Homologs in group_35

Help

12 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17200 FBDBKF_17200 39.9 Morganella morganii S1 araC AraC-type DNA-binding domain and AraC-containing proteins
FBDBKF_18175 FBDBKF_18175 62.2 Morganella morganii S1 araC AraC-type DNA-binding domain and AraC-containing proteins
EHELCC_01690 EHELCC_01690 39.9 Morganella morganii S2 araC AraC-type DNA-binding domain and AraC-containing proteins
EHELCC_18210 EHELCC_18210 62.2 Morganella morganii S2 araC AraC-type DNA-binding domain and AraC-containing proteins
NLDBIP_01770 NLDBIP_01770 39.9 Morganella morganii S4 araC AraC-type DNA-binding domain and AraC-containing proteins
NLDBIP_18135 NLDBIP_18135 62.2 Morganella morganii S4 araC AraC-type DNA-binding domain and AraC-containing proteins
LHKJJB_00265 LHKJJB_00265 39.9 Morganella morganii S3 araC AraC-type DNA-binding domain and AraC-containing proteins
LHKJJB_18330 LHKJJB_18330 62.2 Morganella morganii S3 araC AraC-type DNA-binding domain and AraC-containing proteins
HKOGLL_00305 HKOGLL_00305 39.9 Morganella morganii S5 araC AraC-type DNA-binding domain and AraC-containing proteins
HKOGLL_18065 HKOGLL_18065 62.2 Morganella morganii S5 araC AraC-type DNA-binding domain and AraC-containing proteins
F4V73_RS05955 F4V73_RS05955 39.3 Morganella psychrotolerans - AraC family transcriptional regulator
PMI_RS03950 PMI_RS03950 48.3 Proteus mirabilis HI4320 - AraC family transcriptional regulator

