Homologs in group_263

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06920 FBDBKF_06920 87.2 Morganella morganii S1 hisC histidinol-phosphate transaminase
EHELCC_04050 EHELCC_04050 87.2 Morganella morganii S2 hisC histidinol-phosphate transaminase
NLDBIP_04050 NLDBIP_04050 87.2 Morganella morganii S4 hisC histidinol-phosphate transaminase
LHKJJB_09880 LHKJJB_09880 87.2 Morganella morganii S3 hisC histidinol-phosphate transaminase
HKOGLL_09095 HKOGLL_09095 87.2 Morganella morganii S5 hisC histidinol-phosphate transaminase
PMI_RS03265 PMI_RS03265 65.9 Proteus mirabilis HI4320 hisC histidinol-phosphate transaminase
PMI_RS14095 PMI_RS14095 20.6 Proteus mirabilis HI4320 - valine--pyruvate transaminase

Distribution of the homologs in the orthogroup group_263

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_263

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N6I1 3.28e-176 512 67 0 355 3 hisCD Putative histidine biosynthesis bifunctional protein HisCD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B6I848 1.14e-172 487 67 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SE11)
P06986 1.14e-172 487 67 0 344 1 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12)
B1X6V8 1.14e-172 487 67 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / DH10B)
C4ZSB0 1.14e-172 487 67 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M400 1.14e-172 487 67 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O8 (strain IAI1)
A8A1P5 2.08e-172 486 67 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O9:H4 (strain HS)
B2TYF9 2.76e-172 486 66 0 344 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7UT58 2.76e-172 486 67 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7L9P8 4.99e-172 485 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain 55989 / EAEC)
Q323J1 5.75e-172 485 66 0 344 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 4 (strain Sb227)
B7NQG9 6.85e-172 485 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YU77 7.47e-172 485 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q9S5G6 7.47e-172 485 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7
Q6D410 9.33e-172 485 65 0 350 3 hisC Histidinol-phosphate aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7ZNJ3 1.24e-171 484 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
B1IZ53 1.46e-171 484 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7MDH5 2.28e-171 484 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7FJH1 3.48e-171 484 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JPW1 4.43e-171 484 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q1RA52 5.66e-171 483 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain UTI89 / UPEC)
Q8FG51 5.66e-171 483 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TG66 5.66e-171 483 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1JTV9 7.25e-171 483 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B7LUF2 9.06e-171 482 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LP20 1e-170 482 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SMS-3-5 / SECEC)
Q83KJ6 2.35e-170 481 66 0 344 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri
Q0T3A6 2.35e-170 481 66 0 344 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri serotype 5b (strain 8401)
A7MJP4 2.35e-170 481 66 0 348 3 hisC Histidinol-phosphate aminotransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q3Z0G4 2.77e-170 481 66 0 344 3 hisC Histidinol-phosphate aminotransferase Shigella sonnei (strain Ss046)
A4TKK4 3.99e-170 481 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis (strain Pestoides F)
Q1CGX0 3.99e-170 481 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2K5 3.99e-170 481 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFX6 3.99e-170 481 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis
Q1C9R1 3.99e-170 481 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Antiqua)
Q66C50 4.8e-170 481 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZM8 4.8e-170 481 64 0 355 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B7NC61 5.1e-170 480 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A1ACN3 5.82e-170 480 66 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O1:K1 / APEC
Q8Z5J9 5.93e-170 480 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella typhi
A8AEK3 7.97e-170 480 65 0 347 3 hisC Histidinol-phosphate aminotransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7MWU0 9.02e-170 479 65 0 344 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O81 (strain ED1a)
Q32EF0 1.15e-169 479 66 0 344 3 hisC Histidinol-phosphate aminotransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q57MS2 1.41e-169 479 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella choleraesuis (strain SC-B67)
B4TMR6 1.96e-169 479 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella schwarzengrund (strain CVM19633)
B5RBR3 1.96e-169 479 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZL3 1.96e-169 479 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5EX40 1.96e-169 479 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella agona (strain SL483)
B5FM42 2.04e-169 479 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella dublin (strain CT_02021853)
C0Q1K1 2.52e-169 479 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi C (strain RKS4594)
A9MSC2 2.72e-169 479 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SX42 2.72e-169 479 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella newport (strain SL254)
B4T9N5 3.38e-169 478 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella heidelberg (strain SL476)
P10369 3.77e-169 478 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BFB9 6.04e-169 478 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain AKU_12601)
Q5PDP4 6.04e-169 478 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C6DF75 1.62e-168 476 64 0 347 3 hisC Histidinol-phosphate aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A9ML15 1.11e-167 474 64 0 348 3 hisC Histidinol-phosphate aminotransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4WC70 1.54e-166 471 64 0 348 3 hisC Histidinol-phosphate aminotransferase Enterobacter sp. (strain 638)
A8GC78 5.83e-165 468 63 0 351 3 hisC Histidinol-phosphate aminotransferase Serratia proteamaculans (strain 568)
A6TBC4 6.49e-163 462 64 0 348 1 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XPE6 9.25e-160 454 62 0 348 3 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae (strain 342)
Q2NTX2 4.16e-159 453 62 0 352 3 hisC Histidinol-phosphate aminotransferase Sodalis glossinidius (strain morsitans)
Q65RB2 5.23e-151 432 59 1 348 3 hisC2 Histidinol-phosphate aminotransferase 2 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1LT68 1.16e-148 426 58 1 343 3 hisC Histidinol-phosphate aminotransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q9CLM3 1.68e-146 421 57 1 348 3 hisC1 Histidinol-phosphate aminotransferase 1 Pasteurella multocida (strain Pm70)
Q492K2 4.72e-144 414 54 0 348 3 hisC Histidinol-phosphate aminotransferase Blochmanniella pennsylvanica (strain BPEN)
