Homologs in group_1335

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08255 FBDBKF_08255 100.0 Morganella morganii S1 rffA dTDP-4-amino-4,6-dideoxygalactose transaminase
EHELCC_13270 EHELCC_13270 100.0 Morganella morganii S2 rffA dTDP-4-amino-4,6-dideoxygalactose transaminase
NLDBIP_13610 NLDBIP_13610 100.0 Morganella morganii S4 rffA dTDP-4-amino-4,6-dideoxygalactose transaminase
HKOGLL_12085 HKOGLL_12085 100.0 Morganella morganii S5 rffA dTDP-4-amino-4,6-dideoxygalactose transaminase
F4V73_RS18805 F4V73_RS18805 92.8 Morganella psychrotolerans rffA dTDP-4-amino-4,6-dideoxygalactose transaminase
PMI_RS16515 PMI_RS16515 85.6 Proteus mirabilis HI4320 rffA dTDP-4-amino-4,6-dideoxygalactose transaminase

Distribution of the homologs in the orthogroup group_1335

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1335

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P27833 0.0 636 76 0 376 1 wecE dTDP-4-amino-4,6-dideoxygalactose transaminase Escherichia coli (strain K12)
Q58466 2.73e-61 204 35 9 379 3 MJ1066 Uncharacterized protein MJ1066 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q4KC84 3.21e-57 194 32 9 382 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KCC3 7.87e-56 190 33 9 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas fluorescens (strain Pf0-1)
P39623 6.68e-53 183 31 7 379 3 spsC Spore coat polysaccharide biosynthesis protein SpsC Bacillus subtilis (strain 168)
A8GDR5 1.35e-50 177 32 11 380 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Serratia proteamaculans (strain 568)
Q8ZNF3 2.28e-50 176 32 10 387 1 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BCP8 2.34e-50 176 32 10 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella paratyphi A (strain AKU_12601)
Q5PNA4 2.34e-50 176 32 10 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C0Q071 2.36e-50 176 32 10 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella paratyphi C (strain RKS4594)
B4SYW9 2.36e-50 176 32 10 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella newport (strain SL254)
B4TBG4 2.36e-50 176 32 10 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella heidelberg (strain SL476)
Q8Z542 2.71e-50 176 33 10 382 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella typhi
B5RCC2 2.71e-50 176 32 10 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q2NRV5 2.74e-50 176 31 10 386 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Sodalis glossinidius (strain morsitans)
A9N5B4 2.77e-50 176 32 10 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5R270 2.77e-50 176 32 10 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5EZH6 2.77e-50 176 32 10 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella agona (strain SL483)
B4TPI0 2.86e-50 176 33 11 382 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella schwarzengrund (strain CVM19633)
B5FNT7 2.98e-50 176 32 10 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella dublin (strain CT_02021853)
B4ETL5 1.33e-49 174 30 10 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Proteus mirabilis (strain HI4320)
Q4ZSZ4 1.43e-49 174 31 11 382 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas syringae pv. syringae (strain B728a)
Q57M57 3.48e-49 173 32 10 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella choleraesuis (strain SC-B67)
A4WAM5 6.83e-49 172 31 8 378 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Enterobacter sp. (strain 638)
A6TFA0 8.09e-49 172 31 8 378 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XTK7 1.1e-48 171 31 8 378 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Klebsiella pneumoniae (strain 342)
B7LM78 1.47e-48 171 31 9 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P15263 1.54e-48 171 30 4 360 3 degT Pleiotropic regulatory protein Geobacillus stearothermophilus
A1JPP9 2.21e-48 171 32 9 375 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JJ28 9.5e-48 169 30 10 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q7BF87 9.5e-48 169 30 10 381 2 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TIM2 9.5e-48 169 30 10 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pestis (strain Pestoides F)
Q1CIH5 9.5e-48 169 30 10 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R095 9.5e-48 169 30 10 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pestis bv. Antiqua (strain Angola)
Q93PE0 9.5e-48 169 30 10 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pestis
