Homologs in group_288

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06920 FBDBKF_06920 100.0 Morganella morganii S1 hisC histidinol-phosphate transaminase
EHELCC_04050 EHELCC_04050 100.0 Morganella morganii S2 hisC histidinol-phosphate transaminase
NLDBIP_04050 NLDBIP_04050 100.0 Morganella morganii S4 hisC histidinol-phosphate transaminase
LHKJJB_09880 LHKJJB_09880 100.0 Morganella morganii S3 hisC histidinol-phosphate transaminase
F4V73_RS01105 F4V73_RS01105 87.2 Morganella psychrotolerans hisC histidinol-phosphate transaminase
PMI_RS03265 PMI_RS03265 67.9 Proteus mirabilis HI4320 hisC histidinol-phosphate transaminase
PMI_RS14095 PMI_RS14095 22.9 Proteus mirabilis HI4320 - valine--pyruvate transaminase

Distribution of the homologs in the orthogroup group_288

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_288

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N6I1 0.0 527 70 0 355 3 hisCD Putative histidine biosynthesis bifunctional protein HisCD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1IZ53 9e-172 485 67 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZNJ3 9.2e-172 484 67 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7UT58 1.04e-171 484 67 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LUF2 1.35e-171 484 67 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NQG9 1.51e-171 484 66 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q6D410 1.59e-171 484 66 0 346 3 hisC Histidinol-phosphate aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B6I848 2.02e-171 484 67 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SE11)
P06986 2.02e-171 484 67 0 345 1 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12)
B1X6V8 2.02e-171 484 67 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / DH10B)
C4ZSB0 2.02e-171 484 67 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M400 2.02e-171 484 67 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O8 (strain IAI1)
Q3Z0G4 3.65e-171 483 67 0 345 3 hisC Histidinol-phosphate aminotransferase Shigella sonnei (strain Ss046)
B2TYF9 4.17e-171 483 66 0 345 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A8GC78 4.83e-171 483 67 0 346 3 hisC Histidinol-phosphate aminotransferase Serratia proteamaculans (strain 568)
A8A1P5 4.86e-171 483 67 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O9:H4 (strain HS)
B7L9P8 8.03e-171 482 66 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain 55989 / EAEC)
B5YU77 1.39e-170 482 66 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q9S5G6 1.39e-170 482 66 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7
Q83KJ6 4.83e-170 480 66 0 345 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri
Q0T3A6 4.83e-170 480 66 0 345 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri serotype 5b (strain 8401)
B7MDH5 4.99e-170 480 66 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7MWU0 5.22e-170 480 66 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O81 (strain ED1a)
Q323J1 5.63e-170 480 66 0 345 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 4 (strain Sb227)
Q1RA52 7.09e-170 480 66 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain UTI89 / UPEC)
Q8FG51 7.09e-170 480 66 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TG66 7.09e-170 480 66 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7FJH1 8.03e-170 481 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66C50 1e-169 481 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZM8 1e-169 481 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B1JPW1 1.07e-169 481 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
C6DF75 2.27e-169 479 65 0 346 3 hisC Histidinol-phosphate aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B1LP20 2.75e-169 478 66 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SMS-3-5 / SECEC)
A7MJP4 3.43e-169 478 66 0 348 3 hisC Histidinol-phosphate aminotransferase Cronobacter sakazakii (strain ATCC BAA-894)
A4TKK4 7.32e-169 478 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis (strain Pestoides F)
Q1CGX0 7.32e-169 478 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2K5 7.32e-169 478 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFX6 7.32e-169 478 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis
Q1C9R1 7.32e-169 478 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Antiqua)
B7NC61 8.49e-169 477 66 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A1ACN3 1.23e-168 477 66 0 345 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O1:K1 / APEC
A1JTV9 3.1e-168 476 63 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q32EF0 3.12e-168 476 66 0 345 3 hisC Histidinol-phosphate aminotransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q8Z5J9 5.75e-168 475 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella typhi
Q57MS2 1.31e-167 474 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella choleraesuis (strain SC-B67)
B5FM42 1.75e-167 474 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella dublin (strain CT_02021853)
C0Q1K1 2.41e-167 474 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi C (strain RKS4594)
B4TMR6 3e-167 473 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella schwarzengrund (strain CVM19633)
B5RBR3 3e-167 473 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZL3 3e-167 473 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5EX40 3e-167 473 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella agona (strain SL483)
P10369 3.03e-167 473 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9ML15 3.17e-167 473 65 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A9MSC2 3.24e-167 473 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SX42 3.24e-167 473 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella newport (strain SL254)
B5BFB9 9.46e-167 472 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain AKU_12601)
Q5PDP4 9.46e-167 472 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T9N5 1.27e-166 472 64 0 350 3 hisC Histidinol-phosphate aminotransferase Salmonella heidelberg (strain SL476)
A4WC70 1.61e-166 471 65 0 350 3 hisC Histidinol-phosphate aminotransferase Enterobacter sp. (strain 638)
A8AEK3 4.1e-166 471 64 0 349 3 hisC Histidinol-phosphate aminotransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6TBC4 5.3e-162 460 64 0 345 1 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XPE6 2.45e-159 453 63 0 345 3 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae (strain 342)
Q2NTX2 7.47e-158 449 62 0 352 3 hisC Histidinol-phosphate aminotransferase Sodalis glossinidius (strain morsitans)
Q1LT68 5.2e-153 437 61 1 343 3 hisC Histidinol-phosphate aminotransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q65RB2 6.85e-152 434 59 1 348 3 hisC2 Histidinol-phosphate aminotransferase 2 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CLM3 6.67e-151 432 59 1 348 3 hisC1 Histidinol-phosphate aminotransferase 1 Pasteurella multocida (strain Pm70)
Q492K2 1.21e-145 419 55 0 348 3 hisC Histidinol-phosphate aminotransferase Blochmanniella pennsylvanica (strain BPEN)