Q7VQW9 1.95e-141 408 54 0 347 3 hisC Histidinol-phosphate aminotransferase Blochmanniella floridana
P44423 1.83e-140 406 53 0 347 3 hisC1 Histidinol-phosphate aminotransferase 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UGY2 2.12e-140 405 53 0 347 3 hisC Histidinol-phosphate aminotransferase Haemophilus influenzae (strain PittGG)
Q4QN73 3.62e-140 404 53 0 347 3 hisC1 Histidinol-phosphate aminotransferase 1 Haemophilus influenzae (strain 86-028NP)
A5UA19 3.74e-140 404 53 0 347 3 hisC Histidinol-phosphate aminotransferase Haemophilus influenzae (strain PittEE)
Q84I53 4.13e-138 400 55 2 349 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Diuraphis noxia
Q9ZHE5 2.58e-136 395 51 1 347 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A7MX17 1.94e-134 390 55 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio campbellii (strain ATCC BAA-1116)
C3LU31 2.36e-134 389 55 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain M66-2)
A5F2A2 2.36e-134 389 55 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B8D707 5.41e-134 389 51 2 349 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8Q3 5.41e-134 389 51 2 349 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57202 6.17e-134 389 51 2 349 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5E637 7.19e-134 388 55 2 343 3 hisC Histidinol-phosphate aminotransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87QL0 9.14e-134 388 54 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KSX2 1.1e-133 388 55 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B5FDA0 2.14e-133 387 54 2 343 3 hisC Histidinol-phosphate aminotransferase Aliivibrio fischeri (strain MJ11)
Q6LT75 3.15e-131 382 54 2 348 3 hisC Histidinol-phosphate aminotransferase Photobacterium profundum (strain SS9)
B6EJ89 1.5e-129 377 54 2 343 3 hisC Histidinol-phosphate aminotransferase Aliivibrio salmonicida (strain LFI1238)
A4SMP7 2.73e-129 377 55 0 348 3 hisC Histidinol-phosphate aminotransferase Aeromonas salmonicida (strain A449)
Q7MLS5 1.24e-127 372 55 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio vulnificus (strain YJ016)
A0KKB7 1.4e-127 373 53 0 354 3 hisC Histidinol-phosphate aminotransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8D8Q1 1.43e-126 370 54 2 343 3 hisC Histidinol-phosphate aminotransferase Vibrio vulnificus (strain CMCP6)
Q89AX7 1.13e-125 368 49 0 340 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q84I51 1.1e-118 350 48 2 346 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Schlechtendalia chinensis
Q84I52 2.89e-118 349 47 2 348 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Melaphis rhois
Q15RU8 1.61e-110 330 48 1 348 3 hisC Histidinol-phosphate aminotransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5QWQ9 5.5e-108 323 46 3 340 3 hisC2 Histidinol-phosphate aminotransferase 2 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q058A6 5.4e-104 312 45 0 344 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q8EFB2 3.1e-93 286 43 6 356 3 hisC Histidinol-phosphate aminotransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q47XB7 1.3e-92 284 41 5 365 3 hisC Histidinol-phosphate aminotransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3BUF6 1.36e-84 263 40 3 352 3 hisC Histidinol-phosphate aminotransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q87C30 2.38e-83 260 39 4 358 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I5Y0 2.38e-83 260 39 4 358 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain M23)
P58891 2.78e-83 260 40 3 352 3 hisC Histidinol-phosphate aminotransferase Xanthomonas axonopodis pv. citri (strain 306)
B0U3B2 3.43e-83 260 39 3 352 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain M12)
Q9PBC6 8.42e-83 259 39 3 352 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain 9a5c)
B4STN8 1.02e-81 256 41 3 346 3 hisC Histidinol-phosphate aminotransferase Stenotrophomonas maltophilia (strain R551-3)
Q5H0L0 2.14e-81 255 40 3 352 3 hisC Histidinol-phosphate aminotransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3K2 2.14e-81 255 40 3 352 3 hisC Histidinol-phosphate aminotransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B2FPM0 2.22e-79 250 40 4 348 3 hisC Histidinol-phosphate aminotransferase Stenotrophomonas maltophilia (strain K279a)
Q4UU41 1.2e-75 240 38 3 352 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain 8004)
B0RSL5 2.48e-75 239 38 3 352 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain B100)
A1S6Z2 5.93e-75 238 44 8 354 3 hisC Histidinol-phosphate aminotransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
P58892 1.69e-74 237 38 3 352 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0TY45 7.43e-73 233 34 4 349 3 hisC Histidinol-phosphate aminotransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q11VM5 5.51e-72 230 36 5 352 3 hisC Histidinol-phosphate aminotransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A0M287 1.94e-69 224 34 5 358 3 hisC Histidinol-phosphate aminotransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A6GY79 2.03e-68 221 34 6 355 3 hisC Histidinol-phosphate aminotransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
A6LAM2 1.07e-65 214 35 6 352 3 hisC Histidinol-phosphate aminotransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A5FFY0 2.74e-65 213 34 5 356 3 hisC Histidinol-phosphate aminotransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A6L2V8 1.51e-61 203 35 7 348 3 hisC Histidinol-phosphate aminotransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q64RE8 3.54e-60 200 35 8 350 3 hisC Histidinol-phosphate aminotransferase Bacteroides fragilis (strain YCH46)
Q5LAZ9 3.86e-60 200 35 8 350 3 hisC Histidinol-phosphate aminotransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q8ABA8 5.13e-56 189 33 7 349 3 hisC Histidinol-phosphate aminotransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B0K735 6.18e-55 186 36 6 291 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K625 2.47e-54 185 35 6 291 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter sp. (strain X514)
A5N7Q7 6.57e-54 184 32 14 359 3 hisC Histidinol-phosphate aminotransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E168 6.57e-54 184 32 14 359 3 hisC Histidinol-phosphate aminotransferase Clostridium kluyveri (strain NBRC 12016)
Q5WX92 1.76e-52 181 35 6 327 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila (strain Lens)
A5CZ78 2.39e-52 180 36 10 323 3 hisC Histidinol-phosphate aminotransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q5X5X0 2.63e-52 180 35 6 327 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila (strain Paris)
P36605 5.08e-52 180 31 7 358 3 his3 Histidinol-phosphate aminotransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5ZW88 1.17e-51 178 35 8 332 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P56099 2.66e-50 176 32 11 373 3 HIS5 Histidinol-phosphate aminotransferase Candida maltosa