B2K5L5 9.5e-48 169 30 10 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C740 9.5e-48 169 30 10 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FHH2 9.5e-48 169 30 10 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1IXT4 1.29e-47 169 32 9 374 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7N5L8 1.54e-47 168 32 9 374 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B2VBJ1 2.64e-47 168 31 10 380 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q02R23 9.76e-47 166 31 10 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7VBN4 1.07e-46 166 31 10 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas aeruginosa (strain LESB58)
Q6D2E9 1.45e-46 166 29 8 382 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A6V1P2 1.68e-46 166 31 10 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas aeruginosa (strain PA7)
A0KGY8 2.68e-46 165 30 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7N3Q5 3.36e-46 165 30 11 377 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9HY65 3.55e-46 165 31 11 386 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1R9G2 5.79e-46 164 31 11 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain UTI89 / UPEC)
Q8FFM3 5.79e-46 164 31 11 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFI9 5.79e-46 164 31 11 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADA5 5.79e-46 164 31 11 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O1:K1 / APEC
B7MG20 5.79e-46 164 31 11 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
A4SQW7 8.7e-46 164 30 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Aeromonas salmonicida (strain A449)
C5BDQ4 1.36e-45 163 30 11 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Edwardsiella ictaluri (strain 93-146)
B7M5T5 1.54e-45 163 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O8 (strain IAI1)
B7UFR5 2.62e-45 162 31 11 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7MXT4 3.44e-45 162 31 11 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O81 (strain ED1a)
Q31YK4 4.47e-45 162 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Shigella boydii serotype 4 (strain Sb227)
B1LLK7 4.47e-45 162 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain SMS-3-5 / SECEC)
B6I7J6 4.47e-45 162 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain SE11)
B7LAR8 4.47e-45 162 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain 55989 / EAEC)
A7ZP71 4.47e-45 162 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83QT9 6.32e-45 161 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Shigella flexneri
Q0T2N0 6.32e-45 161 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Shigella flexneri serotype 5b (strain 8401)
Q9A9H3 9.02e-45 161 30 10 375 1 per GDP-perosamine synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B5YX44 1e-44 161 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q7AC24 1e-44 161 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O157:H7
B7NNT2 2.77e-44 160 30 11 382 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q3YZV3 2.89e-44 160 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Shigella sonnei (strain Ss046)
B7JA35 4.91e-44 159 31 8 357 1 gnnB UDP-N-acetyl-3-dehydro-alpha-D-glucosamine 3-aminotranferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A8A2C0 8.13e-44 159 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O9:H4 (strain HS)
B1X8W6 8.13e-44 159 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain K12 / DH10B)
C4ZU95 8.13e-44 159 31 10 376 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain K12 / MC4100 / BW2952)
P77690 1.15e-43 158 31 10 376 1 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain K12)
C6DAW7 4.67e-43 157 29 9 375 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8FRR4 2.12e-42 155 28 7 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Shewanella sediminis (strain HAW-EB3)
Q7DBF3 7.63e-42 153 29 7 381 1 perA GDP-perosamine synthase Escherichia coli O157:H7
Q6T1W6 1.26e-40 150 35 4 268 1 fdtB dTDP-3-amino-3,6-dideoxy-alpha-D-galactopyranose transaminase Aneurinibacillus thermoaerophilus
Q795J3 7.78e-40 148 29 9 388 2 epsN Putative pyridoxal phosphate-dependent aminotransferase EpsN Bacillus subtilis (strain 168)
Q9ZGH4 1.06e-39 147 30 6 318 1 desV dTDP-3-amino-3,4,6-trideoxy-alpha-D-glucose transaminase Streptomyces venezuelae
Q07608 7.66e-38 145 34 8 281 3 mosB Protein MosB Rhizobium meliloti
Q8G8Y2 7.91e-38 144 31 8 333 1 btrR L-glutamine:2-deoxy-scyllo-inosose aminotransferase Niallia circulans
P14290 1.11e-37 142 28 6 354 3 eryC1 Erythromycin biosynthesis sensory transduction protein EryC1 Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q9HZ76 3.24e-37 140 32 9 317 1 wbpE UDP-2-acetamido-2-deoxy-3-oxo-D-glucuronate aminotransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8EEB1 5.12e-35 135 31 4 289 1 kdnA 8-amino-3,8-dideoxy-alpha-D-manno-octulosonate transaminase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q06953 5.27e-35 135 24 7 383 1 rfbE GDP-perosamine synthase Vibrio cholerae
