Homologs in group_16

Help

18 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04505 FBDBKF_04505 42.2 Morganella morganii S1 mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
FBDBKF_04700 FBDBKF_04700 91.6 Morganella morganii S1 xylG ABC-type sugar transport system, ATPase component
FBDBKF_15410 FBDBKF_15410 45.9 Morganella morganii S1 rbsA ribose ABC transporter ATP-binding protein RbsA
EHELCC_05795 EHELCC_05795 42.2 Morganella morganii S2 mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
EHELCC_05990 EHELCC_05990 91.6 Morganella morganii S2 xylG ABC-type sugar transport system, ATPase component
EHELCC_15770 EHELCC_15770 45.9 Morganella morganii S2 rbsA ribose ABC transporter ATP-binding protein RbsA
NLDBIP_06115 NLDBIP_06115 42.2 Morganella morganii S4 mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
NLDBIP_06310 NLDBIP_06310 91.6 Morganella morganii S4 xylG ABC-type sugar transport system, ATPase component
NLDBIP_16600 NLDBIP_16600 45.9 Morganella morganii S4 rbsA ribose ABC transporter ATP-binding protein RbsA
LHKJJB_02995 LHKJJB_02995 42.2 Morganella morganii S3 mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
LHKJJB_03190 LHKJJB_03190 91.6 Morganella morganii S3 xylG ABC-type sugar transport system, ATPase component
LHKJJB_16205 LHKJJB_16205 45.9 Morganella morganii S3 rbsA ribose ABC transporter ATP-binding protein RbsA
HKOGLL_06470 HKOGLL_06470 42.2 Morganella morganii S5 mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
HKOGLL_06665 HKOGLL_06665 91.6 Morganella morganii S5 xylG ABC-type sugar transport system, ATPase component
HKOGLL_15975 HKOGLL_15975 45.9 Morganella morganii S5 rbsA ribose ABC transporter ATP-binding protein RbsA
F4V73_RS09120 F4V73_RS09120 41.2 Morganella psychrotolerans - sugar ABC transporter ATP-binding protein
F4V73_RS17735 F4V73_RS17735 45.7 Morganella psychrotolerans rbsA ribose ABC transporter ATP-binding protein RbsA
PMI_RS00440 PMI_RS00440 46.1 Proteus mirabilis HI4320 rbsA ribose ABC transporter ATP-binding protein RbsA

Distribution of the homologs in the orthogroup group_16

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_16

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q2K353 3.09e-156 457 45 3 499 3 RHE_CH03989 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K353 1.98e-20 97 27 4 223 3 RHE_CH03989 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2KAW9 3.17e-156 457 46 3 494 3 RHE_CH01212 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2KAW9 3.98e-10 65 25 5 225 3 RHE_CH01212 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8UAK2 1.56e-155 455 44 3 499 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UAK2 1.44e-20 98 27 3 222 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92TS8 2.05e-155 455 45 3 499 3 RB1420 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium meliloti (strain 1021)
Q92TS8 1.39e-18 92 24 4 245 3 RB1420 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium meliloti (strain 1021)
Q1MAA2 3.9e-155 454 45 3 499 3 RL4654 Putative ribose/galactose/methyl galactoside import ATP-binding protein Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MAA2 1.47e-19 95 26 5 246 3 RL4654 Putative ribose/galactose/methyl galactoside import ATP-binding protein Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8UBN2 1.28e-152 447 45 3 495 3 Atu2819 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UBN2 4.35e-15 81 27 6 247 3 Atu2819 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4KDI2 1.31e-150 442 44 2 489 3 PFL_2594 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KDI2 2.82e-13 75 26 6 241 3 PFL_2594 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9KN37 2.48e-150 441 45 3 490 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KN37 2.29e-12 72 24 4 225 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MEV1 3.87e-150 441 45 3 493 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q7MEV1 3.13e-12 72 24 6 234 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q8D7T7 4.92e-150 441 45 3 493 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q8D7T7 4.01e-12 72 24 6 234 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q82CM5 1.15e-149 441 43 2 495 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8RBQ1 2.68e-149 439 46 2 489 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q39HA1 3.13e-149 439 43 3 492 3 Bcep18194_A4569 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39HA1 8.08e-19 92 25 3 221 3 Bcep18194_A4569 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2SMT0 3.27e-149 439 43 3 490 3 HCH_01167 Putative ribose/galactose/methyl galactoside import ATP-binding protein Hahella chejuensis (strain KCTC 2396)
