Homologs in group_1335

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08255 FBDBKF_08255 85.6 Morganella morganii S1 rffA dTDP-4-amino-4,6-dideoxygalactose transaminase
EHELCC_13270 EHELCC_13270 85.6 Morganella morganii S2 rffA dTDP-4-amino-4,6-dideoxygalactose transaminase
NLDBIP_13610 NLDBIP_13610 85.6 Morganella morganii S4 rffA dTDP-4-amino-4,6-dideoxygalactose transaminase
LHKJJB_12945 LHKJJB_12945 85.6 Morganella morganii S3 rffA dTDP-4-amino-4,6-dideoxygalactose transaminase
HKOGLL_12085 HKOGLL_12085 85.6 Morganella morganii S5 rffA dTDP-4-amino-4,6-dideoxygalactose transaminase
F4V73_RS18805 F4V73_RS18805 84.3 Morganella psychrotolerans rffA dTDP-4-amino-4,6-dideoxygalactose transaminase

Distribution of the homologs in the orthogroup group_1335

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1335

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P27833 0.0 616 75 0 376 1 wecE dTDP-4-amino-4,6-dideoxygalactose transaminase Escherichia coli (strain K12)
Q4KC84 6.74e-60 201 34 10 382 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KCC3 1.45e-58 197 34 11 386 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas fluorescens (strain Pf0-1)
Q58466 1.75e-58 197 35 7 331 3 MJ1066 Uncharacterized protein MJ1066 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A8GDR5 6.76e-56 191 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Serratia proteamaculans (strain 568)
P39623 1.42e-55 190 32 7 379 3 spsC Spore coat polysaccharide biosynthesis protein SpsC Bacillus subtilis (strain 168)
B7LM78 3.86e-54 186 34 12 383 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P15263 1.27e-53 184 33 3 347 3 degT Pleiotropic regulatory protein Geobacillus stearothermophilus
Q8Z542 2.66e-53 184 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella typhi
A9N5B4 3.43e-53 183 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5R270 3.43e-53 183 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5EZH6 3.43e-53 183 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella agona (strain SL483)
B5RCC2 4.33e-53 183 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B4TPI0 4.37e-53 183 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella schwarzengrund (strain CVM19633)
B5FNT7 4.42e-53 183 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella dublin (strain CT_02021853)
B2VBJ1 6.47e-53 182 33 13 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4WAM5 1.25e-52 182 32 9 382 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Enterobacter sp. (strain 638)
B5BCP8 1.68e-52 181 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella paratyphi A (strain AKU_12601)
Q5PNA4 1.68e-52 181 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C0Q071 1.83e-52 181 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella paratyphi C (strain RKS4594)
B4SYW9 1.83e-52 181 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella newport (strain SL254)
B4TBG4 1.83e-52 181 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella heidelberg (strain SL476)
Q8ZNF3 2.53e-52 181 34 11 379 1 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2NRV5 3.79e-52 181 32 13 389 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Sodalis glossinidius (strain morsitans)
A6TFA0 7.78e-52 180 32 10 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7N5L8 8.93e-52 179 33 11 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q57M57 9.72e-52 179 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Salmonella choleraesuis (strain SC-B67)
B5XTK7 9.92e-52 179 32 10 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Klebsiella pneumoniae (strain 342)
B1IXT4 1.93e-51 179 33 11 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7VBN4 2.01e-51 179 32 10 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas aeruginosa (strain LESB58)
Q9HY65 2.03e-51 179 32 10 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02R23 2.21e-51 179 32 10 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V1P2 3.75e-51 178 32 10 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas aeruginosa (strain PA7)
Q4ZSZ4 2.75e-49 173 32 12 383 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pseudomonas syringae pv. syringae (strain B728a)
Q1R9G2 5.59e-49 172 34 12 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain UTI89 / UPEC)
Q8FFM3 5.59e-49 172 34 12 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFI9 5.59e-49 172 34 12 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADA5 5.59e-49 172 34 12 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O1:K1 / APEC
B7MG20 5.59e-49 172 34 12 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B1JJ28 5.6e-49 172 32 9 375 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q7BF87 5.6e-49 172 32 9 375 2 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TIM2 5.6e-49 172 32 9 375 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pestis (strain Pestoides F)
