Homologs in group_338

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13600 FBDBKF_13600 26.4 Morganella morganii S1 dapA 4-hydroxy-tetrahydrodipicolinate synthase
EHELCC_08495 EHELCC_08495 26.4 Morganella morganii S2 dapA 4-hydroxy-tetrahydrodipicolinate synthase
NLDBIP_08820 NLDBIP_08820 26.4 Morganella morganii S4 dapA 4-hydroxy-tetrahydrodipicolinate synthase
LHKJJB_05445 LHKJJB_05445 26.4 Morganella morganii S3 dapA 4-hydroxy-tetrahydrodipicolinate synthase
HKOGLL_05470 HKOGLL_05470 26.4 Morganella morganii S5 dapA 4-hydroxy-tetrahydrodipicolinate synthase
F4V73_RS03165 F4V73_RS03165 25.3 Morganella psychrotolerans dapA 4-hydroxy-tetrahydrodipicolinate synthase
PMI_RS07620 PMI_RS07620 26.4 Proteus mirabilis HI4320 dapA 4-hydroxy-tetrahydrodipicolinate synthase

Distribution of the homologs in the orthogroup group_338

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_338

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A9HIW2 5.65e-16 80 27 11 289 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q9HS19 3.43e-15 77 26 4 226 3 dapAL Uncharacterized DapA-like lyase VNG_0444G Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R3D6 3.43e-15 77 26 4 226 3 dapAL Uncharacterized DapA-like lyase OE_1665R Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
A9FHA5 6e-14 74 31 7 227 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Sorangium cellulosum (strain So ce56)
Q5HPE7 8.22e-14 73 22 5 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A5FZS7 1.24e-13 73 28 10 283 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidiphilium cryptum (strain JF-5)
Q8EQJ1 1.85e-13 72 30 5 174 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P75682 3.01e-13 72 25 5 231 1 yagE Putative 2-dehydro-3-deoxy-D-gluconate aldolase YagE Escherichia coli (strain K12)
A5WHC3 4.17e-13 72 27 7 223 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Psychrobacter sp. (strain PRwf-1)
A0LDB5 4.51e-13 71 25 7 234 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q4L6A0 5.9e-13 71 24 6 231 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus haemolyticus (strain JCSC1435)
A3CVI7 1.4e-12 70 23 5 233 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
B6EJT2 2.17e-12 69 27 6 221 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Aliivibrio salmonicida (strain LFI1238)
B9DP23 3.11e-12 69 26 7 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus carnosus (strain TM300)
B5FGX4 3.91e-12 68 29 5 185 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Aliivibrio fischeri (strain MJ11)
Q5E3I3 5.72e-12 68 29 5 185 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q1JUQ0 6.05e-12 68 42 2 100 1 araD L-2-keto-3-deoxyarabonate dehydratase Azospirillum brasilense
Q49XJ7 9.28e-12 67 25 8 235 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q15SZ4 1.04e-11 67 37 3 108 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q9A900 1.44e-11 67 26 7 226 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A7Z4U8 1.71e-11 67 36 3 110 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q04796 1.97e-11 67 35 3 110 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bacillus subtilis (strain 168)
Q21HE7 2.07e-11 67 26 7 253 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8CP96 2.1e-11 67 21 5 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
B1JDB7 2.16e-11 67 32 1 101 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pseudomonas putida (strain W619)
A9A656 2.28e-11 66 25 7 228 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A6VJM9 2.8e-11 66 26 8 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q2FNR0 2.82e-11 66 22 3 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
C5CU29 3.51e-11 66 24 7 245 3 Vapar_1729 Probable 5-dehydro-4-deoxyglucarate dehydratase Variovorax paradoxus (strain S110)
C5CHX9 3.56e-11 66 25 11 278 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
B9KY71 4.13e-11 66 28 6 216 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A4FYQ3 4.46e-11 65 24 7 226 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A1U1A6 5.84e-11 65 26 7 224 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
C5BQD1 5.91e-11 65 25 6 220 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Teredinibacter turnerae (strain ATCC 39867 / T7901)
A1JL07 9.61e-11 65 25 4 219 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C3LPG2 1e-10 64 23 6 248 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Vibrio cholerae serotype O1 (strain M66-2)
Q9KQ47 1e-10 64 23 6 248 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A4WNS1 1.08e-10 64 26 7 241 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q28WG2 1.28e-10 64 23 6 221 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Jannaschia sp. (strain CCS1)
A5F699 1.43e-10 64 24 5 219 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P39359 1.46e-10 64 25 5 235 1 yjhH Probable 2-dehydro-3-deoxy-D-pentonate aldolase YjhH Escherichia coli (strain K12)
A8AQB6 1.51e-10 64 35 2 99 3 nanA N-acetylneuraminate lyase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q891S3 1.54e-10 64 23 8 222 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Clostridium tetani (strain Massachusetts / E88)
Q082V3 1.57e-10 64 35 1 90 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella frigidimarina (strain NCIMB 400)