P44423 1.51e-144 416 55 0 352 3 hisC1 Histidinol-phosphate aminotransferase 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UGY2 1.62e-144 416 56 0 348 3 hisC Histidinol-phosphate aminotransferase Haemophilus influenzae (strain PittGG)
A5UA19 2.98e-144 415 55 0 352 3 hisC Histidinol-phosphate aminotransferase Haemophilus influenzae (strain PittEE)
Q4QN73 3.15e-144 415 56 0 348 3 hisC1 Histidinol-phosphate aminotransferase 1 Haemophilus influenzae (strain 86-028NP)
Q7VQW9 1.95e-143 413 54 0 347 3 hisC Histidinol-phosphate aminotransferase Blochmanniella floridana
Q5E637 6.07e-138 399 57 2 343 3 hisC Histidinol-phosphate aminotransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q84I53 3.32e-137 397 54 2 349 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Diuraphis noxia
B5FDA0 5.76e-137 396 56 2 343 3 hisC Histidinol-phosphate aminotransferase Aliivibrio fischeri (strain MJ11)
C3LU31 7.58e-136 393 56 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain M66-2)
A5F2A2 7.58e-136 393 56 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9ZHE5 2.39e-135 392 51 1 341 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9KSX2 3.46e-135 392 56 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A7MX17 5.01e-135 391 56 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio campbellii (strain ATCC BAA-1116)
Q87QL0 3.39e-134 389 55 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6LT75 3.52e-134 390 55 2 345 3 hisC Histidinol-phosphate aminotransferase Photobacterium profundum (strain SS9)
B8D707 9.23e-133 386 51 2 349 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8Q3 9.23e-133 386 51 2 349 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57202 1.02e-132 386 51 2 349 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B6EJ89 7.52e-132 383 55 2 343 3 hisC Histidinol-phosphate aminotransferase Aliivibrio salmonicida (strain LFI1238)
A4SMP7 1.19e-129 378 57 0 338 3 hisC Histidinol-phosphate aminotransferase Aeromonas salmonicida (strain A449)
A0KKB7 1.6e-126 370 54 0 349 3 hisC Histidinol-phosphate aminotransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q89AX7 1.91e-126 370 48 0 347 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q7MLS5 2.24e-125 367 54 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio vulnificus (strain YJ016)
Q8D8Q1 2.49e-124 364 54 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio vulnificus (strain CMCP6)
Q84I51 3.03e-123 362 48 2 349 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Schlechtendalia chinensis
Q84I52 2.72e-119 352 46 2 349 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Melaphis rhois
Q15RU8 5.42e-116 343 50 1 348 3 hisC Histidinol-phosphate aminotransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5QWQ9 5.55e-113 335 49 3 340 3 hisC2 Histidinol-phosphate aminotransferase 2 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q058A6 1.1e-105 317 43 0 341 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q8EFB2 5.18e-96 293 46 7 354 3 hisC Histidinol-phosphate aminotransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q47XB7 5e-95 290 42 5 354 3 hisC Histidinol-phosphate aminotransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B0U3B2 6.42e-84 261 41 4 354 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain M12)
Q87C30 6.78e-84 261 41 5 360 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I5Y0 6.78e-84 261 41 5 360 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain M23)
Q3BUF6 1.3e-83 261 40 3 352 3 hisC Histidinol-phosphate aminotransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B4STN8 1.7e-83 260 42 3 346 3 hisC Histidinol-phosphate aminotransferase Stenotrophomonas maltophilia (strain R551-3)
P58891 6.52e-83 259 40 3 352 3 hisC Histidinol-phosphate aminotransferase Xanthomonas axonopodis pv. citri (strain 306)
Q9PBC6 8.42e-83 259 40 4 354 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain 9a5c)
B2FPM0 8.91e-83 259 41 4 348 3 hisC Histidinol-phosphate aminotransferase Stenotrophomonas maltophilia (strain K279a)
Q5H0L0 1.6e-82 258 40 4 354 3 hisC Histidinol-phosphate aminotransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3K2 1.6e-82 258 40 4 354 3 hisC Histidinol-phosphate aminotransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q4UU41 4.61e-79 249 40 5 356 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain 8004)
B0RSL5 6.44e-79 249 40 5 356 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain B100)
Q11VM5 1.97e-78 247 39 5 350 3 hisC Histidinol-phosphate aminotransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
P58892 7.23e-78 246 40 5 356 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0TY45 4.54e-77 244 36 4 350 3 hisC Histidinol-phosphate aminotransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A1S6Z2 7.56e-76 241 44 8 357 3 hisC Histidinol-phosphate aminotransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A6GY79 6.31e-72 230 36 6 355 3 hisC Histidinol-phosphate aminotransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
A0M287 8.91e-71 227 34 5 358 3 hisC Histidinol-phosphate aminotransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A5FFY0 1.63e-70 227 36 5 356 3 hisC Histidinol-phosphate aminotransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A6LAM2 7.72e-68 219 37 6 351 3 hisC Histidinol-phosphate aminotransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q64RE8 1.06e-65 214 37 6 352 3 hisC Histidinol-phosphate aminotransferase Bacteroides fragilis (strain YCH46)
Q5LAZ9 1.25e-65 214 37 6 352 3 hisC Histidinol-phosphate aminotransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A6L2V8 1.34e-62 206 34 8 359 3 hisC Histidinol-phosphate aminotransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B0K735 9.32e-61 201 38 6 291 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K625 6.19e-60 199 38 6 291 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter sp. (strain X514)
Q8ABA8 1.68e-58 196 34 7 352 3 hisC Histidinol-phosphate aminotransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A5CZ78 3.28e-55 187 38 10 323 3 hisC Histidinol-phosphate aminotransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
P36605 1.54e-54 186 32 7 365 3 his3 Histidinol-phosphate aminotransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5X5X0 7.81e-54 184 35 6 325 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila (strain Paris)
Q5ZW88 3.17e-53 182 35 8 330 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5WX92 7.67e-53 181 35 6 325 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila (strain Lens)
P07172 1.67e-52 181 33 12 373 1 HIS5 Histidinol-phosphate aminotransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P56099 6.43e-52 180 33 13 385 3 HIS5 Histidinol-phosphate aminotransferase Candida maltosa
A5N7Q7 6.71e-52 179 31 11 356 3 hisC Histidinol-phosphate aminotransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E168 6.71e-52 179 31 11 356 3 hisC Histidinol-phosphate aminotransferase Clostridium kluyveri (strain NBRC 12016)
