Homologs in group_338

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13600 FBDBKF_13600 100.0 Morganella morganii S1 dapA 4-hydroxy-tetrahydrodipicolinate synthase
EHELCC_08495 EHELCC_08495 100.0 Morganella morganii S2 dapA 4-hydroxy-tetrahydrodipicolinate synthase
NLDBIP_08820 NLDBIP_08820 100.0 Morganella morganii S4 dapA 4-hydroxy-tetrahydrodipicolinate synthase
HKOGLL_05470 HKOGLL_05470 100.0 Morganella morganii S5 dapA 4-hydroxy-tetrahydrodipicolinate synthase
F4V73_RS03165 F4V73_RS03165 93.6 Morganella psychrotolerans dapA 4-hydroxy-tetrahydrodipicolinate synthase
PMI_RS07620 PMI_RS07620 72.2 Proteus mirabilis HI4320 dapA 4-hydroxy-tetrahydrodipicolinate synthase
PMI_RS14530 PMI_RS14530 26.4 Proteus mirabilis HI4320 - dihydrodipicolinate synthase family protein

Distribution of the homologs in the orthogroup group_338

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_338

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A7MP70 5.26e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Cronobacter sakazakii (strain ATCC BAA-894)
Q3YZ74 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shigella sonnei (strain Ss046)
Q31Y13 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shigella boydii serotype 4 (strain Sb227)
B2TXQ4 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LNC8 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli (strain SMS-3-5 / SECEC)
B6I548 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli (strain SE11)
P63943 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A2X1 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O9:H4 (strain HS)
B7MYB7 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O81 (strain ED1a)
B7NQL6 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z015 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P63944 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O157:H7
B7LCL6 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli (strain 55989 / EAEC)
A7ZPS4 7.55e-150 424 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
P0A6L3 3.38e-149 422 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shigella flexneri
P0A6L2 3.38e-149 422 69 1 292 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli (strain K12)
B1IWI1 3.38e-149 422 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7M7I1 3.38e-149 422 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O8 (strain IAI1)
Q32D87 7.77e-149 422 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shigella dysenteriae serotype 1 (strain Sd197)
A1JL07 5.13e-148 419 67 0 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q0T239 2.73e-147 418 68 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shigella flexneri serotype 5b (strain 8401)
B7LKG3 4.14e-147 417 69 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A9MHQ2 7.69e-146 414 68 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4TMN2 1.44e-145 413 66 0 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Yersinia pestis (strain Pestoides F)
Q8ZCD0 1.44e-145 413 66 0 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Yersinia pestis
A7FG49 1.44e-145 413 66 0 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C5B7A2 1.73e-145 413 69 0 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Edwardsiella ictaluri (strain 93-146)
Q8ZN71 1.95e-145 413 68 1 292 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TR62 1.95e-145 413 68 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salmonella schwarzengrund (strain CVM19633)
B5BB16 1.95e-145 413 68 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salmonella paratyphi A (strain AKU_12601)
Q5PLS1 1.95e-145 413 68 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z4R8 6.43e-145 412 67 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salmonella typhi
Q668F7 9.26e-145 411 66 0 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q2NS74 1.43e-144 411 67 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Sodalis glossinidius (strain morsitans)
B2VE56 1.03e-143 409 67 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A6TCA1 4.35e-143 407 68 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B8D702 4.86e-137 392 61 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57197 4.86e-137 392 61 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8P8 7.29e-137 391 61 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q8KA24 5.16e-136 389 60 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q492F5 1.37e-135 388 64 1 289 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Blochmanniella pennsylvanica (strain BPEN)
Q5E3I3 2.51e-134 385 64 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FGX4 2.56e-134 385 64 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Aliivibrio fischeri (strain MJ11)
Q7VRT1 1.46e-131 378 59 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Blochmanniella floridana
B6EJT2 5.56e-128 369 61 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Aliivibrio salmonicida (strain LFI1238)
Q9CLZ7 5.68e-128 369 62 1 298 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pasteurella multocida (strain Pm70)
Q6LN85 6.41e-128 369 62 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Photobacterium profundum (strain SS9)
B0UVZ8 8.64e-127 366 61 1 289 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Histophilus somni (strain 2336)
Q89AY0 1.04e-125 363 56 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A5UAN5 2.98e-125 362 60 1 298 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Haemophilus influenzae (strain PittEE)
A5UG62 6.21e-125 361 59 1 298 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Haemophilus influenzae (strain PittGG)
Q7MIL2 2.44e-124 360 62 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Vibrio vulnificus (strain YJ016)
Q0I260 5.59e-124 359 59 1 289 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Histophilus somni (strain 129Pt)
P43797 8.56e-124 358 59 1 298 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8DBB0 1.92e-123 357 61 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Vibrio vulnificus (strain CMCP6)
A3N0Q9 8.18e-123 356 60 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q4QNT3 4.88e-122 354 59 1 298 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Haemophilus influenzae (strain 86-028NP)