C4L2D2 1.61e-10 64 25 8 248 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
B2RMB9 1.84e-10 64 23 6 239 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q9KA91 1.91e-10 63 35 3 112 3 dapA2 4-hydroxy-tetrahydrodipicolinate synthase 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8TUZ4 2.13e-10 63 27 9 265 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
A5IM62 2.13e-10 63 25 7 235 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9RH76 2.29e-10 63 24 10 280 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9CLZ7 2.3e-10 63 28 6 224 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pasteurella multocida (strain Pm70)
Q9X1K9 2.53e-10 63 25 7 235 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B1LBR1 2.55e-10 63 25 7 235 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermotoga sp. (strain RQ2)
B9K865 2.94e-10 63 24 7 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q2NS74 3.03e-10 63 32 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Sodalis glossinidius (strain morsitans)
B3PC19 3.51e-10 63 30 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Cellvibrio japonicus (strain Ueda107)
B8D8P8 3.93e-10 63 27 5 219 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A1TQC1 3.99e-10 63 23 5 225 3 Aave_2587 Probable 5-dehydro-4-deoxyglucarate dehydratase Paracidovorax citrulli (strain AAC00-1)
O69782 4.1e-10 63 32 1 101 2 dapAL Uncharacterized DapA-like lyase Rhizobium meliloti
C5B7A2 4.2e-10 63 26 4 219 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Edwardsiella ictaluri (strain 93-146)
A8LKQ5 4.68e-10 62 33 3 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
P63948 5.1e-10 62 22 5 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain N315)
P63947 5.1e-10 62 22 5 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ISS7 5.1e-10 62 22 5 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain JH9)
A6U1L6 5.1e-10 62 22 5 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain JH1)
A7X271 5.1e-10 62 22 5 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain Mu3 / ATCC 700698)
B0UVZ8 5.25e-10 62 24 5 217 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Histophilus somni (strain 2336)
B9KI57 5.83e-10 62 24 9 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Anaplasma marginale (strain Florida)
A1RKF2 6.1e-10 62 32 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella sp. (strain W3-18-1)
A4Y644 6.1e-10 62 32 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B8D702 6.83e-10 62 26 5 219 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57197 6.83e-10 62 26 5 219 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5PB64 8.08e-10 62 24 9 275 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Anaplasma marginale (strain St. Maries)
Q57695 9.76e-10 62 25 7 228 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B0BPI4 9.9e-10 62 26 8 227 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q8NWS5 1.03e-09 62 22 5 228 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain MW2)
Q6G9G6 1.03e-09 62 22 5 228 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain MSSA476)
Q12NF7 1.18e-09 61 34 1 102 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A4YNH1 1.28e-09 61 24 5 237 3 BRADO1565 Probable 5-dehydro-4-deoxyglucarate dehydratase Bradyrhizobium sp. (strain ORS 278)
A3N0Q9 1.32e-09 61 25 8 227 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q83CA6 1.39e-09 61 22 5 215 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDT3 1.39e-09 61 22 5 215 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFS0 1.39e-09 61 22 5 215 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Coxiella burnetii (strain Dugway 5J108-111)
A7MP70 1.4e-09 61 30 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Cronobacter sakazakii (strain ATCC BAA-894)
B3GXP5 1.56e-09 61 26 8 227 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A1US27 1.82e-09 61 24 6 225 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q6GH13 1.83e-09 61 21 5 228 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain MRSA252)
A8Z3X3 1.9e-09 61 21 5 228 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain USA300 / TCH1516)
A6QGU6 1.9e-09 61 21 5 228 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain Newman)
Q5HG25 1.9e-09 61 21 5 228 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain COL)
Q9EZ12 1.9e-09 61 21 5 228 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH43 1.9e-09 61 21 5 228 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain USA300)
Q2S3M1 1.95e-09 61 29 3 117 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salinibacter ruber (strain DSM 13855 / M31)
Q5FUW9 2.3e-09 60 25 7 247 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Gluconobacter oxydans (strain 621H)
A5EQF2 2.3e-09 60 24 6 237 3 BBta_6487 Probable 5-dehydro-4-deoxyglucarate dehydratase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q5LMK7 2.43e-09 60 26 8 254 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A1W7E4 2.46e-09 60 22 6 243 3 Ajs_1993 Probable 5-dehydro-4-deoxyglucarate dehydratase Acidovorax sp. (strain JS42)
B9MJB2 2.46e-09 60 22 6 243 3 Dtpsy_1793 Probable 5-dehydro-4-deoxyglucarate dehydratase Acidovorax ebreus (strain TPSY)
Q9I4W3 2.56e-09 60 30 1 97 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A9L573 2.72e-09 60 32 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella baltica (strain OS195)
