_RS02795 88.2 Proteus mirabilis HI4320 - succinate dehydrogenase iron-sulfur subunit

Distribution of the homologs in the orthogroup group_1520

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1520

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZQU2 2.88e-159 443 86 0 238 3 sdhB Succinate dehydrogenase iron-sulfur subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P07014 1.9e-157 439 85 0 238 1 sdhB Succinate dehydrogenase iron-sulfur subunit Escherichia coli (strain K12)
P51053 4.1e-97 286 59 2 233 3 sdhB Succinate dehydrogenase iron-sulfur subunit Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q68XS0 5.3e-92 274 55 3 234 3 sdhB Succinate dehydrogenase iron-sulfur subunit Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZEA1 1.4e-91 273 55 3 234 3 sdhB Succinate dehydrogenase iron-sulfur subunit Rickettsia prowazekii (strain Madrid E)
Q4UN71 2.53e-91 272 55 3 234 3 sdhB Succinate dehydrogenase iron-sulfur subunit Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q92JJ8 2.88e-91 272 55 3 234 3 sdhB Succinate dehydrogenase iron-sulfur subunit Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8LB02 9.49e-90 269 55 5 232 1 SDH2-2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2, mitochondrial Arabidopsis thaliana
Q1RGP3 1.4e-89 268 54 3 234 3 sdhB Succinate dehydrogenase iron-sulfur subunit Rickettsia bellii (strain RML369-C)
Q8LBZ7 7.88e-89 266 55 5 232 1 SDH2-1 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit 1, mitochondrial Arabidopsis thaliana
A5PL98 3.79e-87 262 55 5 234 2 sdhb Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Danio rerio
B0BM36 4.71e-87 262 55 5 233 2 sdhb Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Xenopus tropicalis
Q75CI4 9.82e-87 260 54 4 231 3 SDH2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P21912 1e-86 261 54 5 233 1 SDHB Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Homo sapiens
Q3B8J8 1.97e-86 260 55 5 233 2 sdhb Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Xenopus laevis
P21914 2.1e-86 261 53 5 235 2 SdhB Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Drosophila melanogaster
Q007T0 2.39e-86 260 54 5 233 1 SDHB Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Sus scrofa
Q3T189 3.47e-86 260 54 5 233 1 SDHB Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Bos taurus
Q70KF8 1.16e-85 258 54 6 230 3 SDH2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Uromyces fabae
P21913 1.61e-85 258 55 5 232 2 Sdhb Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Rattus norvegicus
Q9CQA3 2.44e-85 258 54 5 233 1 Sdhb Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Mus musculus
O42772 1.31e-84 256 53 4 231 3 SDH2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Zymoseptoria tritici
Q9YHT2 2.17e-84 256 54 5 233 1 SDHB Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Gallus gallus
Q59662 2.23e-84 254 53 5 233 3 sdhB Succinate dehydrogenase iron-sulfur subunit Paracoccus denitrificans
P80480 9.71e-84 252 53 4 227 3 SDH2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit Reclinomonas americana
P21911 1.02e-83 253 54 5 231 3 sdh2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A8WPF0 4.47e-83 252 53 6 234 3 sdhb-1 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Caenorhabditis briggsae
Q9S827 5.33e-83 252 52 5 234 1 SDH2-1 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit 1, mitochondrial Oryza sativa subsp. japonica
P32420 1.45e-82 251 53 5 229 3 SDH2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Ustilago maydis (strain 521 / FGSC 9021)
Q09545 2.14e-82 251 52 6 234 2 sdhb-1 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Caenorhabditis elegans
P21801 3.66e-82 249 53 4 231 1 SDH2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O44074 6.25e-82 249 52 5 234 1 SDHB Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Ascaris suum
Q6FWS8 6.07e-81 245 51 4 231 3 SDH2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9FJP9 3.52e-80 246 51 7 239 1 SDH2-3 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3, mitochondrial Arabidopsis thaliana
Q55CC2 6.32e-78 239 50 6 238 3 sdhB Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial Dictyostelium discoideum
P48932 2.58e-77 236 50 4 229 3 SDH2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit Chondrus crispus
P48933 6.31e-74 228 49 3 229 3 SDH2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit Cyanidium caldarium
P80477 1.7e-73 226 54 3 198 3 SDH2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit Porphyra purpurea
Q6H4G3 6.23e-69 217 45 6 233 1 SDH2-2 Succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2, mitochondrial Oryza sativa subsp. japonica
P9WN89 3.3e-46 157 36 6 232 1 frdB Fumarate reductase iron-sulfur subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WN88 3.3e-46 157 36 6 232 3 frdB Fumarate reductase iron-sulfur subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P20921 8.88e-46 155 39 4 230 3 frdB Fumarate reductase iron-sulfur subunit Proteus vulgaris
P0AC50 2.74e-45 154 38 6 234 3 frdB Fumarate reductase iron-sulfur subunit Shigella flexneri
P0AC47 2.74e-45 154 38 6 234 1 frdB Fumarate reductase iron-sulfur subunit Escherichia coli (strain K12)
P0AC48 2.74e-45 154 38 6 234 3 frdB Fumarate reductase iron-sulfur subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AC49 2.74e-45 154 38 6 234 3 frdB Fumarate reductase iron-sulfur subunit Escherichia coli O157:H7
P44893 2.38e-44 152 38 7 242 3 frdB Fumarate reductase iron-sulfur subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZMP1 3.16e-30 115 32 8 234 3 frdB Fumarate reductase iron-sulfur subunit Helicobacter pylori (strain J99 / ATCC 700824)
O06914 2.15e-29 113 32 8 234 3 frdB Fumarate reductase iron-sulfur subunit Helicobacter pylori (strain ATCC 700392 / 26695)
P17596 1.08e-28 111 30 8 233 1 frdB Fumarate reductase iron-sulfur subunit Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
D9PUX5 6.85e-23 99 31 10 238 1 tfrB Fumarate reductase (CoM/CoB) subunit B Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q7M826 9.32e-22 94 27 3 220 1 sdhB 8-methylmenaquinol:fumarate reductase iron-sulfur subunit Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q57557 5.6e-21 94 29 9 237 3 MJ0092 Uncharacterized iron-sulfur protein MJ0092 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6LYC4 1.05e-16 82 29 6 195 3 MMP1067 Uncharacterized iron-sulfur protein MMP1067 Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
P08066 1.71e-14 73 23 6 236 3 sdhB Succinate dehydrogenase iron-sulfur subunit Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_14005
Feature type CDS
Gene sdhB
Product Succinate dehydrogenase/fumarate reductase, Fe-S protein subunit
Location 80947 - 81663 (strand: 1)
Length 717 (nucleotides) / 238 (amino acids)