Q2SMT0 1.56e-18 92 25 3 222 3 HCH_01167 Putative ribose/galactose/methyl galactoside import ATP-binding protein Hahella chejuensis (strain KCTC 2396)
Q9RDI1 6.91e-149 438 43 2 491 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9KAG5 1.18e-148 438 45 2 490 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KAG5 3.52e-20 97 25 2 221 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KAG5 5.62e-14 77 23 5 228 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0BG60 3.56e-148 437 43 4 498 3 Bamb_1305 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BG60 5.47e-19 93 24 5 246 3 Bamb_1305 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q87ZE0 3.84e-148 437 43 2 494 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87ZE0 3.91e-22 102 29 4 223 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87ZE0 8.48e-13 74 25 5 229 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9X051 4.57e-148 436 45 8 511 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X051 6.76e-18 90 26 7 264 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8Y003 7.14e-148 436 43 4 498 3 RSc1242 Putative ribose/galactose/methyl galactoside import ATP-binding protein Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8Y003 1.78e-21 100 26 3 222 3 RSc1242 Putative ribose/galactose/methyl galactoside import ATP-binding protein Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5KYQ7 1.2e-147 435 44 2 492 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q5KYQ7 8.05e-17 86 26 5 233 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q5KYQ7 1.08e-14 80 21 2 221 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q1BX03 1.94e-147 435 43 3 492 3 Bcen_0943 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia orbicola (strain AU 1054)
Q1BX03 2.32e-19 94 24 4 245 3 Bcen_0943 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia orbicola (strain AU 1054)
A0K6Q0 1.94e-147 435 43 3 492 3 Bcen2424_1425 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia cenocepacia (strain HI2424)
A0K6Q0 2.32e-19 94 24 4 245 3 Bcen2424_1425 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia cenocepacia (strain HI2424)
Q87H79 2.18e-147 434 44 3 490 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87H79 1.01e-13 77 27 7 236 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q48GY7 1.11e-146 433 43 2 494 3 PSPPH_3184 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48GY7 3.58e-21 100 28 4 225 3 PSPPH_3184 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48GY7 3.3e-12 72 24 5 229 3 PSPPH_3184 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6LH11 1.86e-146 432 44 3 493 3 rbsA Ribose import ATP-binding protein RbsA Photobacterium profundum (strain SS9)
Q6LH11 2.34e-16 85 27 4 228 3 rbsA Ribose import ATP-binding protein RbsA Photobacterium profundum (strain SS9)
Q4ZRC6 1.91e-146 432 43 2 497 3 Psyr_3264 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. syringae (strain B728a)
Q4ZRC6 1.37e-14 79 25 5 229 3 Psyr_3264 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. syringae (strain B728a)
Q57HW1 7.06e-146 430 45 4 493 3 rbsA Ribose import ATP-binding protein RbsA Salmonella choleraesuis (strain SC-B67)
Q57HW1 1.51e-08 60 22 4 229 3 rbsA Ribose import ATP-binding protein RbsA Salmonella choleraesuis (strain SC-B67)
Q8ZKV9 1.54e-145 429 45 4 493 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZKV9 1.5e-08 60 22 4 229 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q65UW1 1.54e-145 429 44 6 504 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65UW1 2.91e-13 75 22 3 220 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8Z2R4 1.98e-145 429 45 4 493 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhi
Q8Z2R4 3.07e-08 59 21 4 229 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhi
Q6DB87 6.4e-145 427 44 4 491 3 rbsA Ribose import ATP-binding protein RbsA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6DB87 6.6e-13 74 24 6 228 3 rbsA Ribose import ATP-binding protein RbsA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5PJX5 6.61e-145 427 45 4 493 3 rbsA Ribose import ATP-binding protein RbsA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PJX5 1.66e-08 60 22 4 229 3 rbsA Ribose import ATP-binding protein RbsA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1R4I3 2.16e-144 426 44 4 493 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain UTI89 / UPEC)
Q1R4I3 1.13e-08 61 23 4 228 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain UTI89 / UPEC)