A6WPI6 2.72e-09 60 32 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella baltica (strain OS185)
A3D5N2 2.72e-09 60 32 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E724 2.72e-09 60 32 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella baltica (strain OS223)
A0KVS0 2.9e-09 60 31 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella sp. (strain ANA-3)
B7LKG3 2.92e-09 60 25 5 219 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q0HU08 2.96e-09 60 31 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella sp. (strain MR-7)
Q0HHQ6 2.96e-09 60 31 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella sp. (strain MR-4)
A4TMN2 3.11e-09 60 30 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Yersinia pestis (strain Pestoides F)
Q8ZCD0 3.11e-09 60 30 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Yersinia pestis
A7FG49 3.11e-09 60 30 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A6UVG7 3.94e-09 60 25 8 231 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q4QNT3 4.01e-09 60 26 6 225 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Haemophilus influenzae (strain 86-028NP)
A9IRK3 4.58e-09 60 33 2 112 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q7MIL2 4.61e-09 60 26 7 214 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Vibrio vulnificus (strain YJ016)
Q2YXX4 5.76e-09 59 21 5 228 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q3YZ74 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shigella sonnei (strain Ss046)
Q31Y13 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shigella boydii serotype 4 (strain Sb227)
B2TXQ4 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LNC8 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli (strain SMS-3-5 / SECEC)
B6I548 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli (strain SE11)
P63943 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A2X1 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O9:H4 (strain HS)
B7MYB7 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O81 (strain ED1a)
B7NQL6 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z015 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P63944 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O157:H7
B7LCL6 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli (strain 55989 / EAEC)
A7ZPS4 5.81e-09 59 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8DBB0 6.32e-09 59 31 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Vibrio vulnificus (strain CMCP6)
Q7VRT1 6.62e-09 59 32 1 82 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Blochmanniella floridana
Q8EFT7 6.77e-09 59 30 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8EMK1 6.94e-09 59 22 7 235 3 OB2841 Probable 5-dehydro-4-deoxyglucarate dehydratase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A4VN86 7.2e-09 59 29 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Stutzerimonas stutzeri (strain A1501)
B5YKK4 7.28e-09 59 23 7 241 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q1MPX7 7.35e-09 59 34 5 123 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Lawsonia intracellularis (strain PHE/MN1-00)
P42235 7.68e-09 59 24 8 234 3 ycbC Probable 5-dehydro-4-deoxyglucarate dehydratase Bacillus subtilis (strain 168)
B4RCW4 8.38e-09 59 24 8 256 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Phenylobacterium zucineum (strain HLK1)
B1LGJ0 8.53e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli (strain SMS-3-5 / SECEC)
B7NKT6 8.53e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q0I260 8.58e-09 59 30 1 99 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Histophilus somni (strain 129Pt)
B7LRJ3 8.77e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q3YX23 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Shigella sonnei (strain Ss046)
P0A6L6 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Shigella flexneri
Q0T065 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Shigella flexneri serotype 5b (strain 8401)
Q32BB4 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Shigella dysenteriae serotype 1 (strain Sd197)
B2U1V9 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R6B5 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli (strain UTI89 / UPEC)
P0A6L4 8.85e-09 59 38 1 84 1 nanA N-acetylneuraminate lyase Escherichia coli (strain K12)
B1IQQ4 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TCP1 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGB9 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli O1:K1 / APEC
A8A535 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli O9:H4 (strain HS)
B1XHJ8 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli (strain K12 / DH10B)
C4ZSW3 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M0T7 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli O8 (strain IAI1)
B5YSV2 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6L5 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli O157:H7
B7LHT3 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli (strain 55989 / EAEC)
B7MBY7 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJV8 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZSB8 8.85e-09 59 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli O139:H28 (strain E24377A / ETEC)