Q9ALN9 1.83e-34 134 29 7 329 1 spnR dTDP-4-dehydro-2,3,6-trideoxy-D-glucose 4-aminotransferase Saccharopolyspora spinosa
Q2MF12 2.59e-34 134 31 4 274 3 tobS2 Putative L-glutamine:3-amino-2,3-dideoxy-scyllo-inosose aminotransferase Streptoalloteichus tenebrarius (strain ATCC 17920 / DSM 40477 / JCM 4838 / CBS 697.72 / NBRC 16177 / NCIMB 11028 / NRRL B-12390 / A12253. 1 / ISP 5477)
Q70KD4 3.05e-34 134 30 5 286 3 gtmD Putative L-glutamine:3-amino-2,3-dideoxy-scyllo-inosose aminotransferase Micromonospora echinospora
O07566 2.3e-33 132 30 7 348 1 ntdA 3-oxo-glucose-6-phosphate:glutamate aminotransferase Bacillus subtilis (strain 168)
Q2MF17 6.66e-32 127 29 8 335 3 tbmB L-glutamine:2-deoxy-scyllo-inosose aminotransferase Streptoalloteichus tenebrarius (strain ATCC 17920 / DSM 40477 / JCM 4838 / CBS 697.72 / NBRC 16177 / NCIMB 11028 / NRRL B-12390 / A12253. 1 / ISP 5477)
Q6L739 3.48e-31 125 31 6 268 1 kanB L-glutamine:2-deoxy-scyllo-inosose aminotransferase Streptomyces kanamyceticus
Q6L733 1.11e-30 124 29 3 259 3 kanD Putative L-glutamine:3-amino-2,3-dideoxy-scyllo-inosose aminotransferase Streptomyces kanamyceticus
Q9F837 1.3e-30 123 27 5 361 1 megDII dTDP-3-amino-3,4,6-trideoxy-alpha-D-glucose transaminase Micromonospora megalomicea subsp. nigra
P25048 2.5e-30 122 27 7 361 3 dnrJ Daunorubicin biosynthesis sensory transduction protein DnrJ Streptomyces peucetius
Q6U1I3 5.45e-30 121 30 10 347 1 vioA dTDP-4-amino-4,6-dideoxy-D-glucose transaminase Shigella dysenteriae
P26398 1.9e-29 121 30 7 325 3 rfbH Lipopolysaccharide biosynthesis protein RfbH Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6QVU4 7.46e-29 119 32 6 280 3 gntA L-glutamine:2-deoxy-scyllo-inosose aminotransferase Micromonospora echinospora
Q2MF71 8.02e-29 119 31 6 262 3 livS L-glutamine:2-deoxy-scyllo-inosose aminotransferase Streptomyces lividus
Q2MFP2 1.11e-28 119 32 6 266 3 parS L-glutamine:2-deoxy-scyllo-inosose aminotransferase Streptomyces paromomycinus
P77952 1.32e-28 118 29 4 275 1 stsC L-glutamine:scyllo-inosose aminotransferase Streptomyces griseus
Q9XCW4 3.88e-27 113 27 8 380 1 vioA dTDP-4-amino-4,6-dideoxy-D-glucose transaminase Escherichia coli
Q4R0W2 1.37e-26 113 32 3 240 1 rbmB L-glutamine:2-deoxy-scyllo-inosose aminotransferase Streptomyces ribosidificus
O25130 1.75e-26 112 26 9 320 1 pseC UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase Helicobacter pylori (strain ATCC 700392 / 26695)
Q5QKR7 8.55e-26 110 30 7 271 3 pseC UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q0P9D3 1.31e-24 107 29 4 260 1 pglE UDP-N-acetylbacillosamine transaminase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q53U20 3.54e-24 106 30 3 240 1 neoB L-glutamine:2-deoxy-scyllo-inosose aminotransferase Streptomyces fradiae
O52552 3.37e-23 103 31 8 248 1 rifK 3-amino-5-hydroxybenzoate synthase Amycolatopsis mediterranei (strain S699)
Q0P8W3 1.48e-22 100 29 7 271 1 pseC UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9ALN8 2.72e-22 101 33 4 223 1 spnQ dTDP-4-dehydro-2,6-dideoxy-D-glucose 3-dehydratase Saccharopolyspora spinosa
G4WJD4 1.32e-17 87 31 4 191 1 colD GDP-4-keto-6-deoxy-D-mannose 3-dehydratase Yersinia pseudotuberculosis
D3QY10 2.65e-17 85 28 3 202 1 colD GDP-4-keto-6-deoxy-D-mannose 3-dehydratase Escherichia coli O55:H7 (strain CB9615 / EPEC)
P9WGJ7 1.85e-09 62 33 4 135 2 Rv3402c Protein Rv3402c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGJ6 1.85e-09 62 33 4 135 3 MT3510 Protein MT3510 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TWJ6 5.37e-09 61 33 4 135 3 BQ2027_MB3436C Protein Mb3436c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q4J8X2 8.21e-07 54 35 5 116 3 aspC Aspartate aminotransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q5UPL1 8.91e-06 50 24 10 245 1 MIMI_L136 Uncharacterized protein L136 Acanthamoeba polyphaga mimivirus
C6C2Z3 2.7e-05 49 30 3 112 1 Dd703_1457 Aspartate aminotransferase Musicola paradisiaca (strain Ech703)
P16524 4.3e-05 48 33 3 112 1 dapX Probable N-acetyl-LL-diaminopimelate aminotransferase Bacillus subtilis (strain 168)
P14909 0.000105 47 28 3 104 1 aspC Aspartate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q60317 0.000227 46 31 4 110 3 MJ0001 Probable aspartate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q819L4 0.000538 45 24 3 133 3 speA Arginine decarboxylase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81MS2 0.000711 45 24 3 133 3 speA Arginine decarboxylase Bacillus anthracis