Q1CIH5 5.6e-49 172 32 9 375 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R095 5.6e-49 172 32 9 375 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pestis bv. Antiqua (strain Angola)
Q93PE0 5.6e-49 172 32 9 375 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pestis
B2K5L5 5.6e-49 172 32 9 375 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C740 5.6e-49 172 32 9 375 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FHH2 5.6e-49 172 32 9 375 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JPP9 7.33e-49 172 32 9 375 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A0KGY8 7.34e-49 172 30 10 378 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q6D2E9 1.28e-48 171 31 9 377 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B7M5T5 1.34e-48 171 33 11 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O8 (strain IAI1)
Q31YK4 2.83e-48 170 33 11 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Shigella boydii serotype 4 (strain Sb227)
B1LLK7 2.83e-48 170 33 11 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain SMS-3-5 / SECEC)
B6I7J6 2.83e-48 170 33 11 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain SE11)
B7LAR8 2.83e-48 170 33 11 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain 55989 / EAEC)
A7ZP71 2.83e-48 170 33 11 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7UFR5 3.8e-48 170 34 12 384 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83QT9 4.8e-48 170 33 11 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Shigella flexneri
Q0T2N0 4.8e-48 170 33 11 385 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Shigella flexneri serotype 5b (strain 8401)
B7MXT4 6.17e-48 169 33 12 390 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O81 (strain ED1a)
A8A2C0 9.61e-48 169 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O9:H4 (strain HS)
B1X8W6 9.61e-48 169 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain K12 / DH10B)
C4ZU95 9.61e-48 169 34 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7NNT2 1.03e-47 169 33 11 387 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YX44 1.28e-47 169 33 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q7AC24 1.28e-47 169 33 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli O157:H7
P77690 1.53e-47 169 34 11 379 1 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Escherichia coli (strain K12)
Q7DBF3 1.62e-47 168 31 6 379 1 perA GDP-perosamine synthase Escherichia coli O157:H7
Q9A9H3 1.99e-47 168 33 5 300 1 per GDP-perosamine synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q3YZV3 2.25e-47 168 33 11 379 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Shigella sonnei (strain Ss046)
B4ETL5 4.87e-47 167 30 10 386 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Proteus mirabilis (strain HI4320)
A4SQW7 1.21e-46 166 30 10 377 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Aeromonas salmonicida (strain A449)
B7JA35 2.45e-46 165 34 7 322 1 gnnB UDP-N-acetyl-3-dehydro-alpha-D-glucosamine 3-aminotranferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
C5BDQ4 3.38e-45 162 30 13 392 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Edwardsiella ictaluri (strain 93-146)
C6DAW7 6.62e-45 162 29 9 377 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q7N3Q5 1.24e-44 161 30 11 377 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9ZGH4 1.1e-43 158 32 4 318 1 desV dTDP-3-amino-3,4,6-trideoxy-alpha-D-glucose transaminase Streptomyces venezuelae
Q6T1W6 1.56e-42 155 36 3 255 1 fdtB dTDP-3-amino-3,6-dideoxy-alpha-D-galactopyranose transaminase Aneurinibacillus thermoaerophilus
P14290 1.59e-41 152 32 6 328 3 eryC1 Erythromycin biosynthesis sensory transduction protein EryC1 Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q795J3 3.64e-41 152 31 9 388 2 epsN Putative pyridoxal phosphate-dependent aminotransferase EpsN Bacillus subtilis (strain 168)
Q8EEB1 3.41e-40 149 33 4 289 1 kdnA 8-amino-3,8-dideoxy-alpha-D-manno-octulosonate transaminase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A8FRR4 4.48e-39 146 28 7 381 3 arnB UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase Shewanella sediminis (strain HAW-EB3)
Q06953 2.51e-38 144 26 8 391 1 rfbE GDP-perosamine synthase Vibrio cholerae
Q2MF12 7.03e-38 144 33 6 276 3 tobS2 Putative L-glutamine:3-amino-2,3-dideoxy-scyllo-inosose aminotransferase Streptoalloteichus tenebrarius (strain ATCC 17920 / DSM 40477 / JCM 4838 / CBS 697.72 / NBRC 16177 / NCIMB 11028 / NRRL B-12390 / A12253. 1 / ISP 5477)
Q9ALN9 9.39e-38 142 30 13 386 1 spnR dTDP-4-dehydro-2,3,6-trideoxy-D-glucose 4-aminotransferase Saccharopolyspora spinosa