B5ELM5 8.85e-09 58 33 1 104 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J6C4 8.85e-09 58 33 1 104 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q8FD58 9.53e-09 58 38 1 84 3 nanA1 N-acetylneuraminate lyase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0PZM3 1.23e-08 58 21 7 223 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Clostridium novyi (strain NT)
B7I9K0 1.23e-08 58 23 6 226 3 AB57_1185 Probable 5-dehydro-4-deoxyglucarate dehydratase Acinetobacter baumannii (strain AB0057)
B7GX14 1.23e-08 58 23 6 226 3 ABBFA_002443 Probable 5-dehydro-4-deoxyglucarate dehydratase Acinetobacter baumannii (strain AB307-0294)
Q1QL43 1.3e-08 58 31 3 109 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q89HW8 1.34e-08 58 25 6 231 3 blr5871 Probable 5-dehydro-4-deoxyglucarate dehydratase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A5ULF8 1.34e-08 58 33 1 99 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
B1YJ39 1.36e-08 58 25 6 222 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A9MNY6 1.37e-08 58 36 1 84 3 nanA N-acetylneuraminate lyase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P43797 1.4e-08 58 32 2 110 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A3M3N7 1.4e-08 58 23 6 226 3 A1S_1101 Probable 5-dehydro-4-deoxyglucarate dehydratase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B6I1U3 1.41e-08 58 38 1 84 3 nanA N-acetylneuraminate lyase Escherichia coli (strain SE11)
A5UG62 1.42e-08 58 33 2 106 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Haemophilus influenzae (strain PittGG)
A5UAN5 1.45e-08 58 33 2 106 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Haemophilus influenzae (strain PittEE)
A1ATI8 1.51e-08 58 22 7 261 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
P0A6L3 1.57e-08 58 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shigella flexneri
P0A6L2 1.57e-08 58 28 2 114 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli (strain K12)
B1IWI1 1.57e-08 58 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7M7I1 1.57e-08 58 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Escherichia coli O8 (strain IAI1)
A2SQU8 1.57e-08 58 23 9 273 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
Q97D80 1.58e-08 58 22 7 240 3 dapA2 4-hydroxy-tetrahydrodipicolinate synthase 2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B5F7J9 1.62e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella agona (strain SL483)
Q8ZLQ6 1.63e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TWJ0 1.63e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella schwarzengrund (strain CVM19633)
C0PZN4 1.63e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella paratyphi C (strain RKS4594)
A9N833 1.63e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T750 1.63e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella newport (strain SL254)
B4TJR3 1.63e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella heidelberg (strain SL476)
B5RET7 1.63e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R0L2 1.63e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella enteritidis PT4 (strain P125109)
B5FIR8 1.63e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella dublin (strain CT_02021853)
Q57JC9 1.63e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella choleraesuis (strain SC-B67)
Q8Z3F0 1.65e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella typhi
B5BGP5 1.65e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella paratyphi A (strain AKU_12601)
Q5PLE9 1.65e-08 58 33 2 99 3 nanA N-acetylneuraminate lyase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q65NX1 1.7e-08 58 25 9 237 3 BLi00284 Probable 5-dehydro-4-deoxyglucarate dehydratase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q4FVD6 1.76e-08 58 26 5 218 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A6US71 1.77e-08 58 23 7 226 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
B2VE56 1.8e-08 58 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A7HX36 2.02e-08 58 24 8 267 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A9MHQ2 2.17e-08 57 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q7VM87 2.23e-08 57 37 2 87 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B8GKG7 2.26e-08 57 22 5 238 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
B0VL04 2.56e-08 57 23 6 226 3 ABSDF1408 Probable 5-dehydro-4-deoxyglucarate dehydratase Acinetobacter baumannii (strain SDF)
Q32D87 2.59e-08 57 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shigella dysenteriae serotype 1 (strain Sd197)
Q1INQ6 2.61e-08 57 28 5 181 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Koribacter versatilis (strain Ellin345)
Q2N9J7 2.78e-08 57 28 8 226 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Erythrobacter litoralis (strain HTCC2594)
Q668F7 2.91e-08 57 29 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZN71 3.06e-08 57 28 2 114 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TR62 3.06e-08 57 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salmonella schwarzengrund (strain CVM19633)
B5BB16 3.06e-08 57 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salmonella paratyphi A (strain AKU_12601)
Q5PLS1 3.06e-08 57 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A9BQU2 3.13e-08 57 23 7 247 3 Daci_0251 Probable 5-dehydro-4-deoxyglucarate dehydratase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q31W94 3.18e-08 57 36 1 84 3 nanA N-acetylneuraminate lyase Shigella boydii serotype 4 (strain Sb227)