Q9CP98 5.99e-144 425 43 3 493 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Pasteurella multocida (strain Pm70)
Q9CP98 7.34e-10 64 23 7 228 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Pasteurella multocida (strain Pm70)
Q3YVK8 7.13e-144 425 44 4 493 3 rbsA Ribose import ATP-binding protein RbsA Shigella sonnei (strain Ss046)
Q3YVK8 5.28e-08 58 23 4 228 3 rbsA Ribose import ATP-binding protein RbsA Shigella sonnei (strain Ss046)
P04983 1.7e-143 424 44 4 493 1 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain K12)
P04983 1.23e-08 60 23 4 228 1 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain K12)
Q0TAW0 1.7e-143 424 44 4 493 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TAW0 1.23e-08 60 23 4 228 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q5E4V6 2.02e-143 424 44 3 490 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E4V6 1.17e-12 73 24 4 240 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8FBS3 3.44e-143 423 44 4 493 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FBS3 1.27e-08 60 23 4 228 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8RD43 3.56e-143 423 42 3 493 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD43 2.24e-19 94 29 6 249 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q1AXG5 7.44e-143 422 43 3 489 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1BGC0 8.36e-143 423 43 3 493 3 Bcen_6474 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia orbicola (strain AU 1054)
Q1BGC0 9.14e-18 89 29 7 254 3 Bcen_6474 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia orbicola (strain AU 1054)
A0KE25 8.36e-143 423 43 3 493 3 Bcen2424_6709 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia cenocepacia (strain HI2424)
A0KE25 9.14e-18 89 29 7 254 3 Bcen2424_6709 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia cenocepacia (strain HI2424)
P44735 1.24e-142 422 43 3 492 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44735 4.78e-11 68 23 5 230 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QN44 1.32e-142 421 43 3 492 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain 86-028NP)
Q4QN44 1.66e-11 70 23 5 230 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain 86-028NP)
Q9CM08 1.34e-142 422 42 4 503 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Pasteurella multocida (strain Pm70)
Q9CM08 2.17e-12 72 21 3 220 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Pasteurella multocida (strain Pm70)
Q0TQU8 1.67e-142 422 42 4 498 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TQU8 4.86e-17 87 24 3 222 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8XAW7 1.79e-142 421 44 4 493 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Escherichia coli O157:H7
Q8XAW7 1.24e-08 60 23 4 228 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Escherichia coli O157:H7
Q8XKQ2 2.1e-142 422 42 4 498 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
Q8XKQ2 3.68e-17 87 24 3 222 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
Q6LG59 5.03e-142 420 42 3 499 3 mglA2 Galactose/methyl galactoside import ATP-binding protein MglA 2 Photobacterium profundum (strain SS9)
Q7NA79 5.98e-142 420 44 4 491 3 rbsA Ribose import ATP-binding protein RbsA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0ST95 9.4e-142 420 42 4 498 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain SM101 / Type A)
Q0ST95 3.1e-17 87 24 3 222 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain SM101 / Type A)
Q8X5Q4 1.33e-141 419 42 2 493 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Escherichia coli O157:H7
Q8X5Q4 1.99e-18 91 27 3 221 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Escherichia coli O157:H7
Q8X5Q4 5.72e-12 71 24 5 227 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Escherichia coli O157:H7
Q8FFU7 2.73e-141 419 41 3 500 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FFU7 1.22e-18 92 24 4 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFU2 2.73e-141 419 41 3 500 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TFU2 1.22e-18 92 24 4 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1ARR5 3.51e-141 418 43 2 490 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1ARR5 1.26e-20 98 25 4 242 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q3Z057 7.74e-141 417 41 5 501 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella sonnei (strain Ss046)
Q3Z057 1.3e-18 92 24 4 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella sonnei (strain Ss046)
P0AAG9 7.74e-141 417 41 5 501 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri
P0AAG9 1.3e-18 92 24 4 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri
P0AAG8 7.74e-141 417 41 5 501 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain K12)
P0AAG8 1.3e-18 92 24 4 244 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain K12)
Q664G2 8.81e-141 417 42 2 489 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q664G2 4.24e-19 93 25 5 265 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q664G2 4.03e-11 68 23 5 227 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1R9S4 8.91e-141 417 41 3 500 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain UTI89 / UPEC)
Q1R9S4 1.33e-18 92 24 4 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain UTI89 / UPEC)
P23924 9.21e-141 417 41 3 500 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X5D9 9.21e-141 417 41 3 500 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O157:H7
Q8X5D9 2.2e-18 91 24 4 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O157:H7
Q66C83 1.33e-140 417 42 5 494 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGT1 1.33e-140 417 42 5 494 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CHQ3 1.33e-140 417 42 5 494 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis
Q1C9V1 1.33e-140 417 42 5 494 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Antiqua)
Q0T2X5 1.67e-140 417 41 5 501 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri serotype 5b (strain 8401)
Q0T2X5 1.52e-18 92 24 4 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri serotype 5b (strain 8401)
Q1CDJ0 1.88e-140 416 42 2 489 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDJ0 4.51e-19 93 25 5 265 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDJ0 4.36e-11 68 23 5 227 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CG00 1.88e-140 416 42 2 489 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q7CG00 4.51e-19 93 25 5 265 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q7CG00 4.36e-11 68 23 5 227 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q1C1B8 1.88e-140 416 42 2 489 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C1B8 4.51e-19 93 25 5 265 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C1B8 4.36e-11 68 23 5 227 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
P44884 2.72e-140 416 41 4 503 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44884 2.37e-12 72 21 3 220 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QM77 2.72e-140 416 41 4 503 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain 86-028NP)
Q4QM77 2.37e-12 72 21 3 220 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain 86-028NP)
Q825P1 3.86e-140 416 41 2 486 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q825P1 3.13e-14 78 26 3 224 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q31YV7 2.33e-139 414 40 3 500 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella boydii serotype 4 (strain Sb227)
Q31YV7 1.62e-18 92 24 4 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella boydii serotype 4 (strain Sb227)
Q9KSD1 1.8e-138 411 42 5 492 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q92S10 3.3e-138 410 41 2 486 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium meliloti (strain 1021)
Q92S10 4.17e-15 81 27 4 230 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium meliloti (strain 1021)
Q92S10 3.65e-14 78 26 3 224 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium meliloti (strain 1021)
Q5KUX3 3.34e-138 410 41 2 490 3 rbsA Ribose import ATP-binding protein RbsA Geobacillus kaustophilus (strain HTA426)
Q2NUD6 3.55e-138 410 42 7 494 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Sodalis glossinidius (strain morsitans)
Q5KYS1 5.92e-138 410 43 7 500 3 xylG Xylose import ATP-binding protein XylG Geobacillus kaustophilus (strain HTA426)
Q5KYS1 9.56e-13 73 24 6 228 3 xylG Xylose import ATP-binding protein XylG Geobacillus kaustophilus (strain HTA426)
Q8ENB3 6.91e-138 409 41 2 486 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q0B775 7.99e-138 410 42 5 492 3 Bamb_4447 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B775 6.04e-17 87 28 5 248 3 Bamb_4447 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B775 6.54e-17 87 25 2 222 3 Bamb_4447 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q7MG07 1.08e-137 409 41 3 491 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain YJ016)