B4S8L6 1.21e-50 176 33 8 328 3 hisC Histidinol-phosphate aminotransferase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q8R5Q4 2.23e-50 174 34 6 303 1 hisC Histidinol-phosphate aminotransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
C5A7A4 2.87e-49 171 31 10 352 3 hisC Histidinol-phosphate aminotransferase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q8KD01 1.04e-48 170 33 8 338 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B8I5V1 1.17e-48 170 31 9 348 3 hisC Histidinol-phosphate aminotransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q8TH25 9.82e-48 167 31 11 340 3 hisC Histidinol-phosphate aminotransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A4SE60 1.06e-46 165 34 7 338 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q7NL03 2.35e-46 164 39 8 311 3 hisC Histidinol-phosphate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q5QZ49 3.67e-46 164 31 12 371 3 hisC1 Histidinol-phosphate aminotransferase 1 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B4SGL8 6.65e-46 163 32 7 335 3 hisC Histidinol-phosphate aminotransferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q3ARM7 2.01e-45 162 32 9 365 3 hisC Histidinol-phosphate aminotransferase Chlorobium chlorochromatii (strain CaD3)
B3ECG2 8.17e-45 160 32 7 338 3 hisC Histidinol-phosphate aminotransferase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B3DXN2 8.89e-43 155 31 12 358 3 hisC Histidinol-phosphate aminotransferase Methylacidiphilum infernorum (isolate V4)
Q3Z879 1.69e-42 154 33 11 333 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q3B3L3 1.74e-42 154 32 7 336 3 hisC Histidinol-phosphate aminotransferase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A4IQ80 1.84e-42 154 32 12 365 3 hisC Histidinol-phosphate aminotransferase Geobacillus thermodenitrificans (strain NG80-2)
C0ZCE7 2.02e-42 154 33 12 314 3 hisC Histidinol-phosphate aminotransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A4FWW1 2.93e-42 154 31 12 322 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q5JFU6 3.02e-42 153 31 10 343 3 hisC Histidinol-phosphate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A5UKY0 3.17e-42 154 32 13 340 3 hisC Histidinol-phosphate aminotransferase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A5V022 3.84e-42 153 33 13 364 3 hisC Histidinol-phosphate aminotransferase Roseiflexus sp. (strain RS-1)
Q18F03 5.61e-42 153 31 8 330 3 hisC Histidinol-phosphate aminotransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q4QLD1 5.82e-42 153 32 14 366 3 hisC2 Histidinol-phosphate aminotransferase 2 Haemophilus influenzae (strain 86-028NP)
Q57004 8.84e-42 152 32 14 366 3 hisC2 Histidinol-phosphate aminotransferase 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P61003 8.96e-42 152 30 16 351 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q9KCA8 1e-41 152 33 10 312 3 hisC Histidinol-phosphate aminotransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q58365 1.11e-41 152 30 13 368 3 hisC Histidinol-phosphate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q3AD52 2.55e-41 150 33 14 371 3 hisC1 Histidinol-phosphate aminotransferase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P45358 3.38e-41 150 32 11 350 3 hisC Histidinol-phosphate aminotransferase Acetobacter pasteurianus
A1BGB4 4.5e-41 150 31 8 327 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B3QP11 5.82e-41 150 31 7 332 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q5KXV3 7.15e-41 150 32 12 365 3 hisC Histidinol-phosphate aminotransferase Geobacillus kaustophilus (strain HTA426)
A5CVR5 7.71e-41 149 31 11 307 3 hisC Histidinol-phosphate aminotransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q4K8N0 9.7e-41 150 32 12 371 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A8FEJ6 1.13e-40 149 32 7 310 3 hisC Histidinol-phosphate aminotransferase Bacillus pumilus (strain SAFR-032)
Q8TVG3 1.98e-40 149 33 18 379 3 hisC Histidinol-phosphate aminotransferase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
A6UPL6 3.32e-40 148 30 13 341 3 hisC Histidinol-phosphate aminotransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
P0DI07 3.75e-40 149 32 10 331 1 HISN6B Histidinol-phosphate aminotransferase 2, chloroplastic Arabidopsis thaliana
B9DHD3 3.75e-40 149 32 10 331 1 HISN6A Histidinol-phosphate aminotransferase 1, chloroplastic Arabidopsis thaliana
O28255 3.93e-40 147 31 12 351 3 hisC2 Histidinol-phosphate aminotransferase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q65S79 4.73e-40 148 30 12 361 3 hisC1 Histidinol-phosphate aminotransferase 1 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4FSH2 6.53e-40 148 30 10 367 3 hisC1 Histidinol-phosphate aminotransferase 1 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
O27624 1.25e-39 147 32 15 380 3 hisC Histidinol-phosphate aminotransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B2HQA3 1.37e-39 147 32 12 332 3 hisC Histidinol-phosphate aminotransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
A7NFV2 1.43e-39 147 31 13 366 3 hisC Histidinol-phosphate aminotransferase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q2JPM4 1.65e-39 146 30 12 360 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8YMG7 2.11e-39 146 31 10 323 3 hisC2 Histidinol-phosphate aminotransferase 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A5FR29 2.26e-39 146 32 10 331 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
A0PXP5 2.75e-39 145 27 11 356 3 hisC Histidinol-phosphate aminotransferase Clostridium novyi (strain NT)
Q3K8U2 2.84e-39 146 33 12 365 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas fluorescens (strain Pf0-1)
Q9RI00 4.01e-39 145 31 13 368 3 hisC Histidinol-phosphate aminotransferase Stutzerimonas stutzeri
Q8DM42 4.63e-39 145 32 12 306 3 hisC Histidinol-phosphate aminotransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3ZXL8 4.73e-39 145 32 10 331 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain CBDB1)
B1HTD4 4.74e-39 145 32 9 299 3 hisC Histidinol-phosphate aminotransferase Lysinibacillus sphaericus (strain C3-41)
P17736 5.25e-39 145 32 8 339 3 hisC Histidinol-phosphate aminotransferase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q51687 6.61e-39 145 34 13 337 3 hisC Histidinol-phosphate aminotransferase Paracoccus denitrificans (strain Pd 1222)
Q9RRM7 9.42e-39 144 32 7 307 3 hisC Histidinol-phosphate aminotransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A7Z614 9.82e-39 144 30 10 362 3 hisC Histidinol-phosphate aminotransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A0PP15 9.93e-39 145 31 13 353 3 hisC Histidinol-phosphate aminotransferase Mycobacterium ulcerans (strain Agy99)
Q3SK85 1.24e-38 144 31 12 364 3 hisC1 Histidinol-phosphate aminotransferase 1 Thiobacillus denitrificans (strain ATCC 25259)
Q3MAX6 1.48e-38 144 31 10 323 3 hisC2 Histidinol-phosphate aminotransferase 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q10VS0 1.66e-38 144 31 9 329 3 hisC Histidinol-phosphate aminotransferase Trichodesmium erythraeum (strain IMS101)