Q8Z4R8 3.2e-08 57 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Salmonella typhi
A4WF38 3.33e-08 57 33 2 99 3 nanA N-acetylneuraminate lyase Enterobacter sp. (strain 638)
A0B7E1 3.71e-08 57 23 5 231 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q6G091 3.72e-08 57 24 9 273 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bartonella quintana (strain Toulouse)
Q492F5 4.6e-08 57 34 1 82 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Blochmanniella pennsylvanica (strain BPEN)
Q1GSC8 5.91e-08 56 28 11 227 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A8MF40 5.93e-08 56 30 5 119 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Alkaliphilus oremlandii (strain OhILAs)
B9K1N4 6.3e-08 56 26 9 231 3 Avi_5701 Probable 5-dehydro-4-deoxyglucarate dehydratase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q4ZW75 6.34e-08 56 28 1 102 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pseudomonas syringae pv. syringae (strain B728a)
A5EXM4 6.4e-08 56 32 1 82 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Dichelobacter nodosus (strain VCS1703A)
Q3J869 6.4e-08 56 25 5 218 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B9EBZ6 6.92e-08 56 24 6 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Macrococcus caseolyticus (strain JCSC5402)
A6L5G7 7.7e-08 56 28 1 107 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B0K4I3 7.77e-08 56 22 7 225 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermoanaerobacter sp. (strain X514)
B0KAL7 7.77e-08 56 22 7 225 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q1QTP6 9.03e-08 56 27 4 214 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q6G468 1.02e-07 55 31 2 112 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q46DC4 1.05e-07 55 24 7 245 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanosarcina barkeri (strain Fusaro / DSM 804)
A6TCA1 1.1e-07 55 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B1LTD9 1.13e-07 55 29 3 119 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q8XRK5 1.15e-07 55 26 12 258 3 RSp0826 Probable 5-dehydro-4-deoxyglucarate dehydratase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8F132 1.24e-07 55 23 7 235 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72U22 1.24e-07 55 23 7 235 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B9MRD1 1.3e-07 55 23 8 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q8G1R0 1.42e-07 55 23 6 229 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Brucella suis biovar 1 (strain 1330)
Q0TP55 1.5e-07 55 23 7 223 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A5VPI5 1.65e-07 55 23 6 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YG60 1.65e-07 55 23 6 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57E96 1.65e-07 55 23 6 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Brucella abortus biovar 1 (strain 9-941)
Q11GY5 1.81e-07 55 26 9 245 3 Meso_1947 Probable 5-dehydro-4-deoxyglucarate dehydratase Chelativorans sp. (strain BNC1)
Q2NHW2 1.85e-07 55 29 1 102 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q55513 1.87e-07 55 28 4 179 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B6IN13 2e-07 55 28 10 270 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rhodospirillum centenum (strain ATCC 51521 / SW)
B3E936 2.04e-07 55 25 7 262 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
C6BSH4 2.06e-07 55 32 3 107 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q92R55 2.11e-07 55 24 8 223 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rhizobium meliloti (strain 1021)
P42233 2.22e-07 55 25 9 250 3 None 5-dehydro-4-deoxyglucarate dehydratase Pseudomonas putida
Q60B13 2.31e-07 54 28 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B8DKU0 2.44e-07 54 31 3 108 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A1K4F8 2.65e-07 54 27 7 219 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Azoarcus sp. (strain BH72)
Q0SRS5 2.73e-07 54 23 7 223 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Clostridium perfringens (strain SM101 / Type A)
A7HJ56 2.85e-07 54 24 8 227 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
B0JL91 2.92e-07 54 25 5 180 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q9X9W0 3.06e-07 54 24 8 225 3 dapA1 4-hydroxy-tetrahydrodipicolinate synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8XJ56 3.08e-07 54 23 7 223 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Clostridium perfringens (strain 13 / Type A)
Q8D2M3 3.25e-07 54 24 1 102 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Wigglesworthia glossinidia brevipalpis
Q0T239 3.45e-07 54 27 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shigella flexneri serotype 5b (strain 8401)
B6YU51 3.91e-07 54 26 8 242 3 dapAL Uncharacterized DapA-like lyase TON_0506 Thermococcus onnurineus (strain NA1)
B6JGA4 4.12e-07 54 32 3 102 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q6LN85 4.17e-07 53 26 5 219 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Photobacterium profundum (strain SS9)
B4U7D7 4.42e-07 53 23 6 218 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Hydrogenobaculum sp. (strain Y04AAS1)
Q07607 4.59e-07 53 26 12 282 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rhizobium meliloti