Q39GY8 3.33e-137 409 42 5 498 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GY8 1.26e-15 82 28 7 233 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0TPX5 3.4e-137 408 44 4 492 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TPX5 1.3e-14 79 25 4 228 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q6D4W8 3.66e-137 408 43 3 490 3 araG Arabinose import ATP-binding protein AraG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4W8 1.05e-13 77 26 4 223 3 araG Arabinose import ATP-binding protein AraG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1BQ82 3.94e-137 408 42 5 492 3 Bcen_3328 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia orbicola (strain AU 1054)
Q1BQ82 1.96e-16 85 22 3 248 3 Bcen_3328 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia orbicola (strain AU 1054)
Q1BQ82 2.01e-15 82 27 4 230 3 Bcen_3328 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia orbicola (strain AU 1054)
A0B297 3.94e-137 408 42 5 492 3 Bcen2424_5039 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia cenocepacia (strain HI2424)
A0B297 1.96e-16 85 22 3 248 3 Bcen2424_5039 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia cenocepacia (strain HI2424)
A0B297 2.01e-15 82 27 4 230 3 Bcen2424_5039 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia cenocepacia (strain HI2424)
Q8D4H4 4.13e-137 408 41 3 491 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain CMCP6)
Q0SSJ0 5.08e-137 407 44 4 492 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
Q0SSJ0 1.6e-14 79 25 4 228 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
Q399X3 1.11e-136 407 42 5 492 3 Bcep18194_B0624 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q399X3 1.47e-17 89 29 5 248 3 Bcep18194_B0624 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q399X3 1.04e-16 86 25 4 229 3 Bcep18194_B0624 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8XJX3 1.2e-136 407 43 4 492 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q8XJX3 2.09e-14 79 25 4 228 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q73DH7 1.87e-136 406 42 3 491 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73DH7 7.95e-13 74 22 2 217 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8REE1 1.91e-136 406 42 5 493 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q81HW8 3.47e-136 405 42 2 489 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q63FX9 3.63e-136 405 42 3 491 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ZK / E33L)
Q63FX9 1.18e-12 73 22 2 217 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ZK / E33L)
Q6HNE7 5.13e-136 405 42 3 491 3 rbsA Ribose import ATP-binding protein RbsA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HNE7 1.25e-12 73 22 2 217 3 rbsA Ribose import ATP-binding protein RbsA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81V36 5.13e-136 405 42 3 491 3 rbsA Ribose import ATP-binding protein RbsA Bacillus anthracis
Q81V36 1.25e-12 73 22 2 217 3 rbsA Ribose import ATP-binding protein RbsA Bacillus anthracis
Q6LK34 6.51e-136 404 42 3 495 3 mglA1 Galactose/methyl galactoside import ATP-binding protein MglA 1 Photobacterium profundum (strain SS9)
Q6LK34 1.32e-17 89 24 5 249 3 mglA1 Galactose/methyl galactoside import ATP-binding protein MglA 1 Photobacterium profundum (strain SS9)
Q896Y2 6.63e-136 405 42 4 501 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium tetani (strain Massachusetts / E88)
Q7UU57 6.97e-136 405 41 5 504 3 rbsA Ribose import ATP-binding protein RbsA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7UU57 4.47e-15 81 27 7 232 3 rbsA Ribose import ATP-binding protein RbsA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q8U9B0 3.34e-135 403 41 2 498 3 Atu3818 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U9B0 1.94e-14 79 26 5 225 3 Atu3818 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U9B0 6.63e-13 74 24 4 226 3 Atu3818 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q87FK7 3.55e-135 403 44 3 485 3 araG Arabinose import ATP-binding protein AraG Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1BWN5 4.52e-135 403 43 6 501 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia orbicola (strain AU 1054)
Q1BWN5 3.77e-15 81 27 7 233 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia orbicola (strain AU 1054)
A0K718 4.52e-135 403 43 6 501 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia cenocepacia (strain HI2424)
A0K718 3.77e-15 81 27 7 233 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia cenocepacia (strain HI2424)