Q9HZ76 1.07e-37 142 35 7 284 1 wbpE UDP-2-acetamido-2-deoxy-3-oxo-D-glucuronate aminotransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8G8Y2 2.77e-36 139 29 9 363 1 btrR L-glutamine:2-deoxy-scyllo-inosose aminotransferase Niallia circulans
Q07608 2.86e-36 141 33 9 281 3 mosB Protein MosB Rhizobium meliloti
O07566 2.01e-35 137 28 6 362 1 ntdA 3-oxo-glucose-6-phosphate:glutamate aminotransferase Bacillus subtilis (strain 168)
Q70KD4 9.18e-35 135 32 6 287 3 gtmD Putative L-glutamine:3-amino-2,3-dideoxy-scyllo-inosose aminotransferase Micromonospora echinospora
Q6L739 9.22e-34 132 32 7 271 1 kanB L-glutamine:2-deoxy-scyllo-inosose aminotransferase Streptomyces kanamyceticus
Q2MF17 5.34e-33 130 31 7 298 3 tbmB L-glutamine:2-deoxy-scyllo-inosose aminotransferase Streptoalloteichus tenebrarius (strain ATCC 17920 / DSM 40477 / JCM 4838 / CBS 697.72 / NBRC 16177 / NCIMB 11028 / NRRL B-12390 / A12253. 1 / ISP 5477)
Q6L733 1.58e-32 129 30 3 259 3 kanD Putative L-glutamine:3-amino-2,3-dideoxy-scyllo-inosose aminotransferase Streptomyces kanamyceticus
Q6QVU4 3.99e-32 128 33 7 292 3 gntA L-glutamine:2-deoxy-scyllo-inosose aminotransferase Micromonospora echinospora
P77952 1.35e-31 127 31 7 285 1 stsC L-glutamine:scyllo-inosose aminotransferase Streptomyces griseus
P25048 3.75e-31 124 28 9 367 3 dnrJ Daunorubicin biosynthesis sensory transduction protein DnrJ Streptomyces peucetius
Q2MFP2 9.01e-31 124 36 4 216 3 parS L-glutamine:2-deoxy-scyllo-inosose aminotransferase Streptomyces paromomycinus
Q4R0W2 1.53e-30 124 37 4 218 1 rbmB L-glutamine:2-deoxy-scyllo-inosose aminotransferase Streptomyces ribosidificus
P26398 2.32e-29 120 31 5 306 3 rfbH Lipopolysaccharide biosynthesis protein RfbH Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9F837 2.99e-29 119 29 4 322 1 megDII dTDP-3-amino-3,4,6-trideoxy-alpha-D-glucose transaminase Micromonospora megalomicea subsp. nigra
Q2MF71 4.07e-29 120 31 7 265 3 livS L-glutamine:2-deoxy-scyllo-inosose aminotransferase Streptomyces lividus
O25130 1.99e-28 117 26 9 318 1 pseC UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase Helicobacter pylori (strain ATCC 700392 / 26695)
Q6U1I3 3.06e-28 116 28 10 373 1 vioA dTDP-4-amino-4,6-dideoxy-D-glucose transaminase Shigella dysenteriae
Q53U20 4.39e-28 117 35 3 209 1 neoB L-glutamine:2-deoxy-scyllo-inosose aminotransferase Streptomyces fradiae
O52552 1.9e-26 112 29 5 289 1 rifK 3-amino-5-hydroxybenzoate synthase Amycolatopsis mediterranei (strain S699)
Q0P9D3 5.63e-25 107 30 5 264 1 pglE UDP-N-acetylbacillosamine transaminase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9ALN8 6.03e-25 108 37 3 200 1 spnQ dTDP-4-dehydro-2,6-dideoxy-D-glucose 3-dehydratase Saccharopolyspora spinosa
Q5QKR7 1.88e-24 106 29 6 267 3 pseC UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9XCW4 3.94e-22 99 26 10 371 1 vioA dTDP-4-amino-4,6-dideoxy-D-glucose transaminase Escherichia coli
Q0P8W3 1.56e-20 95 27 6 267 1 pseC UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
G4WJD4 4.57e-19 91 32 4 191 1 colD GDP-4-keto-6-deoxy-D-mannose 3-dehydratase Yersinia pseudotuberculosis
D3QY10 6.56e-16 82 27 4 209 1 colD GDP-4-keto-6-deoxy-D-mannose 3-dehydratase Escherichia coli O55:H7 (strain CB9615 / EPEC)
P9WGJ7 1.56e-08 59 28 7 212 2 Rv3402c Protein Rv3402c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGJ6 1.56e-08 59 28 7 212 3 MT3510 Protein MT3510 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TWJ6 3.78e-08 58 29 8 213 3 BQ2027_MB3436C Protein Mb3436c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5UPL1 3.55e-06 52 24 10 245 1 MIMI_L136 Uncharacterized protein L136 Acanthamoeba polyphaga mimivirus
P16524 0.000253 46 35 2 97 1 dapX Probable N-acetyl-LL-diaminopimelate aminotransferase Bacillus subtilis (strain 168)
Q795M6 0.000406 45 28 5 134 3 yugH Putative aminotransferase YugH Bacillus subtilis (strain 168)
Q972A2 0.000645 45 28 5 122 3 aspC Aspartate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q60317 0.000793 44 27 6 153 3 MJ0001 Probable aspartate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16515
Feature type CDS
Gene rffA
Product dTDP-4-amino-4,6-dideoxygalactose transaminase
Location 3642445 - 3643575 (strand: 1)
Length 1131 (nucleotides) / 376 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1335
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01041 DegT/DnrJ/EryC1/StrS aminotransferase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0399 Cell wall/membrane/envelope biogenesis (M) M dTDP-4-amino-4,6-dideoxygalactose transaminase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02805 dTDP-4-amino-4,6-dideoxygalactose transaminase [EC:2.6.1.59] O-Antigen nucleotide sugar biosynthesis
Metabolic pathways
Biosynthesis of nucleotide sugars		 -