B0BPI4 7.61e-122 353 59 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GXP5 8.96e-122 353 59 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q058B1 3.49e-121 352 58 1 272 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q7VM87 6.09e-121 351 57 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
C3LPG2 9.45e-121 350 58 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Vibrio cholerae serotype O1 (strain M66-2)
Q9KQ47 9.45e-121 350 58 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F699 7.22e-120 348 58 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A1SVX2 3.57e-115 336 57 1 287 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q60B13 8.96e-112 328 56 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q0VRH4 2.62e-111 327 56 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4ZW75 8.9e-110 323 55 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pseudomonas syringae pv. syringae (strain B728a)
A4VN86 7.98e-109 320 55 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Stutzerimonas stutzeri (strain A1501)
B1JDB7 2.57e-107 317 54 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pseudomonas putida (strain W619)
Q48LD5 5.28e-107 315 54 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A4XSW1 9.42e-107 315 54 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pseudomonas mendocina (strain ymp)
Q9I4W3 3.49e-106 313 56 2 292 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B8CMS5 4.11e-104 308 51 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella piezotolerans (strain WP3 / JCM 13877)
A1WZ50 9.78e-104 308 53 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Halorhodospira halophila (strain DSM 244 / SL1)
A8H415 1.16e-102 305 52 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A9L573 1.34e-102 305 52 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella baltica (strain OS195)
A6WPI6 1.34e-102 305 52 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella baltica (strain OS185)
A3D5N2 1.34e-102 305 52 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E724 1.34e-102 305 52 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella baltica (strain OS223)
C5BQD1 6.92e-101 300 51 2 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Teredinibacter turnerae (strain ATCC 39867 / T7901)
A0KVS0 2.71e-100 298 51 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella sp. (strain ANA-3)
Q8EFT7 2.86e-100 298 51 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HU08 2.89e-100 298 51 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella sp. (strain MR-7)
Q082V3 3.67e-100 298 51 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella frigidimarina (strain NCIMB 400)
Q12NF7 4.1e-100 298 51 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q0HHQ6 4.72e-100 298 51 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella sp. (strain MR-4)
Q21HE7 6.61e-100 298 51 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q15SZ4 1.25e-99 297 47 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q1QTP6 1.91e-99 296 51 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q3J869 2.22e-99 296 51 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B3PC19 2.75e-98 293 52 3 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Cellvibrio japonicus (strain Ueda107)
B8GN57 3.35e-98 293 53 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A1RKF2 1.3e-97 292 50 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella sp. (strain W3-18-1)
A4Y644 1.3e-97 292 50 1 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
C0QT41 1.06e-96 290 48 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Persephonella marina (strain DSM 14350 / EX-H1)
Q5QU03 3.85e-96 288 50 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1AVV3 1.07e-95 287 48 3 297 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Ruthia magnifica subsp. Calyptogena magnifica
Q9JZR4 2.92e-95 286 50 3 293 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q0A5S1 4.87e-95 285 52 3 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q9JUU9 1.7e-94 284 50 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5P838 1.7e-94 284 50 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B2V6F1 3.24e-94 283 47 3 286 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Sulfurihydrogenibium sp. (strain YO3AOP1)
A1KTJ9 4.21e-94 283 49 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M4C8 4.9e-94 283 50 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Neisseria meningitidis serogroup C (strain 053442)
A1U1A6 1.15e-93 281 50 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q3SJU8 1.51e-93 281 51 2 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thiobacillus denitrificans (strain ATCC 25259)
B5ELM5 2.71e-93 281 52 2 290 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J6C4 2.71e-93 281 52 2 290 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q5F849 3.19e-93 280 49 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q4FVD6 4.36e-92 278 49 2 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A1K4F8 6.18e-92 277 51 2 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Azoarcus sp. (strain BH72)
C1DD55 1.05e-91 276 50 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Laribacter hongkongensis (strain HLHK9)
A4G724 1.24e-91 276 47 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Herminiimonas arsenicoxydans
A5WHC3 2.09e-91 276 48 2 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Psychrobacter sp. (strain PRwf-1)
Q5WUD4 6.98e-90 272 50 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Legionella pneumophila (strain Lens)
Q5ZT51 6.98e-90 272 50 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
B1Y7F0 7.45e-90 272 47 2 289 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B5YKK4 1.08e-89 271 45 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A2SIX7 1.74e-89 271 47 2 289 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A5IEB3 3.35e-89 270 49 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Legionella pneumophila (strain Corby)
Q83CA6 3.19e-88 268 45 2 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDT3 3.19e-88 268 45 2 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFS0 3.19e-88 268 45 2 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Coxiella burnetii (strain Dugway 5J108-111)