P07172 6.93e-48 169 31 13 373 1 HIS5 Histidinol-phosphate aminotransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B4S8L6 2.01e-47 167 32 10 351 3 hisC Histidinol-phosphate aminotransferase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q8TH25 9.16e-47 165 30 11 354 3 hisC Histidinol-phosphate aminotransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
C5A7A4 1.09e-46 164 31 10 343 3 hisC Histidinol-phosphate aminotransferase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q7NL03 1.14e-46 165 38 8 311 3 hisC Histidinol-phosphate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8R5Q4 7.63e-46 162 33 7 292 1 hisC Histidinol-phosphate aminotransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B8I5V1 2.72e-45 161 30 11 355 3 hisC Histidinol-phosphate aminotransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q8KD01 1.66e-44 159 31 7 338 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B4SGL8 1.74e-43 157 30 7 335 3 hisC Histidinol-phosphate aminotransferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q5JFU6 8.91e-43 154 32 9 343 3 hisC Histidinol-phosphate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
B3DXN2 1.85e-42 154 32 10 324 3 hisC Histidinol-phosphate aminotransferase Methylacidiphilum infernorum (isolate V4)
Q57004 2.68e-42 154 30 12 366 3 hisC2 Histidinol-phosphate aminotransferase 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C0ZCE7 2.88e-42 154 32 11 314 3 hisC Histidinol-phosphate aminotransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q3Z879 3.11e-42 153 32 10 331 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q4QLD1 6e-42 153 30 12 366 3 hisC2 Histidinol-phosphate aminotransferase 2 Haemophilus influenzae (strain 86-028NP)
A4FWW1 1.33e-41 152 30 11 315 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q9RRM7 2.7e-41 151 32 7 308 3 hisC Histidinol-phosphate aminotransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
O27624 3.05e-41 151 31 13 381 3 hisC Histidinol-phosphate aminotransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A4SE60 3.97e-41 150 32 7 335 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
P61003 4.77e-41 150 29 13 342 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
B3ECG2 7.48e-41 150 30 10 343 3 hisC Histidinol-phosphate aminotransferase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
A5V022 1.23e-40 149 33 14 366 3 hisC Histidinol-phosphate aminotransferase Roseiflexus sp. (strain RS-1)
A1BGB4 2.03e-40 149 30 8 350 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A5UKY0 2.14e-40 149 32 13 335 3 hisC Histidinol-phosphate aminotransferase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A4WUN9 2.98e-40 148 34 11 336 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q8YMG7 3.02e-40 149 31 9 325 3 hisC2 Histidinol-phosphate aminotransferase 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2JPM4 3.81e-40 148 31 11 332 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
A3PIA4 8.93e-40 147 33 11 336 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B9KPH4 9.31e-40 147 33 11 336 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3J445 9.91e-40 147 33 11 336 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P45358 1.12e-39 147 31 11 350 3 hisC Histidinol-phosphate aminotransferase Acetobacter pasteurianus
Q9KCA8 1.93e-39 146 33 9 305 3 hisC Histidinol-phosphate aminotransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A6UPL6 1.99e-39 146 29 11 339 3 hisC Histidinol-phosphate aminotransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q5QZ49 2e-39 146 29 13 374 3 hisC1 Histidinol-phosphate aminotransferase 1 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q58365 2.26e-39 146 29 13 368 3 hisC Histidinol-phosphate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O07131 2.9e-39 145 31 10 359 3 hisC Histidinol-phosphate aminotransferase Methylobacillus flagellatus
Q3MAX6 3.63e-39 146 31 10 325 3 hisC2 Histidinol-phosphate aminotransferase 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q18F03 5.4e-39 145 30 7 334 3 hisC Histidinol-phosphate aminotransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q65S79 5.89e-39 145 29 11 363 3 hisC1 Histidinol-phosphate aminotransferase 1 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A7GN55 1.89e-38 144 30 11 349 3 hisC Histidinol-phosphate aminotransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q3ARM7 2.78e-38 143 29 9 367 3 hisC Histidinol-phosphate aminotransferase Chlorobium chlorochromatii (strain CaD3)
Q3B3L3 3.46e-38 142 30 7 336 3 hisC Histidinol-phosphate aminotransferase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B3QP11 4.39e-38 142 29 7 337 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A9AA96 5.27e-38 142 29 11 314 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A5FR29 5.47e-38 142 32 10 331 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q51687 5.8e-38 142 33 13 336 3 hisC Histidinol-phosphate aminotransferase Paracoccus denitrificans (strain Pd 1222)
A6VGF6 6.36e-38 142 29 10 312 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q3AAT6 7.78e-38 142 31 11 359 3 hisC2 Histidinol-phosphate aminotransferase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q163G3 8.73e-38 142 32 10 333 3 hisC Histidinol-phosphate aminotransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q3ZXL8 8.82e-38 142 32 10 331 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain CBDB1)
A7HCR6 9.08e-38 142 30 11 367 3 hisC Histidinol-phosphate aminotransferase Anaeromyxobacter sp. (strain Fw109-5)
Q2NEQ0 1.03e-37 142 30 12 333 3 hisC Histidinol-phosphate aminotransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q67KI2 1.05e-37 141 32 10 361 3 hisC Histidinol-phosphate aminotransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A5CVR5 1.13e-37 141 30 11 307 3 hisC Histidinol-phosphate aminotransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q6HL37 1.14e-37 142 31 10 312 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
B9LZ53 1.2e-37 141 31 11 329 3 hisC Histidinol-phosphate aminotransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A8FEJ6 1.25e-37 141 30 7 311 3 hisC Histidinol-phosphate aminotransferase Bacillus pumilus (strain SAFR-032)
B1HTD4 1.32e-37 141 32 8 295 3 hisC Histidinol-phosphate aminotransferase Lysinibacillus sphaericus (strain C3-41)
Q10VS0 1.64e-37 141 32 11 326 3 hisC Histidinol-phosphate aminotransferase Trichodesmium erythraeum (strain IMS101)
Q81SV5 1.7e-37 141 31 10 312 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus anthracis
B2HQA3 1.9e-37 141 31 14 330 3 hisC Histidinol-phosphate aminotransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
B9EAC1 1.94e-37 140 30 9 326 3 hisC Histidinol-phosphate aminotransferase Macrococcus caseolyticus (strain JCSC5402)
A7NFV2 2.32e-37 140 31 13 363 3 hisC Histidinol-phosphate aminotransferase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q4K8N0 2.48e-37 140 31 12 368 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q63DL4 2.5e-37 140 31 10 312 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ZK / E33L)
C5D3D2 2.78e-37 140 32 10 314 3 hisC Histidinol-phosphate aminotransferase Geobacillus sp. (strain WCH70)