Protein Sequence

MIPFNKPPVVGTELEYMKQAMESGKLCGDGNFTKKCEKWLEEQFHCHKTLLTPSCTASLEMAAILLDIKPGDEVIMPSFTFVSTSNAFVLRGATIVFVDIRPDTMNLDETKIEAAITEKTRAIVPVHYAGVACEMDTIMAIAKKHNLFVVEDAAQGVMSTYKGKALGTIGHIGCYSFHETKNYSSGGEGGATLINDPALINRAEVIREKGTNRSQFFRGQVDKYTWRDIGSSYLLSDLQAAYLWAQLEQADKINERRLAFWQIYYDALTPLAEQGLLTLPVVPDGLEHNAHMFYIKLNDIEQRTAFNEYMKAQGVLTVFHYVSLHTSPAGMKFGRFDGKDIFTTQESERLVRLPMFYNMTEEEQQTVIHHIRHFFA

Flanking regions ( +/- flanking 50bp)

AAGCGGTGCTTTAATTGATAGCACTACTTATTGGTTATACAGGGGATAATATGATTCCGTTTAATAAACCACCCGTTGTTGGCACAGAATTAGAGTATATGAAACAGGCGATGGAAAGTGGCAAGCTCTGTGGTGATGGCAACTTCACAAAAAAATGTGAAAAGTGGTTAGAAGAACAATTTCATTGTCATAAGACGCTGTTAACACCTTCTTGTACAGCATCGTTAGAAATGGCGGCTATCCTTCTGGATATCAAACCCGGCGATGAAGTGATTATGCCGAGTTTCACTTTTGTTTCGACTTCGAACGCCTTTGTTTTACGTGGTGCAACTATTGTGTTTGTCGATATTCGTCCAGACACCATGAACCTTGATGAAACAAAAATTGAAGCGGCGATTACGGAGAAAACGCGTGCGATAGTGCCCGTTCATTACGCAGGTGTTGCCTGTGAAATGGATACCATTATGGCGATCGCCAAAAAGCATAACCTGTTTGTCGTTGAAGATGCTGCGCAAGGGGTAATGTCGACTTATAAAGGTAAAGCCTTAGGAACTATCGGTCATATTGGTTGCTATAGCTTTCATGAGACGAAAAACTATTCATCAGGTGGTGAAGGTGGGGCAACACTGATTAACGATCCGGCTTTAATTAATCGTGCGGAAGTGATCCGTGAAAAAGGCACCAATCGTAGTCAATTTTTCCGTGGGCAAGTTGATAAATACACTTGGCGTGATATTGGCTCTAGCTATTTGCTGTCTGATTTGCAAGCCGCTTATCTTTGGGCGCAACTCGAACAAGCCGATAAAATTAATGAACGTCGTTTAGCATTCTGGCAAATCTATTACGATGCATTAACGCCGTTAGCCGAACAAGGTTTGTTAACATTGCCTGTTGTACCAGACGGTTTAGAGCATAATGCCCATATGTTCTATATTAAACTTAATGATATAGAGCAGCGTACGGCTTTTAATGAGTATATGAAAGCACAGGGCGTCTTAACGGTATTCCACTATGTATCACTGCATACGAGTCCTGCCGGAATGAAGTTTGGTCGTTTTGATGGTAAAGATATTTTCACTACACAAGAGAGTGAACGCTTGGTGCGCTTACCGATGTTCTACAACATGACTGAAGAAGAGCAGCAAACCGTTATTCATCATATTCGTCATTTCTTTGCTTGATATGTCGTTAGCTAAAGCTTCAATTTGGACAGCTGGGTCAACCTTGATAA