A1ATI8 5.43e-88 267 46 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q47HS9 7.95e-88 267 48 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Dechloromonas aromatica (strain RCB)
Q0AI27 1.87e-86 263 50 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B6IN13 1.23e-85 261 47 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rhodospirillum centenum (strain ATCC 51521 / SW)
B3E936 1.87e-85 261 46 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q11JT7 2.48e-85 260 47 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chelativorans sp. (strain BNC1)
Q0BYG4 3.84e-85 260 50 3 273 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Hyphomonas neptunium (strain ATCC 15444)
Q8Y099 4.71e-85 260 46 2 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A0LEA7 5.27e-85 259 44 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B9M380 7.22e-85 259 46 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A4SX51 3.8e-84 258 46 3 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q2LTA1 4.34e-84 257 47 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Syntrophus aciditrophicus (strain SB)
B5EGX4 8.26e-84 256 47 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
P58207 8.8e-84 256 45 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
C6E9Q9 8.81e-84 256 47 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Geobacter sp. (strain M21)
Q2Y8S8 1.31e-83 256 51 2 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q6AR63 1.51e-83 256 44 2 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q82SD7 2.15e-83 256 50 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q74GT6 2.37e-83 255 46 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A5GD89 2.88e-83 255 46 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Geotalea uraniireducens (strain Rf4)
A7HX36 3.08e-83 255 47 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q9A900 3.86e-83 255 45 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A1W4S3 4.78e-83 255 45 4 301 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidovorax sp. (strain JS42)
B9MER6 4.78e-83 255 45 4 301 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidovorax ebreus (strain TPSY)
Q21WN2 1.19e-82 254 45 3 300 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q39Z67 1.38e-82 253 46 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
O29352 1.57e-82 253 45 4 289 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8G1R0 1.59e-82 253 44 3 293 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Brucella suis biovar 1 (strain 1330)
A5VPI5 6.96e-82 252 44 3 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YG60 6.96e-82 252 44 3 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57E96 6.96e-82 252 44 3 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Brucella abortus biovar 1 (strain 9-941)
B4RCW4 7.26e-82 252 45 3 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Phenylobacterium zucineum (strain HLK1)
Q3A1U7 1.03e-81 251 46 2 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A8LKQ5 6.26e-81 249 46 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q7VXZ8 1.56e-80 248 45 2 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8D2M3 2.58e-80 248 42 4 280 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Wigglesworthia glossinidia brevipalpis
A9IRK3 2.86e-80 248 41 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bartonella tribocorum (strain CIP 105476 / IBS 506)
A9HIW2 3.86e-80 247 43 1 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A5FZS7 4.62e-80 247 45 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidiphilium cryptum (strain JF-5)
A4WNS1 1.13e-79 246 44 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q8PXL7 1.96e-79 245 42 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B8DKU0 2.9e-79 245 43 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
O67216 7.04e-79 244 45 4 289 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Aquifex aeolicus (strain VF5)
Q8THP1 8.59e-79 244 43 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q46DC4 5.16e-78 242 42 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q3APU0 1.3e-77 241 41 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chlorobium chlorochromatii (strain CaD3)
A5EXM4 1.73e-77 241 46 4 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Dichelobacter nodosus (strain VCS1703A)
A1US27 2.04e-77 240 39 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A0LDB5 2.16e-77 240 44 3 287 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A9A656 3.53e-77 239 43 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q57695 1.26e-76 238 43 4 293 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q310Q2 1.91e-76 238 41 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A1VCZ9 2e-76 238 44 4 290 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitratidesulfovibrio vulgaris (strain DP4)
Q72AX2 2e-76 238 44 4 290 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q04796 2.69e-76 237 45 3 271 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bacillus subtilis (strain 168)
A8MF40 3.93e-76 237 43 5 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Alkaliphilus oremlandii (strain OhILAs)
A6VJM9 5.57e-76 236 42 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A7Z4U8 9.28e-76 236 44 2 270 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q5LMK7 1.51e-75 235 44 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A0B7E1 1.99e-75 235 43 2 280 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
B4SE03 2.05e-75 235 41 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A4FYQ3 2.93e-75 234 43 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q9RH76 4.88e-75 234 44 3 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q07607 4.91e-75 234 43 4 293 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rhizobium meliloti
Q3B2G4 5.68e-75 234 42 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B3EH29 9.77e-75 234 41 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q6G091 1.06e-74 233 40 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bartonella quintana (strain Toulouse)
A7I0Y0 2.25e-74 233 41 4 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A6US71 2.3e-74 232 42 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