Contig

Accession ZDB_371
Length 143607 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1520
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF13085 2Fe-2S iron-sulfur cluster binding domain
PF13534 4Fe-4S dicluster domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0479 Energy production and conversion (C) C Succinate dehydrogenase/fumarate reductase, Fe-S protein subunit

Kegg Ortholog Annotation(s)

Protein Sequence

MKVEFSVYRYNPDVDNAPHMQNYQLDVEEGRDMMVLDALILLKEQDPSLSFRRSCREGVCGSDGINMNGKNGLACITPLSALMKGGKKVVIRPLPGLPVVRDLVVDMGQFYAQYEKIRPYLINDNKNPPAREHLQSPAQREKLDGLYECILCACCSTSCPSFWWNPDKFIGPAGLLAAYRFLTDSRDTETESRLDDISDAFSVFRCHGIMNCVSVCPKGLNPTKAIGHIKSMLLKRSA

Flanking regions ( +/- flanking 50bp)

GATTCGTACTTACTGATGTGTGGTGATGAGGCATTTGCGGAGAGAATACTATGAAAGTTGAATTTTCAGTTTATCGCTATAACCCGGATGTGGATAACGCACCACACATGCAGAACTATCAGCTGGATGTGGAAGAGGGCCGGGACATGATGGTGCTGGATGCACTGATTCTGCTGAAAGAGCAGGATCCTAGCCTGTCATTCCGCCGCTCCTGTCGTGAAGGGGTGTGTGGTTCTGACGGTATCAATATGAACGGCAAAAACGGTCTGGCCTGTATCACTCCGTTGTCGGCGCTGATGAAAGGCGGCAAAAAAGTGGTGATCCGTCCGCTGCCGGGCTTACCGGTGGTGCGGGATCTGGTCGTGGATATGGGGCAGTTCTATGCGCAGTATGAAAAGATCCGCCCGTATCTGATCAACGACAACAAAAACCCGCCGGCGCGTGAGCATTTACAGTCACCGGCGCAGCGTGAAAAGCTCGATGGTCTGTACGAATGTATCCTGTGTGCCTGCTGCTCGACATCCTGCCCGTCCTTCTGGTGGAACCCGGACAAATTTATCGGCCCGGCCGGTCTGTTAGCCGCGTACCGTTTCCTGACGGACAGCCGCGATACCGAGACAGAATCCCGTCTTGACGACATCAGTGATGCTTTCAGCGTATTCCGCTGTCACGGCATCATGAACTGCGTCAGTGTATGTCCGAAAGGGCTGAATCCGACAAAAGCAATTGGTCATATTAAATCAATGTTACTGAAACGCAGTGCATAATTGACTTTATTCTGCTTAAGCGATTGATAATAATAAGATGCCTGCCCGGC