Q5KXV3 3.32e-37 140 31 12 364 3 hisC Histidinol-phosphate aminotransferase Geobacillus kaustophilus (strain HTA426)
Q8TVG3 4.11e-37 140 33 13 313 3 hisC Histidinol-phosphate aminotransferase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q31GD4 4.36e-37 140 29 8 306 3 hisC2 Histidinol-phosphate aminotransferase 2 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
O67857 4.37e-37 140 30 11 340 3 hisC Histidinol-phosphate aminotransferase Aquifex aeolicus (strain VF5)
A4IQ80 4.73e-37 140 32 12 337 3 hisC Histidinol-phosphate aminotransferase Geobacillus thermodenitrificans (strain NG80-2)
Q73AX7 4.91e-37 140 31 10 312 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5ZU10 5.45e-37 140 28 6 307 3 hisC2 Histidinol-phosphate aminotransferase 2 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A6UTL8 5.72e-37 140 28 12 340 3 hisC Histidinol-phosphate aminotransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
P17736 5.89e-37 139 32 10 337 3 hisC Histidinol-phosphate aminotransferase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
A0PXP5 7.12e-37 139 28 8 303 3 hisC Histidinol-phosphate aminotransferase Clostridium novyi (strain NT)
Q5WV43 9.93e-37 139 28 7 307 3 hisC2 Histidinol-phosphate aminotransferase 2 Legionella pneumophila (strain Lens)
Q02YW3 1.17e-36 139 29 10 350 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. cremoris (strain SK11)
O28255 1.27e-36 138 30 13 352 3 hisC2 Histidinol-phosphate aminotransferase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q39K90 1.43e-36 138 31 13 351 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A0PP15 1.7e-36 139 30 15 351 3 hisC Histidinol-phosphate aminotransferase Mycobacterium ulcerans (strain Agy99)
Q28TL1 2.85e-36 137 29 11 346 3 hisC Histidinol-phosphate aminotransferase Jannaschia sp. (strain CCS1)
B2UPR9 3.29e-36 137 31 8 340 3 hisC Histidinol-phosphate aminotransferase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q46Y48 3.85e-36 137 31 9 309 3 hisC1 Histidinol-phosphate aminotransferase 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q03VY3 4.6e-36 137 30 8 320 3 hisC Histidinol-phosphate aminotransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q2JTG5 4.76e-36 137 31 11 334 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain JA-3-3Ab)
A8AY31 5.85e-36 137 31 12 353 3 hisC Histidinol-phosphate aminotransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8Y0Y8 7.8e-36 137 32 8 309 3 hisC2 Histidinol-phosphate aminotransferase 2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3JMZ7 8.13e-36 136 33 10 299 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia pseudomallei (strain 1710b)
Q63Q87 8.84e-36 136 33 10 299 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia pseudomallei (strain K96243)
Q62GE0 8.84e-36 136 33 10 299 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia mallei (strain ATCC 23344)
Q4FSH2 8.92e-36 137 29 10 367 3 hisC1 Histidinol-phosphate aminotransferase 1 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q8DM42 9.54e-36 136 32 12 306 3 hisC Histidinol-phosphate aminotransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q2RL44 1.1e-35 137 31 12 370 3 hisC Histidinol-phosphate aminotransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A3CNT7 1.35e-35 135 30 10 347 3 hisC Histidinol-phosphate aminotransferase Streptococcus sanguinis (strain SK36)
Q97ES6 1.37e-35 135 29 12 346 3 hisC Histidinol-phosphate aminotransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B1N009 1.83e-35 135 30 10 327 3 hisC Histidinol-phosphate aminotransferase Leuconostoc citreum (strain KM20)
Q5X3Q5 1.91e-35 135 27 7 307 3 hisC2 Histidinol-phosphate aminotransferase 2 Legionella pneumophila (strain Paris)
A4XMY1 1.98e-35 135 29 12 366 3 hisC Histidinol-phosphate aminotransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q5N4R3 2.22e-35 135 33 12 318 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31PF9 2.38e-35 135 33 12 318 3 hisC Histidinol-phosphate aminotransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q3M504 2.69e-35 135 31 13 359 3 hisC1 Histidinol-phosphate aminotransferase 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q24QJ1 2.72e-35 135 29 9 343 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain Y51)
P0DI07 2.86e-35 136 32 11 333 1 HISN6B Histidinol-phosphate aminotransferase 2, chloroplastic Arabidopsis thaliana
B9DHD3 2.86e-35 136 32 11 333 1 HISN6A Histidinol-phosphate aminotransferase 1, chloroplastic Arabidopsis thaliana
Q1GET3 3.04e-35 135 32 11 335 3 hisC Histidinol-phosphate aminotransferase Ruegeria sp. (strain TM1040)
Q3AD52 3.07e-35 134 32 9 308 3 hisC1 Histidinol-phosphate aminotransferase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q9RI00 3.12e-35 135 30 14 371 3 hisC Histidinol-phosphate aminotransferase Stutzerimonas stutzeri
Q3J7H2 3.31e-35 135 31 15 339 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q8ESS3 3.77e-35 134 28 12 355 3 hisC1 Histidinol-phosphate aminotransferase 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A7Z614 7.25e-35 134 29 9 362 3 hisC Histidinol-phosphate aminotransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P16246 8.26e-35 134 30 9 317 3 hisC Histidinol-phosphate aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q3IRT1 1.16e-34 133 29 9 343 3 hisC Histidinol-phosphate aminotransferase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A1R558 1.33e-34 133 30 11 314 3 hisC Histidinol-phosphate aminotransferase Paenarthrobacter aurescens (strain TC1)
Q8FNZ1 1.39e-34 133 30 12 354 3 hisC Histidinol-phosphate aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q47GP2 1.49e-34 133 30 9 309 3 hisC1 Histidinol-phosphate aminotransferase 1 Dechloromonas aromatica (strain RCB)
B8FP20 1.74e-34 133 30 8 313 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q5V4K3 1.89e-34 133 28 9 339 3 hisC Histidinol-phosphate aminotransferase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q3K8U2 2e-34 133 30 11 365 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas fluorescens (strain Pf0-1)
O33770 2.28e-34 133 33 11 310 3 hisC Histidinol-phosphate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q0P8H7 2.6e-34 132 32 14 362 1 Cj1437c Dihydroxyacetone phosphate transaminase Cj1437c Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q970Z4 2.9e-34 132 30 12 329 3 hisC Histidinol-phosphate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
A3CWS8 3.11e-34 132 29 10 342 3 hisC Histidinol-phosphate aminotransferase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q845V2 3.18e-34 132 32 10 299 3 hisC Histidinol-phosphate aminotransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q46E46 3.51e-34 132 31 13 341 3 hisC Histidinol-phosphate aminotransferase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q8YV89 4.74e-34 131 30 16 362 3 hisC1 Histidinol-phosphate aminotransferase 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A6LUF3 5.32e-34 131 28 12 344 3 hisC Histidinol-phosphate aminotransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q82XE0 6.62e-34 131 29 9 306 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P60999 9.63e-34 131 30 10 331 3 hisC Histidinol-phosphate aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q5LNM6 1.1e-33 130 31 11 337 3 hisC Histidinol-phosphate aminotransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q65I37 1.1e-33 130 29 10 367 3 hisC Histidinol-phosphate aminotransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A5G9G1 1.26e-33 130 30 11 328 3 hisC Histidinol-phosphate aminotransferase Geotalea uraniireducens (strain Rf4)