B3EMS4 5.18e-74 232 41 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chlorobium phaeobacteroides (strain BS1)
A7GYB0 5.3e-74 232 40 4 298 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Campylobacter curvus (strain 525.92)
Q2IGX5 6.06e-74 231 44 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Anaeromyxobacter dehalogenans (strain 2CP-C)
A6Q8F8 1.19e-73 231 43 6 299 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Sulfurovum sp. (strain NBC37-1)
Q9KC32 1.37e-73 231 45 2 275 3 dapA1 4-hydroxy-tetrahydrodipicolinate synthase 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q4FLS1 1.84e-73 230 41 5 304 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pelagibacter ubique (strain HTCC1062)
Q2G8D6 1.99e-73 230 43 3 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
B1LTD9 2.52e-73 230 44 3 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q5FUW9 3e-73 230 43 2 289 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Gluconobacter oxydans (strain 621H)
B4UHY1 3.11e-73 229 44 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Anaeromyxobacter sp. (strain K)
Q2NHW2 4.84e-73 229 41 2 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
B8JAN5 5.9e-73 229 44 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B6JGA4 9.29e-73 228 44 3 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q2N9J7 1.57e-72 228 43 3 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Erythrobacter litoralis (strain HTCC2594)
A7H773 1.9e-72 228 44 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Anaeromyxobacter sp. (strain Fw109-5)
A5ULF8 2.21e-72 228 40 3 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A7ZDQ5 2.51e-72 228 39 6 300 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Campylobacter concisus (strain 13826)
A4SG05 5.21e-72 226 40 3 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A6Q2V4 5.4e-72 226 43 4 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitratiruptor sp. (strain SB155-2)
B6YQ20 7.95e-72 226 42 6 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Azobacteroides pseudotrichonymphae genomovar. CFP2
C6BSH4 9.95e-72 226 40 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q8KC06 2.56e-71 225 41 4 285 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B3QM33 4.31e-71 224 39 4 297 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q8TUZ4 5.25e-71 224 43 6 297 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q07M65 6.29e-71 224 44 3 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rhodopseudomonas palustris (strain BisA53)
Q28WG2 7.91e-71 223 41 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Jannaschia sp. (strain CCS1)
Q92R55 8.75e-71 223 42 4 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rhizobium meliloti (strain 1021)
Q16BK4 1.29e-70 223 44 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B9K865 1.44e-70 223 40 4 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B4S5J5 1.46e-70 223 41 3 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q1GSC8 1.58e-70 223 41 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A0RP26 2.02e-70 223 41 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Campylobacter fetus subsp. fetus (strain 82-40)
Q8EQJ1 3.27e-70 222 40 2 272 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q6LZP8 3.65e-70 222 42 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A7HJ56 4.14e-70 221 42 4 286 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q2FNR0 4.62e-70 221 42 5 287 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
A8ET60 5.75e-70 221 42 7 279 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Aliarcobacter butzleri (strain RM4018)
A6LA57 6.96e-70 221 42 7 284 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A0PZM3 8.2e-70 221 40 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Clostridium novyi (strain NT)
B9MRD1 8.31e-70 221 40 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B1LBR1 1.09e-69 221 39 4 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermotoga sp. (strain RQ2)
A1BE04 1.17e-69 221 41 4 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A5IM62 1.3e-69 220 39 4 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
C5CHX9 1.31e-69 220 38 4 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
Q8UGL3 1.58e-69 220 41 5 297 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1QL43 1.64e-69 220 42 3 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A5D2Q5 1.72e-69 220 44 1 256 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B4U7D7 2.04e-69 220 39 4 289 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Hydrogenobaculum sp. (strain Y04AAS1)
Q1INQ6 2.2e-69 220 40 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Koribacter versatilis (strain Ellin345)
A8FLL9 2.84e-69 219 37 6 298 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9X1K9 3.05e-69 219 39 4 295 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A4XJU0 3.91e-69 219 40 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B8GKG7 4.54e-69 219 43 3 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
A6UVG7 6.46e-69 218 39 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
B0K4I3 6.76e-69 219 42 4 278 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermoanaerobacter sp. (strain X514)
B0KAL7 6.76e-69 219 42 4 278 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B9KY71 1.26e-68 218 41 3 281 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
O26892 2.56e-68 217 41 1 263 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B0SL58 3.34e-68 217 40 3 278 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SCT0 3.34e-68 217 40 3 278 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q1MPX7 4.12e-68 217 39 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Lawsonia intracellularis (strain PHE/MN1-00)
Q5HUY6 4.2e-68 217 37 6 298 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Campylobacter jejuni (strain RM1221)
A1VZF4 4.2e-68 217 37 6 298 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q836D1 4.37e-68 216 41 4 286 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Enterococcus faecalis (strain ATCC 700802 / V583)