Q2NEQ0 1.67e-38 144 31 11 336 3 hisC Histidinol-phosphate aminotransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q24QJ1 1.74e-38 144 30 9 343 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain Y51)
A6VGF6 2.09e-38 144 29 12 314 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
B9LZ53 2.3e-38 143 31 10 328 3 hisC Histidinol-phosphate aminotransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
O67857 4.82e-38 142 30 12 341 3 hisC Histidinol-phosphate aminotransferase Aquifex aeolicus (strain VF5)
B9KPH4 5.3e-38 142 32 10 333 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q31GD4 6.15e-38 142 28 8 306 3 hisC2 Histidinol-phosphate aminotransferase 2 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B2UPR9 6.45e-38 142 30 9 366 3 hisC Histidinol-phosphate aminotransferase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q97ES6 8.55e-38 141 30 11 352 3 hisC Histidinol-phosphate aminotransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q3J445 9e-38 142 32 10 333 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9FEW2 9.8e-38 142 30 10 351 1 HPA Histidinol-phosphate aminotransferase, chloroplastic Nicotiana plumbaginifolia
A3PIA4 9.98e-38 141 32 10 333 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A4WUN9 1.01e-37 141 32 10 333 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A6UTL8 1.12e-37 142 29 14 349 3 hisC Histidinol-phosphate aminotransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q72DA0 1.25e-37 141 33 9 308 1 hisC Histidinol-phosphate aminotransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A7HCR6 1.46e-37 141 30 10 365 3 hisC Histidinol-phosphate aminotransferase Anaeromyxobacter sp. (strain Fw109-5)
Q63XM1 1.5e-37 141 31 12 356 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia pseudomallei (strain K96243)
Q3JW89 1.5e-37 141 31 12 356 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia pseudomallei (strain 1710b)
Q03VY3 1.73e-37 140 30 9 350 3 hisC Histidinol-phosphate aminotransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A9AA96 2.03e-37 141 30 14 323 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A1VEW4 2.6e-37 140 32 9 308 3 hisC Histidinol-phosphate aminotransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q73AX7 3.08e-37 140 31 9 308 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9HZ68 3.45e-37 140 31 12 366 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O82030 5.82e-37 140 30 10 351 2 HPA Histidinol-phosphate aminotransferase, chloroplastic Nicotiana tabacum
A7GN55 5.97e-37 140 31 9 308 3 hisC Histidinol-phosphate aminotransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q3J7H2 6.4e-37 139 33 12 310 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
C5D3D2 7.01e-37 139 32 10 311 3 hisC Histidinol-phosphate aminotransferase Geobacillus sp. (strain WCH70)
O33770 8.97e-37 139 33 12 310 3 hisC Histidinol-phosphate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q6HL37 9.04e-37 139 30 9 308 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q970Z4 9.13e-37 139 30 12 329 3 hisC Histidinol-phosphate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q163G3 1.04e-36 139 33 10 330 3 hisC Histidinol-phosphate aminotransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q39K90 1.17e-36 139 33 10 299 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q81SV5 1.43e-36 139 30 9 308 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus anthracis
Q5ZU10 1.46e-36 139 28 7 311 3 hisC2 Histidinol-phosphate aminotransferase 2 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q65I37 1.53e-36 138 30 10 367 3 hisC Histidinol-phosphate aminotransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q63DL4 1.79e-36 138 30 9 308 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ZK / E33L)
Q62FC0 1.79e-36 138 31 12 356 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia mallei (strain ATCC 23344)
Q63Q87 1.89e-36 138 34 10 299 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia pseudomallei (strain K96243)
Q62GE0 1.89e-36 138 34 10 299 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia mallei (strain ATCC 23344)
Q3JMZ7 2.01e-36 138 34 10 299 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia pseudomallei (strain 1710b)
Q9CMI7 2.26e-36 138 30 13 373 3 hisC2 Histidinol-phosphate aminotransferase 2 Pasteurella multocida (strain Pm70)
B1N009 2.66e-36 137 31 8 318 3 hisC Histidinol-phosphate aminotransferase Leuconostoc citreum (strain KM20)
B8FP20 2.85e-36 137 30 8 317 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q3AAT6 3.09e-36 137 30 9 310 3 hisC2 Histidinol-phosphate aminotransferase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q0SHX9 3.11e-36 138 33 13 352 3 hisC Histidinol-phosphate aminotransferase Rhodococcus jostii (strain RHA1)
Q5V4K3 4.54e-36 137 29 8 339 3 hisC Histidinol-phosphate aminotransferase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q67KI2 5.3e-36 137 31 11 364 3 hisC Histidinol-phosphate aminotransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q5WV43 5.42e-36 137 27 8 316 3 hisC2 Histidinol-phosphate aminotransferase 2 Legionella pneumophila (strain Lens)
P60998 5.68e-36 137 31 10 310 3 hisC Histidinol-phosphate aminotransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q82AA5 6.26e-36 137 31 9 317 3 hisC Histidinol-phosphate aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q2JTG5 6.62e-36 136 30 12 360 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain JA-3-3Ab)
Q3IRT1 7.97e-36 136 30 9 343 3 hisC Histidinol-phosphate aminotransferase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A6VUD3 7.98e-36 136 29 14 360 3 hisC Histidinol-phosphate aminotransferase Marinomonas sp. (strain MWYL1)
P16246 8.71e-36 136 30 9 313 3 hisC Histidinol-phosphate aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6ABU3 8.77e-36 136 30 10 355 3 pat Putative phenylalanine aminotransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)
A1R558 9.33e-36 136 31 11 314 3 hisC Histidinol-phosphate aminotransferase Paenarthrobacter aurescens (strain TC1)
Q5YYP9 1.18e-35 136 33 14 352 3 hisC Histidinol-phosphate aminotransferase Nocardia farcinica (strain IFM 10152)
Q8KZ92 1.19e-35 136 29 9 362 3 hisC Histidinol-phosphate aminotransferase Bacillus subtilis subsp. natto
P17731 1.42e-35 135 29 9 362 3 hisC Histidinol-phosphate aminotransferase Bacillus subtilis (strain 168)
Q02YW3 1.75e-35 135 29 12 352 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. cremoris (strain SK11)
Q608S3 1.98e-35 135 29 11 363 3 hisC2 Histidinol-phosphate aminotransferase 2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
O07131 2.3e-35 135 30 6 304 3 hisC Histidinol-phosphate aminotransferase Methylobacillus flagellatus
Q47GP2 2.45e-35 135 29 8 304 3 hisC1 Histidinol-phosphate aminotransferase 1 Dechloromonas aromatica (strain RCB)
