Homologs in group_308

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16590 FBDBKF_16590 38.5 Morganella morganii S1 - IS3 family transposase
EHELCC_12625 EHELCC_12625 100.0 Morganella morganii S2 - Integrase catalytic domain-containing protein
NLDBIP_12965 NLDBIP_12965 100.0 Morganella morganii S4 - Integrase catalytic domain-containing protein
LHKJJB_13590 LHKJJB_13590 100.0 Morganella morganii S3 - Integrase catalytic domain-containing protein
HKOGLL_11440 HKOGLL_11440 100.0 Morganella morganii S5 - Integrase catalytic domain-containing protein
F4V73_RS01605 F4V73_RS01605 45.4 Morganella psychrotolerans - IS3 family transposase
PMI_RS15560 PMI_RS15560 22.3 Proteus mirabilis HI4320 - IS481 family transposase

Distribution of the homologs in the orthogroup group_308

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_308

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P24577 1.88e-45 155 38 2 205 4 Bmul_4719 Insertion element IS407 uncharacterized 31.7 kDa protein Burkholderia multivorans (strain ATCC 17616 / 249)
P25438 1.19e-39 142 35 1 217 4 None Insertion element IS476 uncharacterized 39.2 kDa protein Xanthomonas euvesicatoria
Q9RI18 4.43e-18 80 40 0 98 4 lcrT Low calcium response locus protein T Yersinia pestis
Q00932 6.54e-18 80 40 0 98 4 lcrT Low calcium response locus protein T Yersinia pseudotuberculosis serotype I (strain IP32953)
P37007 4e-10 62 27 1 149 2 yagA Uncharacterized protein YagA Escherichia coli (strain K12)
P0C5W5 6.7e-08 55 24 7 234 3 insD Transposase InsD for insertion element IS2A/D/F/H/I/K Escherichia coli
P0CF59 6.7e-08 55 24 7 234 4 insD7 Transposase InsD for insertion element IS2 on F plasmid Escherichia coli (strain K12)
P0CF58 6.7e-08 55 24 7 234 4 insD6 Transposase InsD for insertion element IS2K Escherichia coli (strain K12)
P0CF57 6.7e-08 55 24 7 234 4 insD5 Transposase InsD for insertion element IS2I Escherichia coli (strain K12)
P0CF56 6.7e-08 55 24 7 234 4 insD4 Transposase InsD for insertion element IS2H Escherichia coli (strain K12)
P0CF55 6.7e-08 55 24 7 234 4 insD3 Transposase InsD for insertion element IS2F Escherichia coli (strain K12)
P0CF54 6.7e-08 55 24 7 234 4 insD2 Transposase InsD for insertion element IS2D Escherichia coli (strain K12)
P0CF53 6.7e-08 55 24 7 234 4 insD1 Transposase InsD for insertion element IS2A Escherichia coli (strain K12)
P0CF61 7.89e-08 55 24 7 234 4 JW5899 Transposase InsD for insertion element IS2-9 Escherichia coli (strain K12)
P0CF64 7.89e-08 55 24 7 234 4 JW5933 Transposase InsD for insertion element IS2-12 Escherichia coli (strain K12)
P0CF63 7.89e-08 55 24 7 234 4 JW5918 Transposase InsD for insertion element IS2-11 Escherichia coli (strain K12)
P0CF62 7.89e-08 55 24 7 234 4 JW5903 Transposase InsD for insertion element IS2-10 Escherichia coli (strain K12)
P03975 1.4e-07 55 32 2 96 2 Iap IgE-binding protein Mus musculus
Q88419 5.63e-07 53 27 6 167 3 ORF3 Putative integrase ORF3 Spiroplasma virus SpV1-C74
P51026 6.81e-07 52 24 7 231 3 None Insertion element IS2A uncharacterized 48.2 kDa protein Escherichia coli
P0CF60 1.1e-06 51 25 6 203 5 insD8 Putative transposase InsD for insertion element IS2E Escherichia coli (strain K12)
P17984 1.54e-06 50 44 1 59 4 None Insertion element ISR1 uncharacterized 17 kDa protein A2 Rhizobium sp.
P03363 3.85e-06 50 30 3 100 1 gag-pro-pol Gag-Pro-Pol polyprotein Human T-cell leukemia virus 2
P11368 9.21e-06 49 27 3 127 3 pol Intracisternal A-particle Pol-related polyprotein (Fragment) Mouse intracisternal a-particle MIA14
P12894 3.67e-05 47 29 3 119 3 None Intracisternal A-particle Pol-related polyprotein (Fragment) Mouse intracisternal a-particle IL3
P0C211 0.000538 44 36 0 52 1 gag-pro-pol Gag-Pro-Pol polyprotein Human T-cell leukemia virus 1 (isolate Melanesia mel5 subtype C)
P03362 0.000553 44 36 0 52 1 gag-pro-pol Gag-Pro-Pol polyprotein Human T-cell leukemia virus 1 (strain Japan ATK-1 subtype A)
P14078 0.000558 44 36 0 52 1 gag-pro-pol Gag-Pro-Pol polyprotein Human T-cell leukemia virus 1 (isolate Caribbea HS-35 subtype A)
O05086 0.001 42 24 3 203 3 HI_1721 Uncharacterized transposase-like protein HI_1721 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P04026 0.001 43 27 3 112 3 pol Intracisternal A-particle Pol-related polyprotein (Fragment) Hamster intracisternal a-particle H18