Q8F132 4.72e-68 217 39 3 279 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72U22 4.72e-68 217 39 3 279 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q9PPB4 5.05e-68 216 37 6 298 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B9KFX0 5.94e-68 216 38 6 299 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q2RJK7 7.4e-68 216 42 2 287 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B9KI57 1.06e-67 216 40 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Anaplasma marginale (strain Florida)
Q5PB64 1.08e-67 216 40 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Anaplasma marginale (strain St. Maries)
B1GYN1 1.6e-67 215 39 4 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Endomicrobium trichonymphae
B2RMB9 1.74e-67 215 40 2 285 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q12ZG2 2.47e-67 214 39 2 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
A3CVI7 3.38e-67 214 41 3 280 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A6L5G7 3.59e-67 214 42 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q71ZN5 5.18e-67 214 41 4 272 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Listeria monocytogenes serotype 4b (strain F2365)
C1L2Z1 5.18e-67 214 41 4 272 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Listeria monocytogenes serotype 4b (strain CLIP80459)
A7H443 6.21e-67 214 36 6 298 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A3DE17 6.31e-67 213 40 4 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q6G468 6.63e-67 213 39 3 293 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A4J5V5 9.02e-67 213 42 3 283 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A0AIN8 1.2e-66 213 41 4 272 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8RBI5 1.45e-66 213 39 5 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B0JL91 2.43e-66 212 42 3 284 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q9ZM13 2.49e-66 212 39 3 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Helicobacter pylori (strain J99 / ATCC 700824)
Q891S3 2.7e-66 212 39 4 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Clostridium tetani (strain Massachusetts / E88)
Q2JWL7 2.73e-66 212 39 2 287 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechococcus sp. (strain JA-3-3Ab)
B1I383 3.08e-66 212 41 2 273 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Desulforudis audaxviator (strain MP104C)
Q5V5D4 3.39e-66 212 41 2 276 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
C1F658 3.95e-66 212 41 4 286 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q7M7L6 4.53e-66 211 38 6 298 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B5Z6I0 7.52e-66 211 39 3 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Helicobacter pylori (strain G27)
B6JL09 1.47e-65 210 39 3 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Helicobacter pylori (strain P12)
A2SQU8 1.92e-65 210 41 6 290 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
Q17WU7 2.1e-65 210 39 3 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Helicobacter acinonychis (strain Sheeba)
Q92BS0 2.16e-65 209 41 4 272 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8DE74 2.31e-65 209 41 4 272 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Listeria monocytogenes serotype 4a (strain HCC23)
Q8Y766 2.93e-65 209 40 4 272 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A6H0M8 6.31e-65 208 41 4 276 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q6MDD9 8.19e-65 208 38 2 278 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Protochlamydia amoebophila (strain UWE25)
B3QUT2 8.5e-65 208 41 3 280 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q3ISQ0 8.8e-65 208 42 3 281 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A5V3L9 9.16e-65 208 43 2 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
O25657 9.63e-65 208 39 3 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Helicobacter pylori (strain ATCC 700392 / 26695)
B2USR7 1.04e-64 208 39 3 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Helicobacter pylori (strain Shi470)
A9KHY6 2.2e-64 207 37 3 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q2JQ67 3.38e-64 207 38 2 287 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q1CU72 4.52e-64 206 39 3 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Helicobacter pylori (strain HPAG1)
Q5NPL6 6.84e-64 206 40 2 290 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q3Z7V3 3.02e-63 204 43 4 279 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q97D80 1.2e-62 202 35 2 276 3 dapA2 4-hydroxy-tetrahydrodipicolinate synthase 2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q3ZXV3 1.85e-62 202 43 4 279 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Dehalococcoides mccartyi (strain CBDB1)
Q1WU86 2.79e-62 201 37 4 286 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Ligilactobacillus salivarius (strain UCC118)
A9NGC2 4.75e-62 201 39 5 278 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acholeplasma laidlawii (strain PG-8A)
A5FQT5 5.22e-62 201 43 4 279 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q97GI9 6.64e-62 201 41 3 292 3 dapA1 4-hydroxy-tetrahydrodipicolinate synthase 1 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q0SRS5 8.38e-62 200 37 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Clostridium perfringens (strain SM101 / Type A)
Q0TP55 9.23e-62 200 37 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q67P59 1.13e-61 200 40 4 290 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8XJ56 1.22e-61 200 37 3 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Clostridium perfringens (strain 13 / Type A)
Q6MRM9 1.37e-61 200 38 2 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A5FE82 9.34e-61 197 40 4 280 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q7VFP9 1.15e-60 197 40 6 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A3CN43 1.48e-60 197 38 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus sanguinis (strain SK36)
A2RJL6 1.58e-60 197 38 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Lactococcus lactis subsp. cremoris (strain MG1363)
A8AXI2 3.23e-60 197 37 5 283 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q3YSK1 4.98e-60 196 36 3 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Ehrlichia canis (strain Jake)
Q02XU7 1.1e-59 195 38 3 273 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Lactococcus lactis subsp. cremoris (strain SK11)
C1CRD6 1.34e-59 195 38 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus pneumoniae (strain Taiwan19F-14)