Q65E55 6.5e-135 402 42 2 488 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65E55 8.28e-20 95 29 7 230 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8CK44 1.89e-134 401 40 2 486 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8CK44 6.44e-13 74 25 2 224 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8NR12 2.05e-134 402 40 2 493 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NR12 1.49e-11 70 24 5 240 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q65WJ1 2.18e-134 401 44 3 490 3 araG Arabinose import ATP-binding protein AraG Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1AVD3 2.82e-134 401 40 3 490 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1AVD3 2.48e-16 85 25 2 224 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q02XM9 5.44e-134 399 44 3 488 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. cremoris (strain SK11)
Q0BFU0 1.32e-133 399 42 6 501 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BFU0 1.42e-14 79 27 6 233 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q28P50 1.9e-133 399 41 2 497 3 rbsA Ribose import ATP-binding protein RbsA Jannaschia sp. (strain CCS1)
Q28P50 5.54e-20 96 26 5 247 3 rbsA Ribose import ATP-binding protein RbsA Jannaschia sp. (strain CCS1)
Q164K3 2.18e-133 399 40 2 489 3 rbsA Ribose import ATP-binding protein RbsA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q164K3 8.19e-18 89 28 4 222 3 rbsA Ribose import ATP-binding protein RbsA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q164K3 8.24e-12 70 27 8 249 3 rbsA Ribose import ATP-binding protein RbsA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q0BGD7 7.86e-133 397 41 3 491 3 Bamb_1228 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BGD7 2.63e-12 72 27 8 255 3 Bamb_1228 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q2T8T6 8.03e-133 397 41 5 498 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9CF44 1.35e-132 396 43 3 488 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. lactis (strain IL1403)
Q1J3P2 1.72e-132 396 40 1 488 3 rbsA Ribose import ATP-binding protein RbsA Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q1J3P2 6.1e-13 74 25 4 228 3 rbsA Ribose import ATP-binding protein RbsA Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q7NTN6 2.83e-132 395 42 2 486 3 rbsA Ribose import ATP-binding protein RbsA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NTN6 1.03e-12 73 25 2 224 3 rbsA Ribose import ATP-binding protein RbsA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NTN6 3.85e-12 72 25 4 230 3 rbsA Ribose import ATP-binding protein RbsA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8U949 2.95e-132 395 41 5 493 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UA86 3.2e-132 395 40 2 489 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UA86 3.15e-18 90 26 6 252 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UA86 8.96e-13 73 28 5 229 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5WC31 9.34e-132 394 41 2 490 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q5WC31 2.32e-17 88 27 5 233 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q5WC31 4.03e-12 72 25 7 257 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q891M1 1.23e-131 394 40 4 495 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q3JHZ1 1.55e-131 394 42 6 501 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia pseudomallei (strain 1710b)
Q21TR5 1.76e-131 394 42 5 492 3 Rfer_3129 Putative ribose/galactose/methyl galactoside import ATP-binding protein Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q63P06 2.09e-131 394 42 6 501 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia pseudomallei (strain K96243)
Q9K6J9 2.45e-131 393 40 2 490 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K6J9 1.04e-18 92 25 2 224 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q13FD9 3.2e-131 393 43 6 494 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q13FD9 1.18e-17 89 25 2 224 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q13FD9 1.15e-14 80 25 5 230 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q1M5X4 6.28e-131 392 40 2 493 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M5X4 6.72e-13 74 28 7 229 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M5X4 8.31e-13 74 23 3 222 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P36947 7.43e-131 391 40 2 488 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
P36947 5.52e-18 90 27 5 229 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
Q329G7 8.92e-131 391 40 3 493 3 rbsA Ribose import ATP-binding protein RbsA Shigella dysenteriae serotype 1 (strain Sd197)
Q329G7 6.3e-16 84 25 3 221 3 rbsA Ribose import ATP-binding protein RbsA Shigella dysenteriae serotype 1 (strain Sd197)
Q329G7 1.13e-08 61 24 4 218 3 rbsA Ribose import ATP-binding protein RbsA Shigella dysenteriae serotype 1 (strain Sd197)
Q13LX0 1.57e-130 391 41 2 482 3 rbsA Ribose import ATP-binding protein RbsA Paraburkholderia xenovorans (strain LB400)