Q8ESS3 2.85e-35 135 27 11 369 3 hisC1 Histidinol-phosphate aminotransferase 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5LNM6 2.95e-35 135 31 10 338 3 hisC Histidinol-phosphate aminotransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A6LUF3 3.12e-35 135 28 12 345 3 hisC Histidinol-phosphate aminotransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B7GHJ8 3.46e-35 135 31 9 316 3 hisC Histidinol-phosphate aminotransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A3Q130 3.53e-35 135 31 11 343 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain JLS)
Q9X7B8 3.53e-35 135 30 13 369 3 hisC Histidinol-phosphate aminotransferase Mycobacterium leprae (strain TN)
B8ZRB0 3.53e-35 135 30 13 369 3 hisC Histidinol-phosphate aminotransferase Mycobacterium leprae (strain Br4923)
Q82XE0 4.07e-35 135 29 14 370 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A4XMY1 4.81e-35 134 28 14 369 3 hisC Histidinol-phosphate aminotransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B9EAC1 5.21e-35 134 29 8 321 3 hisC Histidinol-phosphate aminotransferase Macrococcus caseolyticus (strain JCSC5402)
Q3JEN8 5.81e-35 134 27 11 367 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q89GX0 6.68e-35 134 31 10 352 3 hisC1 Histidinol-phosphate aminotransferase 1 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1B7G5 8.22e-35 134 31 11 343 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain MCS)
A1UHK7 8.22e-35 134 31 11 343 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain KMS)
P60999 9.11e-35 134 31 10 331 3 hisC Histidinol-phosphate aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q5X3Q5 9.55e-35 134 27 8 316 3 hisC2 Histidinol-phosphate aminotransferase 2 Legionella pneumophila (strain Paris)
C1ATZ5 1.68e-34 133 32 13 352 3 hisC Histidinol-phosphate aminotransferase Rhodococcus opacus (strain B4)
Q3SI68 1.79e-34 133 30 10 354 3 hisC2 Histidinol-phosphate aminotransferase 2 Thiobacillus denitrificans (strain ATCC 25259)
B3PCJ2 2.1e-34 132 31 15 352 3 hisC Histidinol-phosphate aminotransferase Cellvibrio japonicus (strain Ueda107)
Q845V2 2.15e-34 132 33 10 299 3 hisC Histidinol-phosphate aminotransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q6AQK2 2.31e-34 133 28 16 371 3 hisC Histidinol-phosphate aminotransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q311Z4 2.59e-34 133 31 9 307 3 hisC Histidinol-phosphate aminotransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B9LNJ8 2.93e-34 132 30 8 322 3 hisC Histidinol-phosphate aminotransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
A0QX82 3.11e-34 132 30 13 366 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9HQS0 3.14e-34 132 29 9 337 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4Q4 3.14e-34 132 29 9 337 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q28TL1 3.98e-34 132 29 12 348 3 hisC Histidinol-phosphate aminotransferase Jannaschia sp. (strain CCS1)
Q3M504 4.47e-34 131 29 11 354 3 hisC1 Histidinol-phosphate aminotransferase 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A5G9G1 5.86e-34 131 30 10 324 3 hisC Histidinol-phosphate aminotransferase Geotalea uraniireducens (strain Rf4)
Q4JW58 5.97e-34 132 30 13 345 3 hisC Histidinol-phosphate aminotransferase Corynebacterium jeikeium (strain K411)
Q39CT7 6.85e-34 131 30 12 356 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1GP30 8.87e-34 131 30 12 365 3 hisC Histidinol-phosphate aminotransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q46WL3 9.05e-34 131 33 10 312 1 hisC2 Histidinol-phosphate aminotransferase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q5WGR9 9.67e-34 131 30 11 355 3 hisC Histidinol-phosphate aminotransferase Shouchella clausii (strain KSM-K16)
Q2SBJ7 1.23e-33 130 31 18 367 3 hisC Histidinol-phosphate aminotransferase Hahella chejuensis (strain KCTC 2396)
B1WY56 1.24e-33 130 29 11 333 3 hisC Histidinol-phosphate aminotransferase Crocosphaera subtropica (strain ATCC 51142 / BH68)
C3KVX5 1.58e-33 130 27 12 351 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain 657 / Type Ba4)
Q39M27 1.86e-33 130 31 13 372 3 hisC3 Histidinol-phosphate aminotransferase 3 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B4U9L1 2.26e-33 129 27 7 304 3 hisC Histidinol-phosphate aminotransferase Hydrogenobaculum sp. (strain Y04AAS1)
Q1GET3 2.35e-33 130 31 10 329 3 hisC Histidinol-phosphate aminotransferase Ruegeria sp. (strain TM1040)
Q736A5 2.43e-33 130 29 11 349 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8FNZ1 2.71e-33 130 29 11 346 3 hisC Histidinol-phosphate aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q5HR08 2.74e-33 129 28 12 352 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1R089 3.19e-33 129 31 15 358 3 hisC Histidinol-phosphate aminotransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8CTG8 3.61e-33 129 28 12 352 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q49VS0 4.26e-33 129 31 11 296 3 hisC Histidinol-phosphate aminotransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q46Y48 4.29e-33 129 28 9 309 3 hisC1 Histidinol-phosphate aminotransferase 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A3CWS8 4.34e-33 129 28 10 342 3 hisC Histidinol-phosphate aminotransferase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
P61001 4.55e-33 130 31 13 348 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QHI1 4.99e-33 130 31 13 348 3 hisC Histidinol-phosphate aminotransferase Mycobacterium avium (strain 104)
Q6FEC7 5.82e-33 129 30 13 370 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q46E46 5.99e-33 129 30 13 337 3 hisC Histidinol-phosphate aminotransferase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q6HHF6 7.43e-33 129 29 11 349 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8YV89 8.91e-33 128 29 11 354 3 hisC1 Histidinol-phosphate aminotransferase 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q81P62 1.04e-32 128 29 11 349 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus anthracis
Q6GIR8 1.08e-32 128 28 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MRSA252)
Q02135 1.1e-32 128 28 11 350 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q2RL44 1.59e-32 128 29 11 370 3 hisC Histidinol-phosphate aminotransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A7GDQ6 1.61e-32 127 28 11 339 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q5N4R3 1.73e-32 128 30 15 354 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31PF9 1.85e-32 127 30 15 354 3 hisC Histidinol-phosphate aminotransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q12U08 1.86e-32 127 28 12 333 3 hisC Histidinol-phosphate aminotransferase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q63A05 1.95e-32 127 29 13 361 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ZK / E33L)
Q2W047 2.11e-32 127 31 10 314 3 hisC Histidinol-phosphate aminotransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2RP86 2.19e-32 127 31 11 315 3 hisC Histidinol-phosphate aminotransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q0W253 2.6e-32 127 31 9 306 3 hisC Histidinol-phosphate aminotransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