A1VCZ9 4.64e-07 53 28 3 108 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitratidesulfovibrio vulgaris (strain DP4)
Q72AX2 4.64e-07 53 28 3 108 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B8CMS5 4.88e-07 53 28 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q9JUU9 5.15e-07 53 34 1 89 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M4C8 5.24e-07 53 34 1 89 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Neisseria meningitidis serogroup C (strain 053442)
A4XSW1 5.32e-07 53 26 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pseudomonas mendocina (strain ymp)
A1KTJ9 5.34e-07 53 34 1 89 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JZR4 5.34e-07 53 34 1 89 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q48LD5 5.52e-07 53 27 1 102 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6FFQ1 5.82e-07 53 22 11 282 1 ACIAD0130 Probable 5-dehydro-4-deoxyglucarate dehydratase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0VRH4 5.94e-07 53 24 6 216 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q9X9X7 6.43e-07 53 25 7 234 3 SCO1895 Probable 5-dehydro-4-deoxyglucarate dehydratase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A4XJU0 7.31e-07 53 21 7 218 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A4XRL4 7.51e-07 53 25 11 235 3 Pmen_1215 Probable 5-dehydro-4-deoxyglucarate dehydratase Pseudomonas mendocina (strain ymp)
Q836D1 7.67e-07 53 29 8 179 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Enterococcus faecalis (strain ATCC 700802 / V583)
Q8RBI5 8.09e-07 53 22 7 218 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A7B555 8.34e-07 53 21 5 228 1 nanA N-acetylneuraminate lyase Mediterraneibacter gnavus (strain ATCC 29149 / DSM 114966 / JCM 6515 / VPI C7-9)
Q5QU03 8.58e-07 53 24 5 212 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q07M65 9.06e-07 53 29 3 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rhodopseudomonas palustris (strain BisA53)
A1SVX2 9.7e-07 53 31 1 90 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A6H0M8 9.88e-07 53 32 0 75 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q0BYG4 1.07e-06 52 26 7 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Hyphomonas neptunium (strain ATCC 15444)
Q92WP0 1.16e-06 52 25 6 227 3 nanA N-acetylneuraminate lyase Rhizobium meliloti (strain 1021)
Q6LZP8 1.23e-06 52 23 6 227 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A8H415 1.26e-06 52 27 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
C1F658 1.29e-06 52 26 7 215 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
B1MZM8 1.3e-06 52 21 7 270 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leuconostoc citreum (strain KM20)
Q39Z67 1.33e-06 52 23 7 259 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A4SX51 1.41e-06 52 32 0 79 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q3A1U7 1.65e-06 52 28 2 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q5F849 1.67e-06 52 34 1 89 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
O05969 1.9e-06 52 23 6 238 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia prowazekii (strain Madrid E)
Q6AR63 2.13e-06 52 23 5 176 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q16BK4 2.21e-06 52 25 8 248 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q46ID7 2.3e-06 52 22 7 254 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain NATL2A)
Q3SJU8 2.43e-06 51 35 0 68 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thiobacillus denitrificans (strain ATCC 25259)
Q2G8D6 2.69e-06 51 37 1 75 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A1VMN2 3.09e-06 51 23 8 247 3 Pnap_1596 Probable 5-dehydro-4-deoxyglucarate dehydratase Polaromonas naphthalenivorans (strain CJ2)
Q8PXL7 3.28e-06 51 23 7 245 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q3YSK1 3.81e-06 51 23 7 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Ehrlichia canis (strain Jake)
Q8Y099 4.06e-06 51 30 1 91 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q03YE2 4.17e-06 51 22 10 266 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q11JT7 4.94e-06 50 23 6 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chelativorans sp. (strain BNC1)
B8GN57 5.15e-06 50 23 5 219 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A3DE17 5.2e-06 50 20 8 230 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A0LEA7 5.57e-06 50 30 3 107 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
O67216 5.8e-06 50 27 3 104 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Aquifex aeolicus (strain VF5)
Q7VXZ8 5.8e-06 50 31 0 76 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q310Q2 6.59e-06 50 27 3 115 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B1W1P9 6.82e-06 50 33 2 103 3 SGR_5617 Probable 5-dehydro-4-deoxyglucarate dehydratase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q8UGL3 7.02e-06 50 23 10 267 1 dapA 4-hydroxy-tetrahydrodipicolinate synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q74GT6 7.09e-06 50 23 7 232 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q9KC32 8.61e-06 50 32 4 112 3 dapA1 4-hydroxy-tetrahydrodipicolinate synthase 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A2SIX7 8.7e-06 50 25 6 224 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B8HYL7 8.82e-06 50 24 8 234 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B1LW44 8.85e-06 50 26 7 215 3 Mrad2831_5150 Probable 5-dehydro-4-deoxyglucarate dehydratase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