Q13LX0 1.04e-15 83 26 6 240 3 rbsA Ribose import ATP-binding protein RbsA Paraburkholderia xenovorans (strain LB400)
Q66AF5 2.23e-130 391 42 3 496 3 araG Arabinose import ATP-binding protein AraG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CIX6 2.23e-130 391 42 3 496 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WER5 2.23e-130 391 42 3 496 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis
Q1C7J0 2.23e-130 391 42 3 496 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis bv. Antiqua (strain Antiqua)
Q9CL63 3.49e-130 390 40 1 489 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q9CL63 1.79e-15 82 26 5 250 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q1BJW2 1.02e-129 389 40 3 499 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
Q1BJW2 2.09e-16 85 28 6 226 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
A0B3Z7 1.02e-129 389 40 3 499 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
A0B3Z7 2.09e-16 85 28 6 226 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
Q1MBG4 1.36e-129 389 41 4 492 3 araG Arabinose import ATP-binding protein AraG Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q6VMN4 4.56e-129 387 40 5 502 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q6VMN4 5.42e-17 87 28 6 226 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q6VMN4 1.65e-10 67 22 5 245 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q3MB44 7.02e-129 387 41 4 493 3 rbsA Ribose import ATP-binding protein RbsA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3MB44 1.27e-16 85 24 5 249 3 rbsA Ribose import ATP-binding protein RbsA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q0S9A4 8.75e-129 387 40 2 493 3 rbsA Ribose import ATP-binding protein RbsA Rhodococcus jostii (strain RHA1)
Q0S9A4 5.56e-16 84 28 5 226 3 rbsA Ribose import ATP-binding protein RbsA Rhodococcus jostii (strain RHA1)
Q0S9A4 1.74e-13 76 25 4 223 3 rbsA Ribose import ATP-binding protein RbsA Rhodococcus jostii (strain RHA1)
Q8E7N9 9.23e-129 386 42 3 483 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q8E7N9 1.41e-15 82 25 3 231 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q8E7N9 1.16e-13 76 23 4 226 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q9WXX0 1.1e-128 387 39 4 501 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX0 2.95e-22 103 27 4 229 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q3K3R2 1.2e-128 386 42 3 483 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K3R2 1.1e-15 83 25 3 231 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K3R2 2.04e-13 75 23 4 226 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q4ZTW1 2.1e-128 385 41 3 490 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. syringae (strain B728a)
Q4ZTW1 1.97e-14 79 25 4 233 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. syringae (strain B728a)
Q48IS7 3.56e-128 385 41 3 490 3 araG Arabinose import ATP-binding protein AraG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48IS7 8e-14 77 25 4 233 3 araG Arabinose import ATP-binding protein AraG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q987E7 3.88e-128 385 40 4 493 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q882I8 5.99e-128 384 41 5 495 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q882I8 5.09e-14 77 25 4 233 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8E281 9.47e-128 384 41 3 483 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E281 3.79e-15 81 24 3 231 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E281 2.27e-13 75 23 4 226 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q39BJ8 9.67e-128 384 40 3 491 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39BJ8 6.92e-16 84 28 6 226 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1JUP7 9.91e-128 384 40 3 491 3 araG Arabinose import ATP-binding protein AraG Azospirillum brasilense
Q1JUP7 1.8e-15 82 28 6 227 3 araG Arabinose import ATP-binding protein AraG Azospirillum brasilense
Q2K0S7 1.9e-127 383 39 2 477 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K0S7 1.74e-14 79 24 5 257 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q56342 5.57e-127 382 39 2 491 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema pallidum (strain Nichols)
Q56342 2.71e-15 82 23 7 243 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema pallidum (strain Nichols)
Q2K3Y7 8.01e-127 381 40 4 492 3 araG Arabinose import ATP-binding protein AraG Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q03CA4 1.77e-126 380 41 2 488 3 rbsA Ribose import ATP-binding protein RbsA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q3K8M7 2.99e-126 380 41 3 490 3 araG Arabinose import ATP-binding protein AraG Pseudomonas fluorescens (strain Pf0-1)