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_12945
Feature type CDS
Gene rffA
Product dTDP-4-amino-4,6-dideoxygalactose transaminase
Location 27766 - 28896 (strand: 1)
Length 1131 (nucleotides) / 376 (amino acids)

Contig

Accession ZDB_370
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1335
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01041 DegT/DnrJ/EryC1/StrS aminotransferase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0399 Cell wall/membrane/envelope biogenesis (M) M dTDP-4-amino-4,6-dideoxygalactose transaminase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02805 dTDP-4-amino-4,6-dideoxygalactose transaminase [EC:2.6.1.59] O-Antigen nucleotide sugar biosynthesis
Metabolic pathways
Biosynthesis of nucleotide sugars		 -

Protein Sequence

MIPFNKPPVVGTEVEYMQQAMKSGKLCGDGSFTKKCEEWMEKRFGSAKVLLTPSCTASLEMAAILLDIQPGDEVIMPSYTFVSTSNAFVLRGAKVVFVDIRPDTMNIDETKIEAAITDKTKAIVPVHYAGVACEMDIIMALAKKYNLFVVEDAAQGVMSTYKGRALGSIGHIGCYSFHETKNYSSGGEGGATLINDPAMIGRAEIIREKGTNRSEFFRGQVDKYTWRDIGSSYLMSDLQAAYLWAQLEEAEKINERRLAFWQIYYDALTPLAQDGLLTLPVVPENLEQNAHMFYIKLKDVAERTAFSEYMKANDVLTVFHYVPLHSCPAGMEFGRFHGEDIFTTRESERLVRLPMFYNMTEEEQQRVIHLIKGFFA

Flanking regions ( +/- flanking 50bp)

AAGCGGTGGTGCGGTTGACAGCACTGCCTACTGGTTATACCGAGGATGCAATGATTCCATTTAATAAACCACCTGTAGTCGGCACTGAAGTTGAATATATGCAGCAGGCCATGAAAAGCGGCAAGCTGTGCGGTGACGGTTCGTTCACCAAAAAATGCGAAGAGTGGATGGAAAAACGGTTCGGCAGCGCCAAAGTTCTGCTGACCCCGTCCTGTACCGCCTCACTGGAAATGGCGGCAATCCTGCTGGATATTCAGCCGGGTGATGAAGTCATCATGCCGAGCTATACCTTCGTCTCCACCTCCAACGCCTTTGTGCTGCGCGGTGCGAAAGTGGTGTTTGTTGATATCCGTCCGGACACCATGAACATCGATGAAACTAAAATCGAAGCGGCTATCACCGATAAAACCAAAGCGATTGTACCGGTGCATTATGCAGGCGTGGCCTGTGAAATGGACATCATCATGGCGCTGGCGAAGAAATATAACCTCTTTGTGGTGGAAGATGCCGCGCAGGGCGTGATGTCAACTTACAAAGGCCGCGCGCTGGGCTCTATCGGCCATATCGGCTGCTACAGCTTCCACGAAACCAAAAACTACTCCTCCGGCGGAGAGGGCGGTGCGACCCTGATTAACGATCCGGCGATGATTGGCCGTGCGGAAATCATTCGTGAGAAAGGCACCAACCGCAGTGAATTCTTCCGCGGACAGGTGGATAAATACACCTGGCGTGATATCGGCTCCAGCTACCTGATGTCCGACTTACAGGCCGCATACCTGTGGGCACAGCTGGAAGAAGCGGAAAAAATCAACGAGCGCCGTCTGGCATTCTGGCAGATTTACTATGATGCCCTGACCCCGCTGGCGCAGGATGGCCTGCTGACGTTGCCGGTTGTTCCGGAAAATCTGGAGCAGAACGCGCACATGTTCTACATCAAACTGAAAGATGTGGCAGAGCGCACCGCATTCAGCGAATACATGAAAGCCAATGACGTGCTGACCGTATTCCACTATGTGCCGCTGCACAGCTGCCCGGCGGGTATGGAGTTCGGCCGTTTCCACGGTGAGGATATCTTTACCACCCGTGAAAGCGAGCGCCTGGTGCGTCTGCCGATGTTCTACAACATGACAGAAGAAGAGCAGCAGCGCGTGATCCACCTGATTAAGGGCTTCTTCGCGTAGTATGTCCCTCGCTAAAGCCTCTGTCTGGACCGCCGGCTCCACCCTGATCA