O58577 9.63e-06 50 26 11 229 3 dapAL Uncharacterized DapA-like lyase PH0847 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A6LA57 1e-05 50 24 1 108 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
O26892 1.03e-05 49 23 5 223 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A8GNF1 1.13e-05 49 23 6 238 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia akari (strain Hartford)
Q4ZNL5 1.23e-05 49 24 8 240 3 Psyr_4227 Probable 5-dehydro-4-deoxyglucarate dehydratase Pseudomonas syringae pv. syringae (strain B728a)
B5EGX4 1.31e-05 49 25 9 262 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
A4G724 1.32e-05 49 24 6 215 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Herminiimonas arsenicoxydans
Q829P9 1.43e-05 49 25 7 229 3 SAV_6360 Probable 5-dehydro-4-deoxyglucarate dehydratase 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
C6E9Q9 1.46e-05 49 25 7 220 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Geobacter sp. (strain M21)
Q2LTA1 1.49e-05 49 30 4 117 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Syntrophus aciditrophicus (strain SB)
C1DJJ0 1.52e-05 49 24 10 235 3 Avin_05220 Probable 5-dehydro-4-deoxyglucarate dehydratase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q1RIJ3 1.52e-05 49 24 8 242 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia bellii (strain RML369-C)
B0SL58 1.61e-05 49 22 6 219 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SCT0 1.61e-05 49 22 6 219 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q5V5D4 1.65e-05 49 31 4 122 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q4ULR2 1.86e-05 48 22 5 235 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q04U80 1.89e-05 48 22 6 231 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q03HT2 1.9e-05 48 30 2 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q053P3 2.02e-05 48 22 6 231 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q5FKQ9 2.13e-05 48 29 2 99 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B9M380 2.23e-05 48 23 6 231 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q89AY0 2.25e-05 48 25 2 112 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q87WJ7 2.31e-05 48 24 9 231 3 PSPTO_4549 Probable 5-dehydro-4-deoxyglucarate dehydratase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8PLN5 2.34e-05 48 35 1 80 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Xanthomonas axonopodis pv. citri (strain 306)
Q2RJK7 2.36e-05 48 31 4 116 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A8Z624 2.7e-05 48 32 0 71 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Karelsulcia muelleri (strain GWSS)
A1AVV3 2.72e-05 48 27 2 112 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Ruthia magnifica subsp. Calyptogena magnifica
P58207 2.74e-05 48 28 3 115 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q3IW19 2.93e-05 48 24 8 226 3 RHOS4_36970 Probable 5-dehydro-4-deoxyglucarate dehydratase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A5D2Q5 3.04e-05 48 26 4 175 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q5P838 3.1e-05 48 28 6 178 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1S0T1 3.18e-05 48 21 6 248 3 dapAL Uncharacterized DapA-like lyase Tpen_1666 Thermofilum pendens (strain DSM 2475 / Hrk 5)
Q8FDU7 3.25e-05 48 28 1 88 3 nanA2 N-acetylneuraminate lyase 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B9KW45 3.39e-05 48 24 8 226 3 RSKD131_3189 Probable 5-dehydro-4-deoxyglucarate dehydratase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q1IA73 3.4e-05 48 23 10 251 3 PSEEN2658 Probable 5-dehydro-4-deoxyglucarate dehydratase Pseudomonas entomophila (strain L48)
Q0A5S1 3.43e-05 48 32 0 75 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A3PQ70 3.81e-05 48 24 8 226 3 Rsph17029_3393 Probable 5-dehydro-4-deoxyglucarate dehydratase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q9CBW4 3.87e-05 48 28 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycobacterium leprae (strain TN)
B8ZRR3 3.87e-05 48 28 1 97 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycobacterium leprae (strain Br4923)
A9KHY6 3.95e-05 48 28 6 148 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A9BD97 4.07e-05 48 24 6 181 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain MIT 9211)
Q82BX4 4.62e-05 48 24 6 228 3 SAV_5580 Probable 5-dehydro-4-deoxyglucarate dehydratase 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
C1DD55 4.82e-05 47 31 1 94 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Laribacter hongkongensis (strain HLHK9)
B1GYN1 5.18e-05 47 28 3 114 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Endomicrobium trichonymphae
Q97GI9 5.77e-05 47 22 10 258 3 dapA1 4-hydroxy-tetrahydrodipicolinate synthase 1 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5JGK8 5.85e-05 47 26 9 235 3 dapAL Uncharacterized DapA-like lyase TK1237 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A9I3W2 6.27e-05 47 22 7 232 3 Bpet3876 Probable 5-dehydro-4-deoxyglucarate dehydratase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B1I383 6.76e-05 47 31 2 105 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Desulforudis audaxviator (strain MP104C)