Distribution of the homologs in the orthogroup group_35

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_35

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ACI2 4.24e-57 188 38 6 297 3 rob Right origin-binding protein Shigella flexneri
P0ACI0 4.24e-57 188 38 6 297 1 rob Right origin-binding protein Escherichia coli (strain K12)
P0ACI1 4.24e-57 188 38 6 297 3 rob Right origin-binding protein Escherichia coli O157:H7
Q8ZJU7 9.1e-57 187 38 7 299 2 rob Transcriptional regulator Rob Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P28816 4.77e-34 124 53 0 105 1 tetD Transposon Tn10 TetD protein Escherichia coli
P0ACH7 1.76e-30 114 48 1 121 3 marA Multiple antibiotic resistance protein MarA Shigella flexneri
P0ACH5 1.76e-30 114 48 1 121 1 marA Multiple antibiotic resistance protein MarA Escherichia coli (strain K12)
P0ACH6 1.76e-30 114 48 1 121 3 marA Multiple antibiotic resistance protein MarA Escherichia coli O157:H7
P43463 4.86e-30 113 50 0 102 4 aarP HTH-type transcriptional activator AarP Providencia stuartii
P0A2S4 8.11e-30 112 49 0 112 2 marA Multiple antibiotic resistance protein MarA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2S5 8.11e-30 112 49 0 112 3 marA Multiple antibiotic resistance protein MarA Salmonella typhi
P0A2S6 8.11e-30 112 49 0 112 3 marA Multiple antibiotic resistance protein MarA Salmonella enteritidis
P0A9E2 5.32e-28 107 49 0 104 1 soxS Regulatory protein SoxS Escherichia coli (strain K12)
P0A9E3 5.32e-28 107 49 0 104 3 soxS Regulatory protein SoxS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9E4 5.32e-28 107 49 0 104 3 soxS Regulatory protein SoxS Escherichia coli O157:H7
Q56143 6.64e-28 107 48 0 104 3 soxS Regulatory protein SoxS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q48413 1.09e-27 107 49 0 105 1 ramA Transcriptional activator RamA Klebsiella pneumoniae
A0A0H3GPK2 1.09e-27 107 49 0 105 1 ramA Transcriptional regulator RamA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
H9L484 1.62e-27 106 47 0 105 1 ramA Transcriptional regulator RamA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q52620 3.64e-26 103 45 1 104 4 pqrA Probable transcription factor PqrA Proteus vulgaris
P77601 2.02e-25 104 34 3 193 5 ykgA Putative HTH-type transcriptional regulator YkgA Escherichia coli (strain K12)
P55922 1.81e-24 98 44 0 106 4 ramA Transcriptional activator RamA Enterobacter cloacae
P26950 1.29e-16 82 31 9 276 4 caf1R F1 operon positive regulatory protein Yersinia pestis
P96662 4.61e-14 74 35 1 103 4 ydeE Uncharacterized HTH-type transcriptional regulator YdeE Bacillus subtilis (strain 168)
O31456 1.32e-11 67 38 0 101 3 ybfP Uncharacterized HTH-type transcriptional regulator YbfP Bacillus subtilis (strain 168)
P45008 1.42e-10 64 28 0 106 4 HI_1052 Uncharacterized HTH-type transcriptional regulator HI_1052 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O32071 9.28e-10 63 33 0 103 4 ytdP Uncharacterized HTH-type transcriptional regulator YtdP Bacillus subtilis (strain 168)
Q99XB1 7.4e-08 57 31 0 103 4 SAV0101 Uncharacterized HTH-type transcriptional regulator SAV0101 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A882 7.4e-08 57 31 0 103 4 SA0097 Uncharacterized HTH-type transcriptional regulator SA0097 Staphylococcus aureus (strain N315)
Q6GD21 7.53e-08 57 31 0 103 4 SAS0078 Uncharacterized HTH-type transcriptional regulator SAS0078 Staphylococcus aureus (strain MSSA476)
Q8NYT6 7.53e-08 57 31 0 103 4 MW0077 Uncharacterized HTH-type transcriptional regulator MW0077 Staphylococcus aureus (strain MW2)
Q05587 7.77e-08 56 26 0 105 1 pocR Regulatory protein PocR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6GKK1 7.95e-08 57 31 0 103 4 SAR0107 Uncharacterized HTH-type transcriptional regulator SAR0107 Staphylococcus aureus (strain MRSA252)
Q5HJR8 9.1e-08 57 31 0 103 4 SACOL0084 Uncharacterized HTH-type transcriptional regulator SACOL0084 Staphylococcus aureus (strain COL)
Q936F1 1.66e-07 56 31 0 103 4 None Uncharacterized HTH-type transcriptional regulator Staphylococcus aureus
Q8ZM00 2.25e-07 54 30 1 97 1 STM3175 Probable HTH-type transcriptional regulator STM3175 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9WW32 2.48e-07 54 31 0 90 1 mtrA HTH-type transcriptional regulator MtrA Neisseria gonorrhoeae
Q47129 3.61e-07 54 33 3 109 1 feaR Transcriptional activator FeaR Escherichia coli (strain K12)
Q65Q31 4.95e-07 53 28 0 101 3 rhaS HTH-type transcriptional activator RhaS Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q04713 1.03e-06 53 31 2 105 4 xylS1 XylDLEGF operon transcriptional activator 1 Pseudomonas putida
A4WG91 1.24e-06 52 29 0 99 3 rhaS HTH-type transcriptional activator RhaS Enterobacter sp. (strain 638)
A7ZUB7 2.76e-06 51 29 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O139:H28 (strain E24377A / ETEC)
P77396 2.81e-06 51 28 0 99 4 ypdC Uncharacterized HTH-type transcriptional regulator YpdC Escherichia coli (strain K12)
Q05335 3.04e-06 51 31 2 105 4 xylS3 XylDLEGF operon transcriptional activator 3 Pseudomonas putida
B4TPQ9 3.25e-06 51 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella schwarzengrund (strain CVM19633)
B6I4P8 4.02e-06 50 29 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SE11)
B5FPP6 5.11e-06 50 28 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella dublin (strain CT_02021853)
P19219 5.45e-06 50 31 0 93 1 adaA Bifunctional transcriptional activator/DNA repair enzyme AdaA Bacillus subtilis (strain 168)
O31449 6.61e-06 50 27 1 101 4 ybfI Uncharacterized HTH-type transcriptional regulator YbfI Bacillus subtilis (strain 168)
B5BJG8 6.78e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain AKU_12601)
Q5PKG2 6.78e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A9MI64 6.78e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P0A2S9 7.43e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2T0 7.43e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhi
C0Q3L4 7.43e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi C (strain RKS4594)
A9MZC8 7.43e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZZ3 7.43e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella newport (strain SL254)
B5RFC3 7.43e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QWY4 7.43e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella enteritidis PT4 (strain P125109)
B5F0M9 7.57e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella agona (strain SL483)
B5FPP5 7.64e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella dublin (strain CT_02021853)
B4TBY3 7.71e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella heidelberg (strain SL476)
Q9HTH5 7.77e-06 50 31 0 88 1 cdhR HTH-type transcriptional regulator CdhR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q57HG8 7.85e-06 50 27 0 99 3 rhaS HTH-type transcriptional activator RhaS Salmonella choleraesuis (strain SC-B67)
Q05092 1.05e-05 48 32 2 95 4 xylS2 XylDLEGF operon transcriptional activator 2 Pseudomonas putida
B1LMU6 1.21e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SMS-3-5 / SECEC)