A4QFG6 1.27e-33 130 29 13 339 3 hisC Histidinol-phosphate aminotransferase Corynebacterium glutamicum (strain R)
C1ATZ5 1.39e-33 131 31 12 336 3 hisC Histidinol-phosphate aminotransferase Rhodococcus opacus (strain B4)
Q02135 1.53e-33 130 28 10 350 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q9KJU4 1.64e-33 130 29 13 339 1 hisC Histidinol-phosphate aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B1WY56 1.88e-33 130 28 12 354 3 hisC Histidinol-phosphate aminotransferase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q9CMI7 1.9e-33 130 30 12 363 3 hisC2 Histidinol-phosphate aminotransferase 2 Pasteurella multocida (strain Pm70)
P17731 2.13e-33 130 28 10 367 3 hisC Histidinol-phosphate aminotransferase Bacillus subtilis (strain 168)
Q3JEN8 2.22e-33 130 28 11 365 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q6AQK2 2.66e-33 130 27 13 366 3 hisC Histidinol-phosphate aminotransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q0SHX9 2.73e-33 130 31 12 336 3 hisC Histidinol-phosphate aminotransferase Rhodococcus jostii (strain RHA1)
P60998 3.03e-33 130 29 12 351 3 hisC Histidinol-phosphate aminotransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A6VUD3 3.53e-33 129 28 14 360 3 hisC Histidinol-phosphate aminotransferase Marinomonas sp. (strain MWYL1)
Q3SK85 3.67e-33 130 28 12 359 3 hisC1 Histidinol-phosphate aminotransferase 1 Thiobacillus denitrificans (strain ATCC 25259)
Q6ABU3 3.8e-33 129 29 10 353 3 pat Putative phenylalanine aminotransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q82AA5 3.83e-33 129 29 9 317 3 hisC Histidinol-phosphate aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q5YYP9 3.89e-33 130 31 12 334 3 hisC Histidinol-phosphate aminotransferase Nocardia farcinica (strain IFM 10152)
Q7WHN5 4.14e-33 129 29 9 353 3 hisC1 Histidinol-phosphate aminotransferase 1 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W6Q1 4.18e-33 129 29 9 353 3 hisC1 Histidinol-phosphate aminotransferase 1 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
B8HW95 4.23e-33 129 31 12 346 3 hisC Histidinol-phosphate aminotransferase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q8KZ92 4.28e-33 129 28 10 367 3 hisC Histidinol-phosphate aminotransferase Bacillus subtilis subsp. natto
Q3A7R3 4.85e-33 129 30 11 332 3 hisC Histidinol-phosphate aminotransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A3Q130 6.19e-33 129 31 11 343 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain JLS)
Q39CT7 7.85e-33 128 30 13 357 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1B7G5 1.12e-32 128 31 11 343 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain MCS)
A1UHK7 1.12e-32 128 31 11 343 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain KMS)
A0QX82 1.47e-32 128 29 13 366 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q39M27 2.07e-32 127 32 14 379 3 hisC3 Histidinol-phosphate aminotransferase 3 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B7GHJ8 2.26e-32 127 29 6 309 3 hisC Histidinol-phosphate aminotransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A2RKS5 2.4e-32 127 28 10 350 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. cremoris (strain MG1363)
A1VEW4 2.54e-32 127 30 8 304 3 hisC Histidinol-phosphate aminotransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q63XM1 2.83e-32 127 30 14 359 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia pseudomallei (strain K96243)
Q3JW89 2.83e-32 127 30 14 359 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia pseudomallei (strain 1710b)
Q6GIR8 2.88e-32 127 29 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MRSA252)
Q5FQA6 2.95e-32 127 31 12 359 3 hisC2 Histidinol-phosphate aminotransferase 2 Gluconobacter oxydans (strain 621H)
Q2SBJ7 2.99e-32 127 31 17 365 3 hisC Histidinol-phosphate aminotransferase Hahella chejuensis (strain KCTC 2396)
B9LNJ8 3.23e-32 127 29 8 330 3 hisC Histidinol-phosphate aminotransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
O28277 4.23e-32 125 32 10 316 3 hisC1 Histidinol-phosphate aminotransferase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9HZ68 4.38e-32 126 29 12 368 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A8HZS2 5.56e-32 126 29 8 334 3 hisC Histidinol-phosphate aminotransferase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q0W253 7.47e-32 125 31 9 306 3 hisC Histidinol-phosphate aminotransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q46WL3 8.68e-32 125 31 10 312 1 hisC2 Histidinol-phosphate aminotransferase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q5WGR9 9.24e-32 125 30 10 353 3 hisC Histidinol-phosphate aminotransferase Shouchella clausii (strain KSM-K16)
Q8NXN3 9.66e-32 125 29 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MW2)
Q6GBA6 9.66e-32 125 29 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MSSA476)
Q72DA0 9.71e-32 125 30 8 304 1 hisC Histidinol-phosphate aminotransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q2Y6Y6 1.11e-31 126 28 9 305 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q49VS0 1.2e-31 125 30 10 296 3 hisC Histidinol-phosphate aminotransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2W047 1.37e-31 125 31 9 314 3 hisC Histidinol-phosphate aminotransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q8PX17 1.4e-31 125 30 12 314 3 hisC Histidinol-phosphate aminotransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q9HQS0 1.55e-31 125 27 9 339 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4Q4 1.55e-31 125 27 9 339 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q311Z4 1.67e-31 125 28 7 315 3 hisC Histidinol-phosphate aminotransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q7VWL5 1.7e-31 125 28 9 353 3 hisC1 Histidinol-phosphate aminotransferase 1 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
C3KVX5 1.72e-31 124 26 11 350 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain 657 / Type Ba4)
P9WML7 1.88e-31 125 29 15 361 1 hisC Histidinol-phosphate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WML6 1.88e-31 125 29 15 361 3 hisC Histidinol-phosphate aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U2V6 1.88e-31 125 29 15 361 3 hisC Histidinol-phosphate aminotransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1ANM2 1.88e-31 125 29 15 361 3 hisC Histidinol-phosphate aminotransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KJ16 1.88e-31 125 29 15 361 3 hisC Histidinol-phosphate aminotransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A679 1.88e-31 125 29 15 361 3 hisC Histidinol-phosphate aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1GP30 2.1e-31 125 30 12 363 3 hisC Histidinol-phosphate aminotransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q8TUE9 2.15e-31 125 29 12 341 3 hisC Histidinol-phosphate aminotransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q736A5 2.49e-31 124 30 8 302 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
