Homologs in group_35

Help

12 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17200 FBDBKF_17200 39.9 Morganella morganii S1 araC AraC-type DNA-binding domain and AraC-containing proteins
EHELCC_01690 EHELCC_01690 39.9 Morganella morganii S2 araC AraC-type DNA-binding domain and AraC-containing proteins
EHELCC_18210 EHELCC_18210 100.0 Morganella morganii S2 araC AraC-type DNA-binding domain and AraC-containing proteins
NLDBIP_01770 NLDBIP_01770 39.9 Morganella morganii S4 araC AraC-type DNA-binding domain and AraC-containing proteins
NLDBIP_18135 NLDBIP_18135 100.0 Morganella morganii S4 araC AraC-type DNA-binding domain and AraC-containing proteins
LHKJJB_00265 LHKJJB_00265 39.9 Morganella morganii S3 araC AraC-type DNA-binding domain and AraC-containing proteins
LHKJJB_18330 LHKJJB_18330 100.0 Morganella morganii S3 araC AraC-type DNA-binding domain and AraC-containing proteins
HKOGLL_00305 HKOGLL_00305 39.9 Morganella morganii S5 araC AraC-type DNA-binding domain and AraC-containing proteins
HKOGLL_18065 HKOGLL_18065 100.0 Morganella morganii S5 araC AraC-type DNA-binding domain and AraC-containing proteins
F4V73_RS01695 F4V73_RS01695 62.2 Morganella psychrotolerans - helix-turn-helix domain-containing protein
F4V73_RS05955 F4V73_RS05955 38.0 Morganella psychrotolerans - AraC family transcriptional regulator
PMI_RS03950 PMI_RS03950 50.0 Proteus mirabilis HI4320 - AraC family transcriptional regulator