P49423 6.89e-05 47 28 8 188 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q9UZ94 7.2e-05 47 21 8 240 3 dapAL Uncharacterized DapA-like lyase PYRAB12600 Pyrococcus abyssi (strain GE5 / Orsay)
Q3KI36 7.92e-05 47 23 8 230 3 Pfl01_0827 Probable 5-dehydro-4-deoxyglucarate dehydratase Pseudomonas fluorescens (strain Pf0-1)
B2UIZ4 7.94e-05 47 26 11 237 3 Rpic_4452 Probable 5-dehydro-4-deoxyglucarate dehydratase Ralstonia pickettii (strain 12J)
A5FE82 8.44e-05 47 29 0 75 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q88GW8 8.91e-05 47 23 9 249 3 PP_3599 5-dehydro-4-deoxyglucarate dehydratase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W516 9.24e-05 47 23 9 249 3 Pput_3098 Probable 5-dehydro-4-deoxyglucarate dehydratase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1J9C7 9.49e-05 47 23 8 231 3 PputW619_2814 Probable 5-dehydro-4-deoxyglucarate dehydratase Pseudomonas putida (strain W619)
Q3APU0 9.52e-05 47 28 1 91 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Chlorobium chlorochromatii (strain CaD3)
B0KPL8 9.76e-05 47 23 9 249 3 PputGB1_2317 Probable 5-dehydro-4-deoxyglucarate dehydratase Pseudomonas putida (strain GB-1)
A5V3L9 9.96e-05 47 34 2 89 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q3ISQ0 9.98e-05 47 23 4 229 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q1WU86 0.000108 46 32 1 78 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Ligilactobacillus salivarius (strain UCC118)
Q48E20 0.000121 46 24 9 231 3 PSPPH_4252 Probable 5-dehydro-4-deoxyglucarate dehydratase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2Y8S8 0.000127 46 32 0 68 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B2GC11 0.000159 46 25 9 233 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q8P9V6 0.000163 46 33 1 80 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9X9Q6 0.000245 45 25 5 160 1 nsaE Trans-O-hydroxybenzylidenepyruvate hydratase-aldolase Sphingobium xenophagum
Q92YS6 0.000246 45 24 11 233 3 RA0787 Probable 5-dehydro-4-deoxyglucarate dehydratase Rhizobium meliloti (strain 1021)
Q73VZ7 0.000283 45 26 1 101 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q21WN2 0.000286 45 27 1 102 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q0IE16 0.000321 45 24 6 199 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechococcus sp. (strain CC9311)
B1Y7F0 0.000353 45 32 0 74 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q3B0T8 0.000388 45 27 2 109 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Synechococcus sp. (strain CC9902)
A2C5R9 0.000388 45 27 4 134 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain MIT 9303)
Q8UB77 0.0004 45 22 6 224 1 Atu3140 Probable 5-dehydro-4-deoxyglucarate dehydratase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7V990 0.000417 45 27 4 134 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Prochlorococcus marinus (strain MIT 9313)
A1W4S3 0.000427 45 24 6 216 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidovorax sp. (strain JS42)
B9MER6 0.000427 45 24 6 216 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Acidovorax ebreus (strain TPSY)
Q8U319 0.000544 44 22 6 236 3 dapAL Uncharacterized DapA-like lyase PF0657 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8YQY1 0.000899 43 24 4 171 3 dapA 4-hydroxy-tetrahydrodipicolinate synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14530
Feature type CDS
Gene -
Product dihydrodipicolinate synthase family protein
Location 3221375 - 3222304 (strand: -1)
Length 930 (nucleotides) / 309 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_338
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00701 Dihydrodipicolinate synthetase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0329 Amino acid transport and metabolism (E)
Cell wall/membrane/envelope biogenesis (M)
EM 4-hydroxy-tetrahydrodipicolinate synthase/N-acetylneuraminate lyase

Protein Sequence

MSQQKYVGVWPVMLTPFDTKGEIDWASLERLVDWYIDAGVHGLFAACQSSEMFYLSDEETQALTCFIVEKADGRVPVVASGHTATALSQQKEQLQAMASTGVDGVIMISNRLAQVGESDDKALETLQSLTHAVPKEIDLGIYECPYPYKRLLSEEIVEWCAQSNRFTFIKDTCCSLPLIERRLALSKGSRLHLANANSQTLLASFQAGCQAYSGVMANFHPELYVWLYENWQDKPEQAALLADYLSTAAMTETLDYPACAKYHQRLIGNFATLVCRSRNSSQFENSFFPSAVNSMTALGENMKKWLSLN

Flanking regions ( +/- flanking 50bp)

TCAAGTGAAAGTGGCAGGTGATGCCATTAACTTACTGTAAGGAATTTATAATGAGTCAGCAAAAATACGTTGGTGTTTGGCCTGTGATGCTCACTCCTTTTGATACTAAAGGAGAGATTGATTGGGCGTCATTAGAGCGCCTTGTCGATTGGTATATCGATGCGGGCGTACATGGGTTATTTGCCGCCTGCCAATCAAGCGAAATGTTTTATTTGAGTGATGAAGAAACACAAGCACTCACCTGTTTTATCGTTGAAAAAGCAGATGGAAGAGTACCTGTTGTTGCTTCTGGCCATACGGCAACGGCCTTAAGCCAGCAAAAAGAACAACTGCAGGCAATGGCGAGTACCGGCGTTGATGGTGTTATTATGATCAGTAATCGCTTAGCGCAAGTGGGCGAGTCTGATGATAAGGCGCTGGAAACGCTACAATCCTTAACCCATGCTGTACCTAAAGAGATTGATTTGGGTATTTATGAATGCCCTTATCCTTACAAACGCTTGTTATCTGAAGAGATAGTAGAGTGGTGCGCACAAAGTAATCGCTTTACCTTTATTAAAGATACTTGCTGTTCTCTTCCTCTCATAGAACGTCGCTTAGCATTATCAAAAGGAAGTCGTTTGCATCTAGCCAATGCTAATAGTCAAACCTTATTAGCGTCATTCCAAGCAGGATGCCAAGCATATAGTGGTGTTATGGCTAACTTCCACCCCGAACTTTATGTCTGGCTGTATGAAAATTGGCAGGATAAACCAGAGCAAGCTGCGCTATTAGCTGATTATTTATCAACAGCTGCGATGACTGAAACGCTGGATTATCCTGCCTGCGCTAAATATCATCAGCGCCTGATCGGCAATTTCGCGACACTGGTTTGCCGCTCTCGTAATAGTAGTCAGTTTGAAAACTCATTTTTCCCTTCTGCTGTTAATAGCATGACGGCATTGGGTGAAAATATGAAGAAGTGGCTTTCGTTAAATTAATTTAGGACACAGGAGTAGGAATATGCCTTTCGTGATGAAGGAAACCCAGT