A8YZZ5 2.77e-31 124 29 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300 / TCH1516)
P67725 2.77e-31 124 29 13 355 1 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain N315)
P67724 2.77e-31 124 29 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QF32 2.77e-31 124 29 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Newman)
Q5HHU9 2.77e-31 124 29 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain COL)
A5IQS7 2.77e-31 124 29 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH9)
Q2G087 2.77e-31 124 29 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIR7 2.77e-31 124 29 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300)
A6TZK2 2.77e-31 124 29 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH1)
A7WZL0 2.77e-31 124 29 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2J8K9 2.81e-31 125 30 15 377 3 hisC Histidinol-phosphate aminotransferase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q62FC0 2.83e-31 124 29 14 359 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia mallei (strain ATCC 23344)
Q608S3 3.06e-31 124 27 12 376 3 hisC2 Histidinol-phosphate aminotransferase 2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q81FQ1 3.37e-31 124 29 9 308 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A0AK37 3.69e-31 124 29 10 332 3 hisC Histidinol-phosphate aminotransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B9DK21 5.48e-31 123 29 7 291 3 hisC Histidinol-phosphate aminotransferase Staphylococcus carnosus (strain TM300)
Q8Y5X8 6.34e-31 123 28 11 362 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q2YSI3 7.56e-31 123 28 13 355 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A7GDQ6 8.24e-31 123 27 13 340 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
O82030 9.07e-31 124 29 11 349 2 HPA Histidinol-phosphate aminotransferase, chloroplastic Nicotiana tabacum
Q88UE6 1.1e-30 122 27 10 348 3 hisC Histidinol-phosphate aminotransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9X7B8 1.22e-30 123 28 15 368 3 hisC Histidinol-phosphate aminotransferase Mycobacterium leprae (strain TN)
B8ZRB0 1.22e-30 123 28 15 368 3 hisC Histidinol-phosphate aminotransferase Mycobacterium leprae (strain Br4923)
Q4L4E7 1.22e-30 122 28 11 349 3 hisC Histidinol-phosphate aminotransferase Staphylococcus haemolyticus (strain JCSC1435)
Q9FEW2 1.56e-30 123 29 11 349 1 HPA Histidinol-phosphate aminotransferase, chloroplastic Nicotiana plumbaginifolia
A8MEH2 2.35e-30 122 26 14 364 3 hisC Histidinol-phosphate aminotransferase Alkaliphilus oremlandii (strain OhILAs)
B2IDA4 2.38e-30 122 28 11 354 3 hisC Histidinol-phosphate aminotransferase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
C1FN41 2.64e-30 121 26 12 341 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Kyoto / Type A2)
A1VK38 2.91e-30 121 30 13 368 3 hisC Histidinol-phosphate aminotransferase Polaromonas naphthalenivorans (strain CJ2)
Q12U08 2.93e-30 121 26 12 335 3 hisC Histidinol-phosphate aminotransferase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q03K75 3.85e-30 121 27 11 363 3 hisC Histidinol-phosphate aminotransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
B4U9L1 4.37e-30 120 26 7 304 3 hisC Histidinol-phosphate aminotransferase Hydrogenobaculum sp. (strain Y04AAS1)
B1VP97 4.74e-30 121 29 8 314 3 pat Putative phenylalanine aminotransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
B1ILA9 5.44e-30 120 26 11 339 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Okra / Type B1)
P73807 5.52e-30 120 27 10 354 3 hisC Histidinol-phosphate aminotransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6HHF6 5.62e-30 120 29 8 302 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
B3PCJ2 5.97e-30 120 29 14 352 3 hisC Histidinol-phosphate aminotransferase Cellvibrio japonicus (strain Ueda107)
A1T8W2 6.3e-30 120 30 10 350 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
C0R1Z0 6.6e-30 120 26 14 342 3 hisC Histidinol-phosphate aminotransferase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
B8DC01 6.68e-30 120 28 11 362 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serotype 4a (strain HCC23)
Q4JSJ5 7.19e-30 120 30 9 285 3 pat Putative phenylalanine aminotransferase Corynebacterium jeikeium (strain K411)
Q3SI68 8.02e-30 120 29 9 353 3 hisC2 Histidinol-phosphate aminotransferase 2 Thiobacillus denitrificans (strain ATCC 25259)
Q63A05 8.1e-30 120 29 8 302 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ZK / E33L)
Q81P62 8.18e-30 120 29 8 302 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus anthracis
A1A2H6 8.44e-30 120 30 13 357 3 hisC Histidinol-phosphate aminotransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q8CTG8 9.52e-30 120 29 10 312 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR08 1e-29 120 29 10 312 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B2GBR8 1.1e-29 120 31 8 331 3 hisC Histidinol-phosphate aminotransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q1R089 1.12e-29 120 29 14 355 3 hisC Histidinol-phosphate aminotransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q7W2Y3 1.15e-29 120 32 14 356 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q609W4 1.32e-29 119 29 13 367 3 hisC1 Histidinol-phosphate aminotransferase 1 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A0QHI1 1.42e-29 120 29 13 348 3 hisC Histidinol-phosphate aminotransferase Mycobacterium avium (strain 104)
Q7WDY3 1.44e-29 120 32 16 362 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A8LK96 1.46e-29 119 30 10 325 3 hisC Histidinol-phosphate aminotransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
P61001 1.6e-29 120 29 13 348 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q2LST8 1.8e-29 119 26 8 359 3 hisC Histidinol-phosphate aminotransferase Syntrophus aciditrophicus (strain SB)
A8EWM9 1.82e-29 119 26 10 305 3 hisC Histidinol-phosphate aminotransferase Aliarcobacter butzleri (strain RM4018)
Q71Y90 2.11e-29 119 29 8 305 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serotype 4b (strain F2365)
Q8DTQ4 2.16e-29 119 28 12 353 3 hisC Histidinol-phosphate aminotransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
C1KWM5 2.36e-29 119 29 8 305 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
A5I245 2.38e-29 119 26 11 340 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FU81 2.38e-29 119 26 11 340 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain ATCC 19397 / Type A)