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_08900
Feature type CDS
Gene -
Product Integrase catalytic domain-containing protein
Location 162322 - 163026 (strand: -1)
Length 705 (nucleotides) / 234 (amino acids)

Contig

Accession contig_9
Length 163724 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_308
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF13683 Integrase core domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2801 Mobilome: prophages, transposons (X) X Transposase InsO and inactivated derivatives

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07497 putative transposase - -

Protein Sequence

MIDAIQAVLSESPQAGFWKCYYRLRFKGYNFNHKRVYRVYCRLGLNLKRRVKKKLPERIKVPLIATTRINEGWAMDFMSDSLYCGKRFRALNIIDESTRECLAIEIDTSLPAERIIRILSRLKEERGLPEYIRVDNGPEFISDKLVQFCTENEVTLNYIQPRKPQQNGFIERFNGSFRREFLNAYLFESLSQVKEMAWFWQQDYNLNRTHESLGHLPPEIYRKQLENSNQVCLR

Flanking regions ( +/- flanking 50bp)

GGGCCTCTTTTTATCGGCGCGATACTGACTGGCGAGAAAAAGATAAGGCCGTGATTGATGCTATTCAGGCTGTTTTATCTGAGTCGCCTCAGGCTGGCTTCTGGAAATGCTATTACCGTCTCAGATTTAAGGGCTATAACTTCAACCATAAACGTGTTTATCGTGTGTACTGCCGGCTGGGCTTAAACCTGAAACGGCGGGTAAAGAAAAAACTACCTGAGCGAATAAAAGTGCCGTTAATTGCCACCACCCGAATTAATGAAGGCTGGGCAATGGATTTTATGAGCGACAGTCTGTACTGCGGTAAACGTTTCAGAGCATTGAATATTATCGATGAAAGTACCCGCGAGTGCCTGGCAATTGAGATCGACACTTCATTACCGGCAGAGCGGATTATTCGTATTTTATCCCGGTTAAAAGAAGAACGCGGGTTACCGGAATATATCCGGGTGGACAACGGACCTGAATTTATATCGGATAAACTGGTTCAGTTTTGCACAGAAAATGAGGTCACTCTGAATTATATTCAGCCGCGAAAACCACAACAAAACGGGTTTATTGAGCGTTTTAACGGATCATTCCGCCGCGAGTTTTTAAATGCGTATTTGTTTGAATCACTGAGTCAGGTGAAGGAAATGGCCTGGTTCTGGCAGCAGGATTATAACCTGAATCGTACCCATGAAAGTCTGGGGCATCTTCCCCCGGAGATATACCGAAAACAGCTAGAAAATTCTAATCAGGTTTGTCTCAGATAATGGGGAGTGGACAGTCACCGCATTAGAAATAGAATTAAGTTTATAGTAAT