Q32A70 1.23e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Shigella dysenteriae serotype 1 (strain Sd197)
Q0TAF8 1.25e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UNM6 1.25e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q31U84 1.26e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 4 (strain Sb227)
P09377 1.26e-05 49 28 0 96 1 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12)
B1IVH3 1.26e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A709 1.26e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O9:H4 (strain HS)
B1XB72 1.26e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / DH10B)
C5A073 1.26e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / MC4100 / BW2952)
B7M6V7 1.26e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O8 (strain IAI1)
B7L9G1 1.26e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain 55989 / EAEC)
Q8CXW5 1.27e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
G3XCU2 1.28e-05 49 33 0 90 4 argR HTH-type transcriptional regulator ArgR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q83PE0 1.32e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri
Q0SZ95 1.32e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri serotype 5b (strain 8401)
B7N2P7 1.32e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O81 (strain ED1a)
Q3YV71 1.44e-05 49 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Shigella sonnei (strain Ss046)
Q1R414 1.82e-05 48 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain UTI89 / UPEC)
B7NFK3 1.82e-05 48 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A1AI82 1.82e-05 48 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O1:K1 / APEC
B7NUA1 1.82e-05 48 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MI37 1.82e-05 48 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O45:K1 (strain S88 / ExPEC)
O87389 1.87e-05 49 34 0 95 4 glxA HTH-type transcriptional regulator GlxA Rhizobium meliloti (strain 1021)
P40865 1.96e-05 48 27 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BJG9 1.96e-05 48 27 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi A (strain AKU_12601)
A9MZC9 1.96e-05 48 27 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKG1 1.96e-05 48 27 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SZZ4 1.96e-05 48 27 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella newport (strain SL254)
B5QWY5 1.96e-05 48 27 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella enteritidis PT4 (strain P125109)
A9MI63 2.11e-05 48 27 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F0N0 2.17e-05 48 27 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella agona (strain SL483)
B7LVD8 2.21e-05 48 28 0 99 3 rhaS HTH-type transcriptional activator RhaS Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B4TPR0 2.65e-05 48 27 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella schwarzengrund (strain CVM19633)
Q8Z2V5 2.7e-05 48 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella typhi
B4TBY4 2.7e-05 48 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella heidelberg (strain SL476)
B2TVP7 2.77e-05 48 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YZ43 2.77e-05 48 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X897 2.77e-05 48 28 0 96 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7
Q57HG7 2.85e-05 48 26 0 102 3 rhaR HTH-type transcriptional activator RhaR Salmonella choleraesuis (strain SC-B67)
P07642 3.26e-05 48 30 0 93 3 araC Arabinose operon regulatory protein Dickeya chrysanthemi
P54722 4.41e-05 48 30 1 99 4 yfiF Uncharacterized HTH-type transcriptional regulator YfiF Bacillus subtilis (strain 168)
P43461 6.54e-05 46 25 1 100 4 None Uncharacterized HTH-type transcriptional regulator in cgkA 5'region (Fragment) Pseudoalteromonas carrageenovora
Q65Q30 6.97e-05 47 25 0 100 3 rhaR HTH-type transcriptional activator RhaR Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P95283 8.44e-05 47 30 0 79 2 Rv1931c HTH-type transcriptional regulator Rv1931c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P17410 9.4e-05 47 26 1 112 1 chbR HTH-type transcriptional regulator ChbR Escherichia coli (strain K12)
B1Q2A8 0.000114 47 33 3 104 1 nphR Transcriptional activator NphR Rhodococcus sp.
Q04710 0.000124 46 31 1 95 4 xylS1 XylDLEGF operon transcriptional activator 1 Pseudomonas putida
P07859 0.000138 46 31 1 95 4 xylS XylDLEGF operon transcriptional activator Pseudomonas putida
A8AL27 0.000147 46 25 0 99 3 rhaS HTH-type transcriptional activator RhaS Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5XZ49 0.00021 45 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae (strain 342)
Q1R413 0.00027 45 27 0 101 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain UTI89 / UPEC)
A1AI83 0.00027 45 27 0 101 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O1:K1 / APEC
Q32A71 0.000272 45 27 0 101 3 rhaR HTH-type transcriptional activator RhaR Shigella dysenteriae serotype 1 (strain Sd197)
P09378 0.000277 45 27 0 101 1 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain K12)
A8A710 0.000277 45 27 0 101 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O9:H4 (strain HS)
C5A074 0.000277 45 27 0 101 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain K12 / MC4100 / BW2952)
Q8X7B3 0.000285 45 27 0 101 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O157:H7
Q83PD9 0.000298 45 27 0 101 3 rhaR HTH-type transcriptional activator RhaR Shigella flexneri
Q0SZ96 0.000298 45 27 0 101 3 rhaR HTH-type transcriptional activator RhaR Shigella flexneri serotype 5b (strain 8401)
O33813 0.000311 45 27 1 108 4 lacR Lactose operon transcription activator Staphylococcus xylosus
Q31U83 0.000323 45 27 0 101 3 rhaR HTH-type transcriptional activator RhaR Shigella boydii serotype 4 (strain Sb227)
Q8FBD7 0.000323 45 27 0 101 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAF7 0.000323 45 27 0 101 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7ZUB8 0.000323 45 27 0 101 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O139:H28 (strain E24377A / ETEC)
A6TGA9 0.000345 45 26 0 99 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P40408 0.000418 45 23 5 192 1 btr HTH-type transcriptional activator Btr Bacillus subtilis (strain 168)
C6DJR5 0.000503 44 26 0 94 3 rhaR HTH-type transcriptional activator RhaR Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6DA21 0.000717 44 25 0 94 3 rhaR HTH-type transcriptional activator RhaR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q00753 0.000803 43 29 0 88 4 msmR Msm operon regulatory protein Streptococcus mutans serotype c (strain ATCC 700610 / UA159)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01695
Feature type CDS
Gene -
Product helix-turn-helix domain-containing protein
Location 372336 - 373250 (strand: -1)
Length 915 (nucleotides) / 304 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_35
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF12833 Helix-turn-helix domain
PF14526 Integron-associated effector binding protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2207 Transcription (K) K AraC-type DNA-binding domain and AraC-containing proteins