B2IDA4 2.66e-32 127 30 10 326 3 hisC Histidinol-phosphate aminotransferase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q81C43 2.9e-32 127 29 11 349 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B1ILA9 3.59e-32 126 27 12 340 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Okra / Type B1)
A1A2H6 3.78e-32 127 31 13 359 3 hisC Histidinol-phosphate aminotransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A4QFG6 4.37e-32 126 30 14 340 3 hisC Histidinol-phosphate aminotransferase Corynebacterium glutamicum (strain R)
C1FN41 4.5e-32 126 28 12 340 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Kyoto / Type A2)
Q7W2Y3 4.52e-32 126 33 10 307 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P9WML7 4.69e-32 127 31 13 334 1 hisC Histidinol-phosphate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WML6 4.69e-32 127 31 13 334 3 hisC Histidinol-phosphate aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U2V6 4.69e-32 127 31 13 334 3 hisC Histidinol-phosphate aminotransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1ANM2 4.69e-32 127 31 13 334 3 hisC Histidinol-phosphate aminotransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KJ16 4.69e-32 127 31 13 334 3 hisC Histidinol-phosphate aminotransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A679 4.69e-32 127 31 13 334 3 hisC Histidinol-phosphate aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8Y0Y8 5.08e-32 126 30 8 309 3 hisC2 Histidinol-phosphate aminotransferase 2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8NXN3 6.03e-32 126 27 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MW2)
Q6GBA6 6.03e-32 126 27 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MSSA476)
Q9KJU4 6.07e-32 126 30 14 340 1 hisC Histidinol-phosphate aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A2RKS5 6.76e-32 125 28 12 352 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. cremoris (strain MG1363)
B1VP97 7.36e-32 125 31 6 278 3 pat Putative phenylalanine aminotransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q7WDY3 7.7e-32 126 33 10 307 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A1VK38 8.8e-32 125 33 10 306 3 hisC Histidinol-phosphate aminotransferase Polaromonas naphthalenivorans (strain CJ2)
Q609W4 1.58e-31 125 30 15 371 3 hisC1 Histidinol-phosphate aminotransferase 1 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q2Y6Y6 1.77e-31 125 30 11 298 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q8DTQ4 2.97e-31 124 31 12 329 3 hisC Histidinol-phosphate aminotransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8Y5X8 3.85e-31 124 27 11 363 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A8HZS2 3.89e-31 124 29 10 338 3 hisC Histidinol-phosphate aminotransferase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q8PX17 3.95e-31 124 29 13 336 3 hisC Histidinol-phosphate aminotransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A5I245 4.42e-31 124 27 12 340 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FU81 4.42e-31 124 27 12 340 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain ATCC 19397 / Type A)
A3CNT7 4.44e-31 123 30 10 347 3 hisC Histidinol-phosphate aminotransferase Streptococcus sanguinis (strain SK36)
A8YZZ5 4.72e-31 123 27 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300 / TCH1516)
P67725 4.72e-31 123 27 11 349 1 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain N315)
P67724 4.72e-31 123 27 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QF32 4.72e-31 123 27 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Newman)
Q5HHU9 4.72e-31 123 27 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain COL)
A5IQS7 4.72e-31 123 27 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH9)
Q2G087 4.72e-31 123 27 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIR7 4.72e-31 123 27 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300)
A6TZK2 4.72e-31 123 27 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH1)
A7WZL0 4.72e-31 123 27 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q71Y90 4.82e-31 124 27 10 369 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serotype 4b (strain F2365)
Q7VSZ0 4.94e-31 124 33 10 307 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
B8DC01 5.17e-31 123 29 8 312 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serotype 4a (strain HCC23)
Q7WHN5 5.97e-31 123 28 9 353 3 hisC1 Histidinol-phosphate aminotransferase 1 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A8AY31 6.03e-31 123 30 11 353 3 hisC Histidinol-phosphate aminotransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q7W6Q1 6.82e-31 123 28 9 353 3 hisC1 Histidinol-phosphate aminotransferase 1 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
C1KWM5 7.17e-31 123 29 8 312 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
A0AK37 8.27e-31 123 28 8 312 3 hisC Histidinol-phosphate aminotransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q9ZBY8 8.55e-31 123 28 9 342 3 pat Putative phenylalanine aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q2J8K9 9.31e-31 124 30 14 386 3 hisC Histidinol-phosphate aminotransferase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
B9DK21 9.41e-31 122 28 8 310 3 hisC Histidinol-phosphate aminotransferase Staphylococcus carnosus (strain TM300)
Q7P0F4 9.65e-31 122 33 10 309 3 hisC Histidinol-phosphate aminotransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q31I36 1.05e-30 122 29 12 355 3 hisC1 Histidinol-phosphate aminotransferase 1 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A1TKZ0 1.05e-30 123 30 11 318 3 hisC Histidinol-phosphate aminotransferase Paracidovorax citrulli (strain AAC00-1)
O28277 1.15e-30 122 30 9 320 3 hisC1 Histidinol-phosphate aminotransferase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8TUE9 1.27e-30 122 29 13 336 3 hisC Histidinol-phosphate aminotransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q30TC9 1.36e-30 122 27 8 306 3 hisC Histidinol-phosphate aminotransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A8LK96 1.42e-30 122 31 10 329 3 hisC Histidinol-phosphate aminotransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q2YSI3 1.45e-30 122 26 11 352 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q3A7R3 1.49e-30 122 29 10 328 3 hisC Histidinol-phosphate aminotransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q4L4E7 1.94e-30 122 29 10 309 3 hisC Histidinol-phosphate aminotransferase Staphylococcus haemolyticus (strain JCSC1435)
B0KQJ6 2.08e-30 122 30 12 340 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain GB-1)
Q4FP52 2.18e-30 122 27 7 311 3 hisC Histidinol-phosphate aminotransferase Pelagibacter ubique (strain HTCC1062)
B9MDV4 3.32e-30 121 31 10 316 3 hisC Histidinol-phosphate aminotransferase Acidovorax ebreus (strain TPSY)