Q9KA91 2.1e-59 194 39 4 272 3 dapA2 4-hydroxy-tetrahydrodipicolinate synthase 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B7IF13 2.16e-59 194 36 4 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermosipho africanus (strain TCF52B)
Q8P9V6 4.07e-59 194 39 2 284 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q97R25 6.17e-59 194 38 4 275 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B1IBH4 6.17e-59 194 38 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus pneumoniae (strain Hungary19A-6)
B5E4D5 6.17e-59 194 38 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus pneumoniae serotype 19F (strain G54)
C1CE08 6.66e-59 193 38 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus pneumoniae (strain JJA)
B8ZPG7 6.66e-59 193 38 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
A4VU96 6.95e-59 193 38 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus suis (strain 05ZYH33)
A4W0I7 6.95e-59 193 38 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus suis (strain 98HAH33)
C1CK93 7.02e-59 193 38 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus pneumoniae (strain P1031)
C1C6Z0 7.02e-59 193 38 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus pneumoniae (strain 70585)
Q5MZT3 1.06e-58 192 40 3 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31M42 1.06e-58 192 40 3 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B2IPH2 3.14e-58 192 37 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus pneumoniae (strain CGSP14)
Q8YQY1 3.7e-58 191 41 2 257 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A8Z624 4.6e-58 191 37 5 281 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Karelsulcia muelleri (strain GWSS)
Q8DPZ9 8.26e-58 191 37 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04KR9 8.26e-58 191 37 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B8HYL7 1.01e-57 190 40 3 285 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q5FKQ9 1.09e-57 190 36 4 285 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B2G6M9 1.21e-57 190 37 5 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJ58 1.21e-57 190 37 5 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Limosilactobacillus reuteri (strain DSM 20016)
Q30R77 1.47e-57 189 38 7 299 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q04U80 2.57e-57 189 37 4 290 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q03K16 3.2e-57 189 38 4 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q053P3 3.71e-57 188 37 4 290 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
A0LZ30 4.09e-57 188 37 3 281 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
B0THT2 4.54e-57 188 39 2 268 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A5GQ13 4.61e-57 188 38 4 295 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechococcus sp. (strain RCC307)
Q9CF61 4.65e-57 188 38 3 272 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Lactococcus lactis subsp. lactis (strain IL1403)
Q8PLN5 9.67e-57 187 40 2 284 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Xanthomonas axonopodis pv. citri (strain 306)
B1YJ39 1.11e-56 187 38 2 289 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q04FS1 1.17e-56 187 36 5 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q03CW3 3.35e-56 186 38 3 277 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3W7E5 3.35e-56 186 38 3 277 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Lacticaseibacillus casei (strain BL23)
B2IT87 4.81e-56 186 41 2 252 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8DJK4 7.26e-56 185 37 3 281 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q87AT3 4.35e-55 183 39 2 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B4SRX7 4.36e-55 183 39 2 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Stenotrophomonas maltophilia (strain R551-3)
A6LP58 7.83e-55 182 36 6 286 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q2GG09 9.76e-55 182 36 3 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q0IE16 1.44e-54 182 40 3 279 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechococcus sp. (strain CC9311)
Q9PER5 1.63e-54 182 39 2 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Xylella fastidiosa (strain 9a5c)
Q2S3M1 2.54e-54 181 36 4 284 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salinibacter ruber (strain DSM 13855 / M31)
Q11VI2 3.25e-54 181 36 2 270 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
B2FL61 3.86e-54 181 40 4 276 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Stenotrophomonas maltophilia (strain K279a)
Q8DUE5 4.72e-54 181 36 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q1RIJ3 5.46e-54 180 33 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia bellii (strain RML369-C)
Q55513 8.86e-54 180 42 3 253 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B2GC11 1.28e-53 180 37 4 285 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A8YUT3 2.42e-53 179 35 4 285 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Lactobacillus helveticus (strain DPC 4571)
A8EYZ4 4.69e-53 178 34 3 285 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia canadensis (strain McKiel)
A8GWS1 5.16e-53 178 33 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia bellii (strain OSU 85-389)
B0C142 5.75e-53 177 39 3 268 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acaryochloris marina (strain MBIC 11017)
Q03HT2 1.28e-52 177 34 4 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B9DS79 1.53e-52 177 36 4 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q8G527 1.64e-52 177 38 3 286 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bifidobacterium longum (strain NCC 2705)
B3DTC8 1.64e-52 177 38 3 286 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bifidobacterium longum (strain DJO10A)
B2A3B2 2.46e-52 176 37 3 273 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
C0R176 1.05e-51 174 33 2 293 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
A8G7F8 1.1e-51 174 39 3 284 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain MIT 9215)
Q9AKE4 2.14e-51 174 31 3 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A9FHA5 2.45e-51 174 40 4 289 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Sorangium cellulosum (strain So ce56)