B0JJJ7 2.45e-29 119 31 13 333 3 hisC Histidinol-phosphate aminotransferase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q8XV80 2.59e-29 119 31 11 313 3 hisC1 Histidinol-phosphate aminotransferase 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q89GX0 3.48e-29 118 28 12 357 3 hisC1 Histidinol-phosphate aminotransferase 1 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q92A83 3.95e-29 118 29 9 309 1 hisC Histidinol-phosphate aminotransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q4JW58 4.98e-29 118 28 12 345 3 hisC Histidinol-phosphate aminotransferase Corynebacterium jeikeium (strain K411)
Q81C43 7.24e-29 118 29 8 302 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8EQB9 7.84e-29 117 28 12 356 3 hisC2 Histidinol-phosphate aminotransferase 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A9H311 9.03e-29 117 29 11 354 3 hisC Histidinol-phosphate aminotransferase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q7VSZ0 1.24e-28 117 31 16 362 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q30TC9 1.3e-28 117 27 9 306 3 hisC Histidinol-phosphate aminotransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
B1MFC0 1.92e-28 116 30 9 325 3 pat Putative phenylalanine aminotransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
B6IYQ0 2.58e-28 116 30 8 309 3 hisC Histidinol-phosphate aminotransferase Rhodospirillum centenum (strain ATCC 51521 / SW)
B7JUI4 3.88e-28 115 26 11 362 3 hisC Histidinol-phosphate aminotransferase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q9ZBY8 5.36e-28 115 30 9 314 3 pat Putative phenylalanine aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q20YH9 5.66e-28 115 29 10 335 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisB18)
Q6FEC7 5.7e-28 115 27 14 375 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q4KI72 7.6e-28 115 27 12 357 3 hisC1 Histidinol-phosphate aminotransferase 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q31I36 7.81e-28 115 29 14 357 3 hisC1 Histidinol-phosphate aminotransferase 1 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q2RP86 9.06e-28 115 30 12 314 3 hisC Histidinol-phosphate aminotransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2GAI1 1e-27 115 27 12 352 3 hisC Histidinol-phosphate aminotransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q8G4S8 1.22e-27 115 29 13 356 3 hisC Histidinol-phosphate aminotransferase Bifidobacterium longum (strain NCC 2705)
Q4FQF9 1.5e-27 114 28 10 362 3 hisC2 Histidinol-phosphate aminotransferase 2 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A1TKZ0 1.91e-27 114 29 11 316 3 hisC Histidinol-phosphate aminotransferase Paracidovorax citrulli (strain AAC00-1)
Q8FU28 1.93e-27 113 26 11 356 3 pat Putative phenylalanine aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P61004 1.93e-27 113 26 11 357 3 pat Putative phenylalanine aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q07IG8 1.98e-27 114 29 10 334 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisA53)
A1KV06 2.1e-27 114 30 8 266 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JTH8 2.1e-27 114 30 8 266 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M185 2.1e-27 114 30 8 266 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup C (strain 053442)
Q5P791 2.19e-27 114 28 12 356 3 hisC Histidinol-phosphate aminotransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A4QAL4 2.39e-27 113 30 7 289 3 pat Putative phenylalanine aminotransferase Corynebacterium glutamicum (strain R)
Q82FJ1 2.41e-27 113 28 8 314 3 pat Putative phenylalanine aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
B4RJ05 2.51e-27 113 31 8 280 3 hisC Histidinol-phosphate aminotransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F7D7 2.51e-27 113 31 8 280 3 hisC Histidinol-phosphate aminotransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q4ZNW0 2.58e-27 113 28 13 356 3 hisC Histidinol-phosphate aminotransferase Pseudomonas syringae pv. syringae (strain B728a)
Q4FP52 2.94e-27 113 25 9 317 3 hisC Histidinol-phosphate aminotransferase Pelagibacter ubique (strain HTCC1062)
Q7P0F4 3.05e-27 113 30 10 307 3 hisC Histidinol-phosphate aminotransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
C0ZM44 3.05e-27 113 30 7 290 3 pat Putative phenylalanine aminotransferase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q82WM3 3.65e-27 113 29 11 300 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B5E9W9 4.15e-27 112 28 14 362 3 hisC Histidinol-phosphate aminotransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
P55683 4.86e-27 113 28 11 320 3 hisC Histidinol-phosphate aminotransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q987C8 6.35e-27 112 29 11 372 3 hisC1 Histidinol-phosphate aminotransferase 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B0KQJ6 6.59e-27 112 29 11 340 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain GB-1)
A2SE05 7.08e-27 112 32 11 306 3 hisC Histidinol-phosphate aminotransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q9JYH7 7.09e-27 112 31 8 266 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q1IE97 7.29e-27 112 28 11 343 3 hisC Histidinol-phosphate aminotransferase Pseudomonas entomophila (strain L48)
Q88P86 7.51e-27 112 29 11 340 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
C6E916 7.76e-27 112 27 14 362 3 hisC Histidinol-phosphate aminotransferase Geobacter sp. (strain M21)
B0UN04 8.97e-27 112 29 9 333 3 hisC Histidinol-phosphate aminotransferase Methylobacterium sp. (strain 4-46)
Q0BVW4 9.06e-27 112 31 12 312 3 hisC Histidinol-phosphate aminotransferase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B9MDV4 9.06e-27 112 28 12 360 3 hisC Histidinol-phosphate aminotransferase Acidovorax ebreus (strain TPSY)
B0V7Q2 1.09e-26 112 27 12 354 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain AYE)
B2HTW5 1.09e-26 112 27 12 354 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain ACICU)
Q0AM22 1.11e-26 112 28 9 313 3 hisC Histidinol-phosphate aminotransferase Maricaulis maris (strain MCS10)
B0VV21 1.65e-26 111 26 11 356 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain SDF)
B7I6C5 1.68e-26 111 26 11 356 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain AB0057)
B7GZI3 1.68e-26 111 26 11 356 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain AB307-0294)
Q87WV6 1.86e-26 111 29 13 342 3 hisC Histidinol-phosphate aminotransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q47KH1 1.94e-26 111 30 9 308 3 pat Putative phenylalanine aminotransferase Thermobifida fusca (strain YX)
B1JBC0 2.06e-26 110 28 11 340 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain W619)
A7ICA9 2.24e-26 111 28 10 335 3 hisC Histidinol-phosphate aminotransferase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q11DR9 2.5e-26 110 27 12 359 3 hisC Histidinol-phosphate aminotransferase Chelativorans sp. (strain BNC1)
Q89UL9 2.59e-26 110 27 10 324 3 hisC2 Histidinol-phosphate aminotransferase 2 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1QQD5 2.67e-26 110 29 12 331 3 hisC Histidinol-phosphate aminotransferase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A5VZ57 2.81e-26 110 28 11 340 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q47QS8 3.75e-26 110 29 12 357 3 hisC Histidinol-phosphate aminotransferase Thermobifida fusca (strain YX)