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05804 AraC family transcriptional regulator, mar-sox-rob regulon activator - -

Protein Sequence

MNIDNIREDIIRSLILWIEQNLESDLSLDIVAERSGYSKWHLQRLFKIHTGIVLGKYIRSRRLSCAARALRITNSSILDISLKFRFDSQQTFCRAFKSQFTITPSGYRKKIGWDTTGFCFPLRPDSDIHIQSDLIVLQDLKLIGSDHYYQKNMTDPHTETTPFRHRFWHQFFSGIDAIPCDLYAMHAPSVSSVDDINYVYTTAIDESLLSKQASRSSALSAIALQGGNYLRIKINPETLAEDTHDYNHIIHSAYEKILPKFNMLRRRGPDIEHYKLTTPYTYSDFMADGLPCLKEINYYIPVIS

Flanking regions ( +/- flanking 50bp)

TGATGTGATATTTAATTAAGTTTAACAAGTATTTAACTGGTAACCAACTAATGAACATAGACAACATACGCGAAGATATTATTAGAAGTTTAATACTGTGGATAGAACAAAATTTAGAGTCTGATTTATCTCTGGATATTGTTGCTGAACGTTCAGGTTATTCAAAGTGGCATCTTCAGCGTTTGTTTAAGATTCATACAGGAATTGTTCTCGGAAAATACATACGATCCCGCCGCCTGTCCTGTGCCGCCAGAGCATTACGCATAACAAACAGCAGTATTCTTGATATCTCCCTTAAATTTCGCTTTGATTCACAACAAACATTTTGCCGGGCATTTAAATCTCAATTTACGATTACACCATCAGGCTACCGGAAAAAAATTGGCTGGGACACTACCGGGTTTTGCTTTCCTCTACGCCCGGACAGTGATATCCATATTCAATCTGATTTGATAGTACTTCAGGATTTGAAACTAATAGGCTCTGACCATTACTATCAAAAAAATATGACAGACCCGCATACTGAAACAACCCCATTTCGTCACCGGTTCTGGCATCAATTTTTCAGCGGCATTGATGCAATTCCCTGTGACCTGTACGCAATGCATGCTCCGTCAGTTTCCTCTGTAGATGACATTAATTATGTCTATACAACGGCAATTGATGAGTCATTATTATCCAAACAAGCCTCCCGCAGCTCTGCCCTCTCCGCCATTGCACTACAGGGGGGCAATTATCTCAGAATCAAAATAAACCCTGAAACACTGGCGGAAGATACGCATGACTATAATCATATAATCCATTCTGCTTATGAAAAAATATTGCCAAAATTTAATATGTTACGTAGAAGAGGACCGGACATTGAGCACTATAAACTAACGACCCCCTATACATATAGTGACTTTATGGCTGACGGTTTACCCTGTCTGAAAGAAATTAATTACTATATCCCGGTCATTTCATGACGCTGTATTTTGTTCAACTTTCAAGCTGGCCATCACCGTGATGGCATGGC