Q8CP96 4e-50 170 36 5 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPE7 6.41e-50 170 36 5 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8GNF1 1.29e-49 169 30 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia akari (strain Hartford)
A2BTN4 1.4e-49 169 39 4 282 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain AS9601)
A3PFE1 1.4e-49 169 37 4 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain MIT 9301)
O05969 1.46e-49 169 30 3 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia prowazekii (strain Madrid E)
B1MZM8 2.28e-49 168 36 5 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leuconostoc citreum (strain KM20)
Q317Y9 3.3e-49 168 38 3 272 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain MIT 9312)
Q46ID7 3.48e-49 168 38 3 258 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain NATL2A)
Q4ULR2 3.88e-49 168 31 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B9EBZ6 5.12e-49 167 36 4 276 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Macrococcus caseolyticus (strain JCSC5402)
Q4L6A0 1.36e-48 166 35 5 273 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus haemolyticus (strain JCSC1435)
Q8NWS5 1.73e-48 166 34 6 297 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain MW2)
Q6G9G6 1.73e-48 166 34 6 297 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain MSSA476)
A5GHT4 2.01e-48 166 41 3 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechococcus sp. (strain WH7803)
A8GS25 2.34e-48 166 31 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia rickettsii (strain Sheila Smith)
B0BXJ1 2.34e-48 166 31 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia rickettsii (strain Iowa)
Q9AKJ9 2.34e-48 166 31 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia rickettsii
Q6GH13 2.71e-48 166 34 6 297 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain MRSA252)
A2BZ39 3.33e-48 166 36 3 291 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain MIT 9515)
A8Z3X3 3.46e-48 165 35 6 285 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain USA300 / TCH1516)
A6QGU6 3.46e-48 165 35 6 285 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain Newman)
Q5HG25 3.46e-48 165 35 6 285 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain COL)
Q9EZ12 3.46e-48 165 35 6 285 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH43 3.46e-48 165 35 6 285 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain USA300)
Q7UA33 3.78e-48 166 38 3 283 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Parasynechococcus marenigrum (strain WH8102)
A8F1K3 4.59e-48 165 30 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia massiliae (strain Mtu5)
Q92I25 5.4e-48 165 30 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PNF5 7.06e-48 164 30 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia africae (strain ESF-5)
C4L2D2 8.07e-48 164 32 2 288 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q9AKQ3 1.03e-47 164 30 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia montanensis
P63948 1.42e-47 164 34 6 297 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain N315)
P63947 1.42e-47 164 34 6 297 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ISS7 1.42e-47 164 34 6 297 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain JH9)
A6U1L6 1.42e-47 164 34 6 297 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain JH1)
A7X271 1.42e-47 164 34 6 297 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YXX4 2.53e-47 163 34 6 286 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain bovine RF122 / ET3-1)
B9DP23 2.55e-47 163 35 5 292 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus carnosus (strain TM300)
C4K288 2.75e-47 163 30 3 296 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia peacockii (strain Rustic)
Q7UZK9 4.99e-46 160 36 3 279 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q03YE2 5.79e-46 159 35 3 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q49XJ7 5.69e-45 157 33 4 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7V990 7.26e-45 157 39 2 252 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain MIT 9313)
A9BD97 7.34e-45 157 38 5 274 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain MIT 9211)
A2C5R9 8.25e-45 157 39 2 252 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain MIT 9303)
Q5SJQ1 2.75e-44 155 31 5 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q6NGP4 2.92e-44 155 38 1 234 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
O86841 5.55e-44 154 36 2 271 3 dapA2 4-hydroxy-tetrahydrodipicolinate synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q72K27 7.24e-44 154 31 5 294 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q3B0T8 8.88e-44 154 37 3 284 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechococcus sp. (strain CC9902)
P49423 9.88e-44 154 36 4 285 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q8RQM8 1.16e-42 151 35 6 298 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q3ANI5 2.64e-42 150 38 3 283 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechococcus sp. (strain CC9605)
Q42948 2.75e-42 152 34 5 287 2 DHPS1 4-hydroxy-tetrahydrodipicolinate synthase, chloroplastic Nicotiana tabacum
A0LV15 2.84e-42 150 33 2 269 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
B8DWI2 3.46e-42 150 37 2 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bifidobacterium animalis subsp. lactis (strain AD011)
P19808 1.66e-40 145 35 2 286 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
C3PH04 1.93e-40 145 35 4 281 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
B1VDC4 1.96e-40 145 34 4 287 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
Q9FVC8 4.32e-40 146 35 7 272 1 DHDPS2 4-hydroxy-tetrahydrodipicolinate synthase 2, chloroplastic Arabidopsis thaliana
Q9LZX6 1.04e-39 145 35 7 272 1 DHDPS1 4-hydroxy-tetrahydrodipicolinate synthase 1, chloroplastic Arabidopsis thaliana
Q9CBW4 1.91e-39 143 37 1 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycobacterium leprae (strain TN)
B8ZRR3 1.91e-39 143 37 1 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycobacterium leprae (strain Br4923)
Q4JV64 3.73e-39 142 32 4 306 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Corynebacterium jeikeium (strain K411)