Distribution of the homologs in the orthogroup group_35

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_35

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZJU7 1.26e-55 184 40 6 272 2 rob Transcriptional regulator Rob Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0ACI2 3.65e-55 183 40 7 281 3 rob Right origin-binding protein Shigella flexneri
P0ACI0 3.65e-55 183 40 7 281 1 rob Right origin-binding protein Escherichia coli (strain K12)
P0ACI1 3.65e-55 183 40 7 281 3 rob Right origin-binding protein Escherichia coli O157:H7
P28816 1.72e-35 127 53 0 106 1 tetD Transposon Tn10 TetD protein Escherichia coli
Q48413 5.28e-30 112 52 0 103 1 ramA Transcriptional activator RamA Klebsiella pneumoniae
A0A0H3GPK2 5.28e-30 112 52 0 103 1 ramA Transcriptional regulator RamA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P43463 2.01e-29 112 49 0 103 4 aarP HTH-type transcriptional activator AarP Providencia stuartii
H9L484 4.76e-29 110 49 0 105 1 ramA Transcriptional regulator RamA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0ACH7 8.92e-29 110 43 1 125 3 marA Multiple antibiotic resistance protein MarA Shigella flexneri
P0ACH5 8.92e-29 110 43 1 125 1 marA Multiple antibiotic resistance protein MarA Escherichia coli (strain K12)
P0ACH6 8.92e-29 110 43 1 125 3 marA Multiple antibiotic resistance protein MarA Escherichia coli O157:H7
P0A2S4 2.63e-28 108 43 0 116 2 marA Multiple antibiotic resistance protein MarA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2S5 2.63e-28 108 43 0 116 3 marA Multiple antibiotic resistance protein MarA Salmonella typhi
P0A2S6 2.63e-28 108 43 0 116 3 marA Multiple antibiotic resistance protein MarA Salmonella enteritidis
Q52620 3.14e-27 105 44 2 114 4 pqrA Probable transcription factor PqrA Proteus vulgaris
P0A9E2 3.25e-27 105 47 0 102 1 soxS Regulatory protein SoxS Escherichia coli (strain K12)
P0A9E3 3.25e-27 105 47 0 102 3 soxS Regulatory protein SoxS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9E4 3.25e-27 105 47 0 102 3 soxS Regulatory protein SoxS Escherichia coli O157:H7
Q56143 5.23e-27 104 46 0 102 3 soxS Regulatory protein SoxS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55922 5.03e-26 102 46 0 103 4 ramA Transcriptional activator RamA Enterobacter cloacae
P77601 1.48e-24 102 45 0 111 5 ykgA Putative HTH-type transcriptional regulator YkgA Escherichia coli (strain K12)
P26950 2.8e-17 83 45 1 113 4 caf1R F1 operon positive regulatory protein Yersinia pestis
O31456 2.72e-12 69 39 0 98 3 ybfP Uncharacterized HTH-type transcriptional regulator YbfP Bacillus subtilis (strain 168)
P96662 4.99e-12 68 35 0 92 4 ydeE Uncharacterized HTH-type transcriptional regulator YdeE Bacillus subtilis (strain 168)
P45008 1.35e-09 61 28 0 105 4 HI_1052 Uncharacterized HTH-type transcriptional regulator HI_1052 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O32071 1.5e-08 59 30 0 107 4 ytdP Uncharacterized HTH-type transcriptional regulator YtdP Bacillus subtilis (strain 168)
Q9WW32 2.04e-08 58 30 1 105 1 mtrA HTH-type transcriptional regulator MtrA Neisseria gonorrhoeae
Q6GD21 7.81e-08 57 31 0 103 4 SAS0078 Uncharacterized HTH-type transcriptional regulator SAS0078 Staphylococcus aureus (strain MSSA476)
Q8NYT6 7.81e-08 57 31 0 103 4 MW0077 Uncharacterized HTH-type transcriptional regulator MW0077 Staphylococcus aureus (strain MW2)
Q99XB1 8.17e-08 57 31 0 103 4 SAV0101 Uncharacterized HTH-type transcriptional regulator SAV0101 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A882 8.17e-08 57 31 0 103 4 SA0097 Uncharacterized HTH-type transcriptional regulator SA0097 Staphylococcus aureus (strain N315)
Q5HJR8 8.7e-08 57 31 0 103 4 SACOL0084 Uncharacterized HTH-type transcriptional regulator SACOL0084 Staphylococcus aureus (strain COL)
Q6GKK1 9.43e-08 57 31 0 103 4 SAR0107 Uncharacterized HTH-type transcriptional regulator SAR0107 Staphylococcus aureus (strain MRSA252)
Q8ZM00 1.17e-07 55 29 1 97 1 STM3175 Probable HTH-type transcriptional regulator STM3175 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q936F1 2.08e-07 55 31 0 103 4 None Uncharacterized HTH-type transcriptional regulator Staphylococcus aureus
Q05587 3.26e-07 54 27 0 99 1 pocR Regulatory protein PocR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q47129 5.3e-07 53 34 3 103 1 feaR Transcriptional activator FeaR Escherichia coli (strain K12)
O87389 6.79e-07 53 35 0 95 4 glxA HTH-type transcriptional regulator GlxA Rhizobium meliloti (strain 1021)
P43461 8.52e-07 51 26 1 104 4 None Uncharacterized HTH-type transcriptional regulator in cgkA 5'region (Fragment) Pseudoalteromonas carrageenovora
A7ZUB7 1.09e-06 52 28 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O139:H28 (strain E24377A / ETEC)
P77396 1.26e-06 52 27 1 105 4 ypdC Uncharacterized HTH-type transcriptional regulator YpdC Escherichia coli (strain K12)
Q04713 2.49e-06 52 30 2 108 4 xylS1 XylDLEGF operon transcriptional activator 1 Pseudomonas putida
B6I4P8 2.94e-06 51 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SE11)
G3XCU2 3.1e-06 51 33 0 96 4 argR HTH-type transcriptional regulator ArgR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q05092 3.34e-06 49 30 1 97 4 xylS2 XylDLEGF operon transcriptional activator 2 Pseudomonas putida
Q32A70 3.44e-06 51 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Shigella dysenteriae serotype 1 (strain Sd197)
P07642 3.55e-06 51 29 0 95 3 araC Arabinose operon regulatory protein Dickeya chrysanthemi
Q31U84 3.67e-06 51 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 4 (strain Sb227)
P09377 3.67e-06 51 27 0 102 1 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12)
B1IVH3 3.67e-06 51 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A709 3.67e-06 51 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O9:H4 (strain HS)
B1XB72 3.67e-06 51 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / DH10B)
C5A073 3.67e-06 51 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / MC4100 / BW2952)
B7M6V7 3.67e-06 51 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O8 (strain IAI1)
B7L9G1 3.67e-06 51 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain 55989 / EAEC)
B1Q2A8 3.68e-06 51 36 2 94 1 nphR Transcriptional activator NphR Rhodococcus sp.
B7N2P7 3.73e-06 51 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O81 (strain ED1a)
Q8CXW5 3.8e-06 51 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3YV71 3.87e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Shigella sonnei (strain Ss046)
B1LMU6 3.87e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SMS-3-5 / SECEC)
Q83PE0 3.91e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri
Q0SZ95 3.91e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri serotype 5b (strain 8401)
Q0TAF8 4.06e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UNM6 4.06e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A4WG91 4.41e-06 50 28 0 99 3 rhaS HTH-type transcriptional activator RhaS Enterobacter sp. (strain 638)
Q1R414 5.49e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain UTI89 / UPEC)
B7NFK3 5.49e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A1AI82 5.49e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O1:K1 / APEC
B7NUA1 5.49e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MI37 5.49e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O45:K1 (strain S88 / ExPEC)
Q65Q30 6.18e-06 50 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1R413 6.19e-06 50 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain UTI89 / UPEC)