B9K9R9 4.26e-26 109 27 8 302 3 hisC Histidinol-phosphate aminotransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A5FVN2 5.3e-26 110 29 13 364 3 hisC Histidinol-phosphate aminotransferase Acidiphilium cryptum (strain JF-5)
Q48ED0 6.82e-26 109 28 13 342 3 hisC Histidinol-phosphate aminotransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8NTT4 7.46e-26 109 29 7 289 3 pat Probable phenylalanine aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
C1B997 7.77e-26 109 30 7 291 3 pat Putative phenylalanine aminotransferase Rhodococcus opacus (strain B4)
A3M2I8 8.2e-26 109 27 12 356 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
A7ZCF3 1.31e-25 108 27 8 310 3 hisC Histidinol-phosphate aminotransferase Campylobacter concisus (strain 13826)
A8FKA6 1.43e-25 108 29 10 301 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9PII2 1.78e-25 108 29 10 301 1 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q2YAU6 2.16e-25 108 27 14 368 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2IS68 2.51e-25 108 28 12 334 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain HaA2)
Q98B00 3.3e-25 108 29 13 311 3 hisC3 Histidinol-phosphate aminotransferase 3 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q7M7Y6 3.69e-25 107 26 8 305 3 hisC Histidinol-phosphate aminotransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q3SV41 4.21e-25 107 28 12 348 3 hisC Histidinol-phosphate aminotransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q39YP6 6.56e-25 107 28 13 336 1 hisC Histidinol-phosphate aminotransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A7H084 7.21e-25 107 28 10 308 3 hisC Histidinol-phosphate aminotransferase Campylobacter curvus (strain 525.92)
B3Q8Z5 8.13e-25 107 27 10 322 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain TIE-1)
P61002 8.13e-25 107 27 10 322 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P34037 1.24e-24 106 26 12 359 1 hisC Histidinol-phosphate aminotransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A0R5X8 1.43e-24 106 31 9 299 1 pat Putative phenylalanine aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q5HWF4 1.47e-24 106 29 10 301 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni (strain RM1221)
A0Q9F3 1.62e-24 105 31 10 302 3 pat Putative phenylalanine aminotransferase Mycobacterium avium (strain 104)
B9KDN6 1.67e-24 105 27 10 306 3 hisC Histidinol-phosphate aminotransferase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q92L21 1.77e-24 105 29 12 352 3 hisC2 Histidinol-phosphate aminotransferase 2 Rhizobium meliloti (strain 1021)
P61005 1.91e-24 105 31 10 302 3 pat Putative phenylalanine aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A1VY36 1.92e-24 105 29 10 301 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A7H556 2.42e-24 105 27 9 307 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q5Z3C0 2.51e-24 105 29 7 296 3 pat Putative phenylalanine aminotransferase Nocardia farcinica (strain IFM 10152)
P61000 2.74e-24 105 27 12 333 3 hisC Histidinol-phosphate aminotransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q3KHZ1 2.76e-24 105 26 10 353 3 hisC1 Histidinol-phosphate aminotransferase 1 Pseudomonas fluorescens (strain Pf0-1)
A0RMN9 3.22e-24 105 25 8 309 3 hisC Histidinol-phosphate aminotransferase Campylobacter fetus subsp. fetus (strain 82-40)
Q8U9W3 4.36e-24 104 29 10 333 3 hisC Histidinol-phosphate aminotransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8F6W9 7.2e-24 104 28 9 300 3 hisC Histidinol-phosphate aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PG3 7.2e-24 104 28 9 300 3 hisC Histidinol-phosphate aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q2N7G6 7.2e-24 104 27 12 361 3 hisC Histidinol-phosphate aminotransferase Erythrobacter litoralis (strain HTCC2594)
Q47AL9 9.53e-24 103 27 14 351 3 hisC2 Histidinol-phosphate aminotransferase 2 Dechloromonas aromatica (strain RCB)
Q04Z75 1.28e-23 103 26 8 306 3 hisC Histidinol-phosphate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04QW8 1.28e-23 103 26 8 306 3 hisC Histidinol-phosphate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q92MG0 1.3e-23 103 27 10 334 3 hisC1 Histidinol-phosphate aminotransferase 1 Rhizobium meliloti (strain 1021)
Q6ABX6 1.43e-23 103 32 7 277 3 pat Putative phenylalanine aminotransferase Leifsonia xyli subsp. xyli (strain CTCB07)
Q7UNC3 1.49e-23 103 29 13 342 3 hisC Histidinol-phosphate aminotransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q6A8L4 1.51e-23 103 31 13 332 3 hisC Histidinol-phosphate aminotransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q5FRR4 1.55e-23 103 25 11 342 3 hisC1 Histidinol-phosphate aminotransferase 1 Gluconobacter oxydans (strain 621H)
A1TGS6 1.66e-23 102 30 8 300 3 pat Putative phenylalanine aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
B8GIB0 1.89e-23 102 27 8 304 3 hisC Histidinol-phosphate aminotransferase Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01105
Feature type CDS
Gene hisC
Product histidinol-phosphate transaminase
Location 233335 - 234411 (strand: -1)
Length 1077 (nucleotides) / 358 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_263
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0079 Amino acid transport and metabolism (E) E Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase

Kegg Ortholog Annotation(s)

Protein Sequence

MNKPFSAMDMARENVQLLTPYMSARRLGGNGDVWLNANEYPQAPDFAFTDRNLNRYPECQPADVINRYAAYAGVNPDQVIAGRGADESIELLIRAFCEPGQDAVMYCPPTYGMYSVSAETFGIPQKIVPTLDGWQLDLDSIAANLHGVKLLYVCHPNNPTGNPVREQDLRYLFEIVNNRALIVIDEAYIEFCPQFSVASWLKEYPNLVILRTLSKAFALAGLRCGFTLSSPEIINVLMKVIAPYPLSSPVAAIAAQALLPEGIEVMRERVAENCRNRQMLCDELSKLPLTETIFPSETNYILVRFRESERVFRSLWNDGIILRDQRRQRGLDDCLRITIGTRAECLRVIAAIATLKMP

Flanking regions ( +/- flanking 50bp)

AATGCCGTGACACTGCGCATGAACGCCCTGCGCTCTGAGGAGAAAAAATAATGAACAAACCATTCAGTGCAATGGATATGGCCCGCGAAAATGTGCAATTACTGACCCCGTACATGTCGGCGCGCCGTCTGGGCGGCAACGGGGATGTCTGGCTGAACGCCAACGAATACCCGCAGGCACCCGATTTCGCCTTTACCGATCGCAACCTGAACCGCTATCCGGAGTGTCAGCCCGCCGATGTCATTAACCGCTATGCCGCTTATGCGGGGGTTAATCCTGATCAGGTGATAGCCGGGCGCGGTGCCGATGAAAGTATTGAACTGCTGATCCGTGCCTTTTGTGAGCCGGGACAGGATGCCGTGATGTACTGCCCGCCGACCTACGGCATGTACAGCGTCAGCGCAGAAACCTTTGGTATTCCTCAGAAAATCGTCCCGACGCTGGATGGCTGGCAGTTGGATTTAGACAGCATCGCTGCCAATCTACACGGCGTAAAACTGCTGTATGTCTGTCACCCGAACAACCCGACCGGTAATCCTGTCCGCGAACAGGATCTGCGCTATCTGTTTGAAATCGTGAATAACCGGGCGCTGATTGTTATTGATGAAGCCTATATTGAGTTCTGCCCGCAGTTCAGTGTCGCGTCATGGCTGAAAGAGTATCCGAACCTGGTTATTCTGCGCACACTCTCCAAAGCCTTTGCACTGGCGGGGTTGCGCTGTGGTTTTACCCTCTCATCGCCGGAGATTATTAATGTGCTGATGAAAGTGATCGCACCTTATCCGCTCTCCTCGCCGGTTGCCGCGATTGCAGCGCAGGCACTGCTGCCGGAAGGTATTGAGGTGATGCGTGAGCGGGTGGCAGAAAACTGCCGCAACCGGCAGATGCTGTGCGACGAGCTGAGTAAACTGCCGCTGACAGAAACCATTTTCCCGAGTGAAACCAACTATATCCTCGTGCGGTTCCGGGAGTCTGAGCGGGTGTTCCGCAGCCTGTGGAATGACGGGATCATTTTGCGCGACCAGCGCAGACAACGCGGACTGGATGACTGCCTGCGTATTACCATCGGTACCCGTGCAGAATGTCTGCGGGTAATTGCCGCTATCGCCACCCTTAAAATGCCTTAATCTGAGGACGACGGATATCATGACACAGAAAGTCTTATTTATTGACCGCG