P9WP25 7.73e-39 141 35 1 229 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WP24 7.73e-39 141 35 1 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U6A6 7.73e-39 141 35 1 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AFL5 7.73e-39 141 35 1 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KM94 7.73e-39 141 35 1 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P63946 7.73e-39 141 35 1 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q42800 2.3e-38 140 33 6 271 2 DHPS1 4-hydroxy-tetrahydrodipicolinate synthase, chloroplastic Glycine max
Q39535 8.78e-38 140 33 7 271 3 DAPA 4-hydroxy-tetrahydrodipicolinate synthase, chloroplastic Coix lacryma-jobi
P24846 9.07e-38 140 34 6 271 1 None 4-hydroxy-tetrahydrodipicolinate synthase 1, chloroplastic Triticum aestivum
P26259 1.2e-37 140 33 7 271 1 None 4-hydroxy-tetrahydrodipicolinate synthase, chloroplastic Zea mays
A6W828 1.39e-36 135 34 3 270 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q73VZ7 2.53e-36 134 34 1 235 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A4TCJ3 1.71e-35 132 35 1 232 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycolicibacterium gilvum (strain PYR-GCK)
P24847 4.51e-35 133 33 6 273 1 None 4-hydroxy-tetrahydrodipicolinate synthase 2, chloroplastic Triticum aestivum
P39359 8.17e-35 130 28 4 298 1 yjhH Probable 2-dehydro-3-deoxy-D-pentonate aldolase YjhH Escherichia coli (strain K12)
Q9X9W0 1.73e-34 130 32 3 270 3 dapA1 4-hydroxy-tetrahydrodipicolinate synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6AA18 4.98e-32 123 30 4 283 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Cutibacterium acnes (strain DSM 16379 / KPA171202)
O69782 6.7e-32 123 31 4 277 2 dapAL Uncharacterized DapA-like lyase Rhizobium meliloti
A1S0T1 1.92e-29 116 28 3 294 3 dapAL Uncharacterized DapA-like lyase Tpen_1666 Thermofilum pendens (strain DSM 2475 / Hrk 5)
P75682 4.28e-27 110 27 2 243 1 yagE Putative 2-dehydro-3-deoxy-D-gluconate aldolase YagE Escherichia coli (strain K12)
Q5XGL6 3.39e-26 108 26 2 271 2 hoga1 4-hydroxy-2-oxoglutarate aldolase, mitochondrial Xenopus laevis
B7LRJ3 2.06e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8FD58 2.47e-25 105 26 2 277 3 nanA1 N-acetylneuraminate lyase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3YX23 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Shigella sonnei (strain Ss046)
P0A6L6 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Shigella flexneri
Q0T065 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Shigella flexneri serotype 5b (strain 8401)
Q32BB4 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Shigella dysenteriae serotype 1 (strain Sd197)
B2U1V9 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R6B5 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli (strain UTI89 / UPEC)
P0A6L4 2.63e-25 105 26 2 277 1 nanA N-acetylneuraminate lyase Escherichia coli (strain K12)
B1IQQ4 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TCP1 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGB9 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli O1:K1 / APEC
A8A535 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli O9:H4 (strain HS)
B1XHJ8 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli (strain K12 / DH10B)
C4ZSW3 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M0T7 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli O8 (strain IAI1)
B5YSV2 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6L5 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli O157:H7
B7LHT3 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli (strain 55989 / EAEC)
B7MBY7 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJV8 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZSB8 2.63e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q5M8W9 2.65e-25 106 26 2 271 2 hoga1 4-hydroxy-2-oxoglutarate aldolase, mitochondrial Xenopus tropicalis
B1LGJ0 3.69e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli (strain SMS-3-5 / SECEC)
B7NKT6 3.69e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B6I1U3 3.97e-25 105 26 2 277 3 nanA N-acetylneuraminate lyase Escherichia coli (strain SE11)
Q31W94 1.15e-24 103 25 2 277 3 nanA N-acetylneuraminate lyase Shigella boydii serotype 4 (strain Sb227)
B0TWJ4 1.21e-24 103 27 7 268 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_05445
Feature type CDS
Gene dapA
Product 4-hydroxy-tetrahydrodipicolinate synthase
Location 79903 - 80802 (strand: -1)
Length 900 (nucleotides) / 299 (amino acids)
In genomic island -

Contig

Accession ZDB_362
Length 257361 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_338
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00701 Dihydrodipicolinate synthetase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0329 Amino acid transport and metabolism (E)
Cell wall/membrane/envelope biogenesis (M)
EM 4-hydroxy-tetrahydrodipicolinate synthase/N-acetylneuraminate lyase

Kegg Ortholog Annotation(s)

Protein Sequence

MSHINDVLKGSIVAMVTPLDTQGRVDKAGLRKLVDYHVAAGTSAIVAVGTTGESATLSHQEHVDVVLATLEFAEGRIPVIAGTGANATNEAVWFTEQFENSGVAACLTVTPYYNRPSQEGLYQHFKVISENTALPQILYNVPTRTGCDMLPATVARLAKLDNIVAIKEATGNLSRVNEIKTLVNDENFILLSGDDASALDFTLLGGKGVISVTANVAAAEMAQMFDLALRGDFDRARVINNQLMDLHHTLFCEPSPSPVKWACHQLGLIAEQTLRLPLLPLTEAGQNTVGRAMKTAGIR

Flanking regions ( +/- flanking 50bp)

GTACCATTAAAATGTTGTCCTATATTTATCCGATTATGAGGGTTTCGTACATGTCACACATAAATGACGTTTTAAAAGGCAGTATTGTTGCGATGGTTACACCACTGGACACACAGGGTCGTGTTGATAAGGCGGGGCTCCGGAAATTAGTGGATTACCATGTCGCGGCAGGTACGTCCGCCATTGTGGCTGTCGGAACCACCGGGGAGTCCGCCACACTGTCACATCAGGAACATGTGGATGTGGTACTGGCGACACTGGAGTTCGCGGAAGGCCGTATTCCTGTTATTGCCGGTACCGGCGCTAACGCGACCAACGAAGCGGTCTGGTTTACTGAGCAATTTGAAAACAGCGGCGTGGCGGCATGTCTGACCGTTACCCCGTATTACAACCGTCCGTCACAGGAAGGTCTGTATCAGCACTTTAAAGTGATTTCAGAGAATACCGCATTACCGCAAATTCTGTATAATGTGCCAACGCGCACCGGCTGTGATATGTTACCTGCAACTGTTGCCCGGCTGGCAAAACTGGACAATATTGTGGCAATTAAAGAAGCGACCGGGAACTTAAGCCGTGTGAATGAAATCAAAACCCTGGTGAATGATGAAAACTTCATTCTGCTCAGCGGTGATGACGCGTCAGCACTGGATTTCACCCTCCTGGGCGGCAAAGGTGTGATTTCTGTGACAGCCAACGTGGCTGCGGCAGAGATGGCACAGATGTTTGATCTTGCCCTGCGCGGGGATTTCGACCGTGCGCGTGTGATTAATAATCAACTGATGGACCTGCATCACACATTATTCTGTGAGCCAAGCCCGTCACCGGTAAAATGGGCCTGTCATCAGCTGGGTCTGATCGCAGAGCAGACACTGCGTCTGCCGCTGTTACCGCTCACGGAAGCGGGGCAGAATACGGTCGGCCGTGCCATGAAGACGGCGGGCATACGATAATATTTTAGGGAATCTGAATGGCAACACTACTGCAAAAATCAAAGGTTACG