Q81FQ1 3.61e-30 121 30 9 308 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8XV80 4.27e-30 121 32 12 316 3 hisC1 Histidinol-phosphate aminotransferase 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B5E9W9 4.35e-30 120 29 14 366 3 hisC Histidinol-phosphate aminotransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q88P86 4.85e-30 120 30 12 340 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5P791 5.14e-30 120 29 12 353 3 hisC Histidinol-phosphate aminotransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1T8W2 5.41e-30 121 31 11 350 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A2SE05 5.51e-30 121 32 10 309 3 hisC Histidinol-phosphate aminotransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B8HW95 6.47e-30 120 30 12 346 3 hisC Histidinol-phosphate aminotransferase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B7I6C5 7.6e-30 120 28 11 356 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain AB0057)
B7GZI3 7.6e-30 120 28 11 356 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain AB307-0294)
Q92A83 7.63e-30 120 28 7 305 1 hisC Histidinol-phosphate aminotransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q20YH9 9.46e-30 120 28 9 351 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisB18)
Q82WM3 9.77e-30 120 30 11 303 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B0JJJ7 1.53e-29 119 28 11 354 3 hisC Histidinol-phosphate aminotransferase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q1IE97 1.58e-29 119 29 10 339 3 hisC Histidinol-phosphate aminotransferase Pseudomonas entomophila (strain L48)
Q4JSJ5 1.77e-29 119 29 9 284 3 pat Putative phenylalanine aminotransferase Corynebacterium jeikeium (strain K411)
B0V7Q2 1.78e-29 119 29 12 354 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain AYE)
B2HTW5 1.78e-29 119 29 12 354 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain ACICU)
B1MFC0 1.94e-29 119 30 7 297 3 pat Putative phenylalanine aminotransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
A5VZ57 2.19e-29 119 30 12 340 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q82FJ1 2.25e-29 119 28 8 314 3 pat Putative phenylalanine aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A9H311 2.62e-29 119 30 12 349 3 hisC Histidinol-phosphate aminotransferase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B0VV21 3.45e-29 119 28 11 356 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain SDF)
Q0AM22 4.09e-29 118 29 10 316 3 hisC Histidinol-phosphate aminotransferase Maricaulis maris (strain MCS10)
Q8EQB9 4.35e-29 118 26 11 356 3 hisC2 Histidinol-phosphate aminotransferase 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q7VWL5 4.67e-29 118 28 9 350 3 hisC1 Histidinol-phosphate aminotransferase 1 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q0P8H7 4.76e-29 118 29 15 362 1 Cj1437c Dihydroxyacetone phosphate transaminase Cj1437c Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
C0R1Z0 5e-29 118 25 13 343 3 hisC Histidinol-phosphate aminotransferase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q4KI72 6.27e-29 117 29 12 357 3 hisC1 Histidinol-phosphate aminotransferase 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
C6E916 7.23e-29 117 29 12 335 3 hisC Histidinol-phosphate aminotransferase Geobacter sp. (strain M21)
Q07IG8 7.96e-29 117 29 10 350 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisA53)
Q1QQD5 1.08e-28 117 29 12 346 3 hisC Histidinol-phosphate aminotransferase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q4ZNW0 1.13e-28 117 28 12 354 3 hisC Histidinol-phosphate aminotransferase Pseudomonas syringae pv. syringae (strain B728a)
C0ZM44 1.14e-28 117 30 8 295 3 pat Putative phenylalanine aminotransferase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
A7H084 1.26e-28 117 29 9 308 3 hisC Histidinol-phosphate aminotransferase Campylobacter curvus (strain 525.92)
Q5FQA6 1.31e-28 117 29 12 358 3 hisC2 Histidinol-phosphate aminotransferase 2 Gluconobacter oxydans (strain 621H)
A8MEH2 1.35e-28 117 25 11 365 3 hisC Histidinol-phosphate aminotransferase Alkaliphilus oremlandii (strain OhILAs)
A3M2I8 1.38e-28 117 28 12 356 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q3SV41 1.68e-28 117 30 10 340 3 hisC Histidinol-phosphate aminotransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A1KV06 1.98e-28 116 27 11 366 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JTH8 1.98e-28 116 27 11 366 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M185 1.98e-28 116 27 11 366 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup C (strain 053442)
Q48ED0 2.7e-28 116 29 13 323 3 hisC Histidinol-phosphate aminotransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4FQF9 3.01e-28 116 28 10 362 3 hisC2 Histidinol-phosphate aminotransferase 2 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B4RJ05 4.84e-28 115 30 8 277 3 hisC Histidinol-phosphate aminotransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F7D7 4.84e-28 115 30 8 277 3 hisC Histidinol-phosphate aminotransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9JYH7 6.45e-28 115 27 11 366 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q89UL9 7e-28 115 28 10 325 3 hisC2 Histidinol-phosphate aminotransferase 2 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2IS68 7.74e-28 115 28 12 350 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain HaA2)
Q7M7Y6 9.01e-28 115 28 8 305 3 hisC Histidinol-phosphate aminotransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q03K75 1.01e-27 114 27 12 355 3 hisC Histidinol-phosphate aminotransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
A8FKA6 1.01e-27 114 29 9 307 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q88UE6 1.16e-27 114 27 9 319 3 hisC Histidinol-phosphate aminotransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8G4S8 1.21e-27 115 29 10 347 3 hisC Histidinol-phosphate aminotransferase Bifidobacterium longum (strain NCC 2705)
Q8FU28 1.76e-27 114 25 8 356 3 pat Putative phenylalanine aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A8EWM9 2.12e-27 114 26 10 305 3 hisC Histidinol-phosphate aminotransferase Aliarcobacter butzleri (strain RM4018)
P61004 2.29e-27 113 27 9 307 3 pat Putative phenylalanine aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q5HWF4 2.55e-27 113 29 9 307 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni (strain RM1221)
B2GBR8 2.64e-27 113 29 10 334 3 hisC Histidinol-phosphate aminotransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B1JBC0 2.94e-27 113 28 11 333 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain W619)
Q11DR9 3.03e-27 113 29 13 347 3 hisC Histidinol-phosphate aminotransferase Chelativorans sp. (strain BNC1)
Q2LST8 3.17e-27 113 25 9 368 3 hisC Histidinol-phosphate aminotransferase Syntrophus aciditrophicus (strain SB)
A1VY36 3.52e-27 113 29 9 307 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
B7JUI4 3.56e-27 113 26 12 335 3 hisC Histidinol-phosphate aminotransferase Rippkaea orientalis (strain PCC 8801 / RF-1)
A7ICA9 3.57e-27 114 28 11 335 3 hisC Histidinol-phosphate aminotransferase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A4QAL4 3.81e-27 112 27 10 356 3 pat Putative phenylalanine aminotransferase Corynebacterium glutamicum (strain R)
Q6A8L4 5.46e-27 113 32 14 342 3 hisC Histidinol-phosphate aminotransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)