A1AI83 6.19e-06 50 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O1:K1 / APEC
Q05335 6.45e-06 50 30 2 108 4 xylS3 XylDLEGF operon transcriptional activator 3 Pseudomonas putida
P09378 6.54e-06 50 29 0 100 1 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain K12)
A8A710 6.54e-06 50 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O9:H4 (strain HS)
C5A074 6.54e-06 50 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain K12 / MC4100 / BW2952)
Q83PD9 6.85e-06 50 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Shigella flexneri
Q0SZ96 6.85e-06 50 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Shigella flexneri serotype 5b (strain 8401)
Q32A71 6.91e-06 50 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Shigella dysenteriae serotype 1 (strain Sd197)
Q8X7B3 6.98e-06 50 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O157:H7
B2TVP7 7.78e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YZ43 7.78e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X897 7.78e-06 50 27 0 102 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7
Q31U83 8.15e-06 50 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Shigella boydii serotype 4 (strain Sb227)
Q8FBD7 8.15e-06 50 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAF7 8.15e-06 50 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7ZUB8 8.15e-06 50 29 0 100 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O139:H28 (strain E24377A / ETEC)
B4TPQ9 8.22e-06 50 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella schwarzengrund (strain CVM19633)
A9MI64 1.32e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5BJG8 1.41e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain AKU_12601)
Q5PKG2 1.41e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P0A2S9 1.46e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2T0 1.46e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhi
C0Q3L4 1.46e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi C (strain RKS4594)
A9MZC8 1.46e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZZ3 1.46e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella newport (strain SL254)
B5RFC3 1.46e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QWY4 1.46e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella enteritidis PT4 (strain P125109)
B4TBY3 1.48e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella heidelberg (strain SL476)
B5F0M9 1.49e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella agona (strain SL483)
B5FPP5 1.6e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella dublin (strain CT_02021853)
Q57HG8 1.62e-05 49 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella choleraesuis (strain SC-B67)
P19219 1.88e-05 48 28 0 96 1 adaA Bifunctional transcriptional activator/DNA repair enzyme AdaA Bacillus subtilis (strain 168)
P54722 2.18e-05 48 28 1 101 4 yfiF Uncharacterized HTH-type transcriptional regulator YfiF Bacillus subtilis (strain 168)
C6DJR5 2.65e-05 48 35 0 74 3 rhaR HTH-type transcriptional activator RhaR Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5FPP6 2.72e-05 48 27 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella dublin (strain CT_02021853)
Q6DA21 3.78e-05 48 33 0 74 3 rhaR HTH-type transcriptional activator RhaR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q04710 4.15e-05 48 31 1 97 4 xylS1 XylDLEGF operon transcriptional activator 1 Pseudomonas putida
B7LVD8 4.26e-05 47 28 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q9HTI4 4.68e-05 48 26 1 130 1 gbdR HTH-type transcriptional regulator GbdR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZIC3 4.68e-05 48 26 1 130 1 gbdR HTH-type transcriptional regulator GbdR Pseudomonas aeruginosa (strain UCBPP-PA14)
P07859 4.76e-05 47 31 1 97 4 xylS XylDLEGF operon transcriptional activator Pseudomonas putida
B5XZ49 5.86e-05 47 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae (strain 342)
Q65Q31 6.59e-05 47 24 0 97 3 rhaS HTH-type transcriptional activator RhaS Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q00753 6.84e-05 47 31 0 87 4 msmR Msm operon regulatory protein Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P0ACI3 6.96e-05 47 32 1 100 1 xylR Xylose operon regulatory protein Escherichia coli (strain K12)
P0ACI4 6.96e-05 47 32 1 100 3 xylR Xylose operon regulatory protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACI5 6.96e-05 47 32 1 100 3 xylR Xylose operon regulatory protein Escherichia coli O157:H7
A6TGA9 7.22e-05 47 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
O31449 8.63e-05 47 26 1 99 4 ybfI Uncharacterized HTH-type transcriptional regulator YbfI Bacillus subtilis (strain 168)
B5F0N0 0.000104 46 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella agona (strain SL483)
A9MI63 0.000105 46 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P40865 0.000106 46 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BJG9 0.000106 46 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi A (strain AKU_12601)
A9MZC9 0.000106 46 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKG1 0.000106 46 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SZZ4 0.000106 46 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella newport (strain SL254)
B5QWY5 0.000106 46 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella enteritidis PT4 (strain P125109)
A8AL27 0.000119 46 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B4TPR0 0.000145 46 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella schwarzengrund (strain CVM19633)
Q57HG7 0.000155 46 25 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella choleraesuis (strain SC-B67)
Q8Z2V5 0.000162 46 25 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella typhi
B4TBY4 0.000162 46 25 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella heidelberg (strain SL476)
P95283 0.000229 45 29 0 79 2 Rv1931c HTH-type transcriptional regulator Rv1931c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9HTH5 0.000287 45 29 0 91 1 cdhR HTH-type transcriptional regulator CdhR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O31517 0.000326 45 35 2 79 3 yesN Uncharacterized transcriptional regulatory protein YesN Bacillus subtilis (strain 168)
Q66FF1 0.000385 45 33 0 69 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FN79 0.000385 45 33 0 69 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JNC4 0.000399 45 33 0 69 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TRS7 0.000399 45 33 0 69 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis (strain Pestoides F)
Q1CEB6 0.000399 45 33 0 69 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYR6 0.000399 45 33 0 69 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIZ9 0.000399 45 33 0 69 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis
B2K1W6 0.000399 45 33 0 69 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C0W2 0.000399 45 33 0 69 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis bv. Antiqua (strain Antiqua)
P17410 0.000573 44 26 1 109 1 chbR HTH-type transcriptional regulator ChbR Escherichia coli (strain K12)
O33813 0.000836 43 27 0 98 4 lacR Lactose operon transcription activator Staphylococcus xylosus
P40408 0.000881 44 24 2 133 1 btr HTH-type transcriptional activator Btr Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_18175
Feature type CDS
Gene araC
Product AraC-type DNA-binding domain and AraC-containing proteins
Location 654 - 1568 (strand: -1)
Length 915 (nucleotides) / 304 (amino acids)
In genomic island -