A3Q7J9 7.12e-27 112 33 5 208 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain JLS)
Q1B1Z8 7.34e-27 112 33 5 208 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain MCS)
A1UN51 7.34e-27 112 33 5 208 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain KMS)
P73807 8.03e-27 112 27 11 359 3 hisC Histidinol-phosphate aminotransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B6IYQ0 8.12e-27 112 29 10 317 3 hisC Histidinol-phosphate aminotransferase Rhodospirillum centenum (strain ATCC 51521 / SW)
Q47AL9 9.06e-27 112 29 12 353 3 hisC2 Histidinol-phosphate aminotransferase 2 Dechloromonas aromatica (strain RCB)
Q2GAI1 9.9e-27 112 27 8 306 3 hisC Histidinol-phosphate aminotransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q47QS8 1.11e-26 112 31 10 325 3 hisC Histidinol-phosphate aminotransferase Thermobifida fusca (strain YX)
C1B997 1.14e-26 112 30 7 295 3 pat Putative phenylalanine aminotransferase Rhodococcus opacus (strain B4)
B0UN04 1.19e-26 112 29 9 337 3 hisC Histidinol-phosphate aminotransferase Methylobacterium sp. (strain 4-46)
Q87WV6 1.23e-26 111 29 13 341 3 hisC Histidinol-phosphate aminotransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q47KH1 1.51e-26 111 31 9 300 3 pat Putative phenylalanine aminotransferase Thermobifida fusca (strain YX)
Q9HVX0 1.66e-26 111 27 11 354 3 hisC1 Histidinol-phosphate aminotransferase 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B9K9R9 2.02e-26 110 29 8 268 3 hisC Histidinol-phosphate aminotransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A1W431 2.06e-26 111 29 9 314 3 hisC Histidinol-phosphate aminotransferase Acidovorax sp. (strain JS42)
Q2YAU6 2.84e-26 110 28 17 370 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A6QBY8 3.18e-26 110 28 13 286 3 hisC Histidinol-phosphate aminotransferase Sulfurovum sp. (strain NBC37-1)
Q9PII2 3.51e-26 110 28 9 307 1 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q3KHZ1 3.66e-26 110 28 13 357 3 hisC1 Histidinol-phosphate aminotransferase 1 Pseudomonas fluorescens (strain Pf0-1)
A7ZCF3 4.14e-26 110 28 10 312 3 hisC Histidinol-phosphate aminotransferase Campylobacter concisus (strain 13826)
Q0S962 4.21e-26 110 34 3 188 3 pat Putative phenylalanine aminotransferase Rhodococcus jostii (strain RHA1)
Q92L21 4.77e-26 110 29 11 351 3 hisC2 Histidinol-phosphate aminotransferase 2 Rhizobium meliloti (strain 1021)
Q04Z75 5.06e-26 110 27 10 309 3 hisC Histidinol-phosphate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04QW8 5.06e-26 110 27 10 309 3 hisC Histidinol-phosphate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A0R5X8 5.72e-26 110 30 10 304 1 pat Putative phenylalanine aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q92MG0 6.93e-26 109 28 9 335 3 hisC1 Histidinol-phosphate aminotransferase 1 Rhizobium meliloti (strain 1021)
Q8NTT4 8.42e-26 108 28 7 306 3 pat Probable phenylalanine aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A7H556 8.57e-26 109 28 9 307 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
B3Q8Z5 1.01e-25 109 27 10 339 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain TIE-1)
P61002 1.01e-25 109 27 10 339 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8U9W3 1.7e-25 108 29 10 333 3 hisC Histidinol-phosphate aminotransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q131B9 1.71e-25 108 28 13 342 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisB5)
B9KDN6 2.06e-25 108 27 8 303 3 hisC Histidinol-phosphate aminotransferase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A1TGS6 2.99e-25 107 33 4 201 3 pat Putative phenylalanine aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q987C8 3.34e-25 107 28 11 343 3 hisC1 Histidinol-phosphate aminotransferase 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A2SSJ1 4.84e-25 107 27 12 352 3 hisC Histidinol-phosphate aminotransferase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
Q2N7G6 1.04e-24 106 27 10 365 3 hisC Histidinol-phosphate aminotransferase Erythrobacter litoralis (strain HTCC2594)
A0RMN9 1.12e-24 106 26 9 312 3 hisC Histidinol-phosphate aminotransferase Campylobacter fetus subsp. fetus (strain 82-40)
P34037 1.19e-24 106 25 11 358 1 hisC Histidinol-phosphate aminotransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A5FVN2 1.78e-24 105 28 12 368 3 hisC Histidinol-phosphate aminotransferase Acidiphilium cryptum (strain JF-5)
Q0C348 1.78e-24 105 29 8 286 3 hisC Histidinol-phosphate aminotransferase Hyphomonas neptunium (strain ATCC 15444)
Q9X0D0 2.32e-24 105 29 10 293 1 hisC Histidinol-phosphate aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q98G10 3.09e-24 105 27 13 360 3 hisC2 Histidinol-phosphate aminotransferase 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P55683 4.07e-24 105 26 10 312 3 hisC Histidinol-phosphate aminotransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B1L869 6.01e-24 103 29 10 293 3 hisC Histidinol-phosphate aminotransferase Thermotoga sp. (strain RQ2)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_09095
Feature type CDS
Gene hisC
Product histidinol-phosphate transaminase
Location 53360 - 54436 (strand: -1)
Length 1077 (nucleotides) / 358 (amino acids)

Contig

Accession ZDB_686
Length 191111 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_288
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0079 Amino acid transport and metabolism (E) E Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase

Kegg Ortholog Annotation(s)

Protein Sequence

MNKPFSAMALARENVQLLTPYQSARRLGGNGDVWLNANEYPQAPDFTFTDRNLNRYPECQPANVINRYAAYAGVSPEQVIAGRGADESIELLIRAFCEPGKDAVLFCPPTYGMYSVSAETFGVAQKVVPALDGWQLDLDSIAASLDNVKVLYVCHPNNPTGNPIREQDLRYLFDIVDNRALIVVDEAYIEFCSEFSVASWLKEYPNLVILRTLSKAFALAGLRCGFTLASADIINVLMKVIAPYPLSSPVAAIAAEALLPEGIAVMQERVTEICRNRQMLCDELQKLPLTETVFPSKTNYILVRFRDAERVFRSLWNEGIILRDQRKQRGLENCLRITVGTQAECLRVITAIAALEMP

Flanking regions ( +/- flanking 50bp)

AATGCCGTGACACTGCGGATGAATGCCCTGAAAGCGGAGGAAAACAACCGATGAACAAACCATTCAGCGCGATGGCACTGGCCCGCGAAAACGTGCAGTTACTGACGCCGTATCAGTCGGCACGCCGTCTCGGCGGTAACGGGGATGTCTGGCTGAACGCCAACGAATATCCGCAGGCACCGGATTTCACCTTTACGGATCGCAACCTGAACCGCTATCCGGAGTGTCAGCCTGCGAACGTGATCAACCGCTATGCGGCTTACGCCGGTGTCAGTCCGGAGCAGGTTATCGCGGGGCGCGGCGCAGATGAAAGCATTGAATTACTGATCCGTGCCTTCTGCGAGCCGGGAAAAGATGCCGTGCTGTTCTGCCCGCCGACATACGGTATGTACAGCGTCAGTGCGGAAACCTTTGGTGTCGCACAGAAAGTGGTGCCGGCACTGGATGGCTGGCAATTGGATCTGGACAGTATCGCGGCCAGCCTTGATAACGTCAAAGTGCTGTATGTCTGCCACCCGAATAACCCGACCGGTAACCCGATCCGCGAACAGGATCTGCGTTATCTGTTTGATATCGTTGATAACCGCGCACTGATTGTGGTCGATGAGGCCTATATCGAATTCTGCTCGGAGTTCAGCGTGGCATCGTGGCTGAAAGAATACCCGAACCTGGTGATCCTGCGCACGCTCTCCAAAGCGTTTGCGCTCGCCGGACTGCGCTGCGGCTTCACACTGGCCTCTGCGGATATTATTAACGTGCTGATGAAAGTGATCGCGCCCTATCCGCTGTCGTCCCCGGTGGCAGCCATTGCTGCCGAAGCTCTGCTGCCGGAAGGCATTGCCGTAATGCAGGAGCGCGTCACTGAAATCTGCCGCAACCGGCAGATGCTGTGTGATGAGCTGCAAAAGCTGCCGCTGACGGAAACCGTTTTCCCGAGCAAAACCAACTACATTCTGGTGCGTTTCCGTGACGCGGAACGGGTTTTCCGCAGCCTGTGGAATGAAGGAATTATTTTGCGTGACCAGCGCAAACAACGCGGGCTGGAAAACTGTCTGCGCATTACTGTCGGCACCCAGGCGGAATGCCTGCGGGTGATCACCGCTATCGCCGCGCTTGAAATGCCATAATCTGAGGACAACGGATACCATGACACAGAACGTTTTATTTATTGACCGCG