Contig

Accession contig_33
Length 35117 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_35
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF12833 Helix-turn-helix domain
PF14526 Integron-associated effector binding protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4977 Transcription (K) K Transcriptional regulator GlxA, contains an amidase domain and an AraC-type DNA-binding HTH domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05804 AraC family transcriptional regulator, mar-sox-rob regulon activator - -

Protein Sequence

MNIDGLRGSIIQSLVLWIEQNLESDLSLDIIAARAGYSKWHLQRLFKEHTGVVIGKYIRARRLSCAAKALRITRSSILDISVKYRFDSQQTFCRAFKSQFNTTPSAYRKKAGWDSNGFCFPLQAENLIPFQSELTELPEMLLAGSHHYHRKHLSDWQTENRKFRREFWEKFFKEVDIIPADLYAIHAPYESTADDISYAYTTAVIPSVLSADSIRRASLSPVTLPGGHYLRITIDPAMLKNLPADYNNIIHAAYSGTLAEMNLLRRRGPDIEHYKLLPAERHDEFIANGLQYVEEINYYIPVMR

Flanking regions ( +/- flanking 50bp)

TGTATCGCACGATAACTGAGCGATAACACTCTTTACCGGTAATAAAAAGAATGAACATAGACGGGCTTCGCGGAAGTATTATTCAGAGTCTGGTGTTGTGGATTGAGCAAAATCTGGAATCTGATTTATCACTGGATATCATTGCCGCACGGGCGGGTTATTCCAAATGGCATTTACAGCGCTTATTTAAAGAGCACACCGGTGTCGTGATCGGAAAATATATCCGTGCCCGACGCTTATCCTGTGCAGCAAAGGCATTGCGGATCACCCGCAGCAGTATTCTCGATATTTCGGTGAAATACCGCTTCGATTCACAGCAGACATTTTGCCGCGCCTTTAAATCCCAGTTTAATACCACCCCTTCCGCCTACCGCAAGAAAGCAGGCTGGGACAGTAACGGCTTCTGTTTTCCGTTACAGGCGGAAAACCTGATTCCGTTTCAGTCTGAACTGACCGAATTACCGGAAATGCTGTTAGCGGGCTCTCATCATTATCACCGGAAACATCTGTCTGACTGGCAGACTGAAAACCGGAAATTCCGGCGTGAATTTTGGGAGAAGTTTTTTAAGGAAGTGGATATTATTCCGGCGGATTTGTATGCCATACATGCCCCGTATGAATCAACCGCAGATGACATCAGTTATGCCTATACCACGGCGGTCATTCCGTCCGTATTATCAGCGGACAGCATCCGCCGCGCATCACTTTCTCCGGTGACCTTACCGGGCGGGCATTATCTCAGAATTACCATTGATCCGGCCATGCTGAAAAATCTGCCCGCTGATTACAACAATATTATTCATGCTGCCTATTCCGGCACGCTGGCAGAAATGAACCTGCTGCGCAGACGGGGCCCGGATATTGAACACTATAAACTGCTGCCCGCAGAGCGGCATGATGAGTTCATTGCCAACGGCTTACAGTATGTGGAAGAGATTAATTACTACATCCCGGTCATGCGATAACAACGCATTATGTACGGCTTGTGTGAAGACAGAAGCCGGCTGCGGCCCGG