Q0B5V4 1.91e-125 379 40 3 499 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B5V4 2.66e-15 82 28 6 226 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q92UI2 1.99e-125 378 40 4 492 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium meliloti (strain 1021)
Q9K7C3 2.73e-125 378 40 6 500 3 araG L-arabinose transport ATP-binding protein AraG Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q6LUY1 3.12e-125 377 39 6 500 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q6LUY1 7.39e-13 74 24 5 247 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q73KK2 3.41e-125 377 39 2 493 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q92W56 4.26e-125 377 40 3 492 3 araG Arabinose import ATP-binding protein AraG Rhizobium meliloti (strain 1021)
Q2RGX2 4.57e-125 377 41 6 499 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RGX2 4.74e-15 81 26 4 226 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RGX2 8.18e-10 64 24 4 223 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q3JNJ9 4.83e-125 377 42 5 492 3 araG Arabinose import ATP-binding protein AraG Burkholderia pseudomallei (strain 1710b)
Q1BZA2 4.89e-125 377 42 5 492 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia orbicola (strain AU 1054)
A0K4E8 4.89e-125 377 42 5 492 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia cenocepacia (strain HI2424)
Q39JR1 7.78e-125 376 42 5 492 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1QYT1 2.24e-124 375 39 4 495 3 araG Arabinose import ATP-binding protein AraG Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q2SZC2 3.07e-124 375 42 5 492 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63QQ7 4.69e-124 374 42 5 492 3 araG Arabinose import ATP-binding protein AraG Burkholderia pseudomallei (strain K96243)
Q1M360 7.6e-124 374 39 6 503 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M360 6.37e-17 87 26 4 223 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1GHE5 1.97e-123 373 39 6 496 3 rbsA Ribose import ATP-binding protein RbsA Ruegeria sp. (strain TM1040)
Q1GHE5 1.23e-21 101 29 5 245 3 rbsA Ribose import ATP-binding protein RbsA Ruegeria sp. (strain TM1040)
Q1GHE5 3.65e-09 62 23 5 246 3 rbsA Ribose import ATP-binding protein RbsA Ruegeria sp. (strain TM1040)
Q62GY9 2.02e-123 373 42 5 492 3 araG Arabinose import ATP-binding protein AraG Burkholderia mallei (strain ATCC 23344)
Q322L1 4.89e-123 372 41 3 490 3 araG Arabinose import ATP-binding protein AraG Shigella boydii serotype 4 (strain Sb227)
Q0TGT7 8.59e-123 371 41 3 490 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0AAF3 1.02e-122 371 41 3 490 1 araG Arabinose import ATP-binding protein AraG Escherichia coli (strain K12)
P0AAF4 1.02e-122 371 41 3 490 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF5 1.02e-122 371 41 3 490 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O157:H7
Q32HC7 1.05e-122 371 41 3 490 3 araG Arabinose import ATP-binding protein AraG Shigella dysenteriae serotype 1 (strain Sd197)
Q92W60 1.43e-122 371 38 5 495 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q92W60 8.83e-18 89 25 5 245 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q1RAN8 2.53e-122 370 41 3 490 3 araG Arabinose import ATP-binding protein AraG Escherichia coli (strain UTI89 / UPEC)
Q11C01 3.14e-122 370 41 3 476 3 rbsA Ribose import ATP-binding protein RbsA Chelativorans sp. (strain BNC1)
Q11C01 5.27e-09 62 23 7 239 3 rbsA Ribose import ATP-binding protein RbsA Chelativorans sp. (strain BNC1)
Q3Z2S7 5.95e-122 369 41 3 490 3 araG Arabinose import ATP-binding protein AraG Shigella sonnei (strain Ss046)
Q2T4S8 1.02e-121 369 39 3 496 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4S8 7.9e-16 83 26 5 225 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9S472 1.45e-121 368 41 6 501 3 araG L-arabinose transport ATP-binding protein AraG Geobacillus stearothermophilus
Q9S472 2.79e-11 69 24 5 240 3 araG L-arabinose transport ATP-binding protein AraG Geobacillus stearothermophilus
Q83KP2 2.23e-121 367 40 3 490 3 araG Arabinose import ATP-binding protein AraG Shigella flexneri
Q13U53 2.74e-121 368 40 5 492 3 araG Arabinose import ATP-binding protein AraG Paraburkholderia xenovorans (strain LB400)
Q0BIE1 5.18e-121 367 42 5 492 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8XVS2 1.16e-120 366 40 5 497 3 araG Arabinose import ATP-binding protein AraG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q2K204 1.07e-119 363 40 5 495 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K204 3.49e-16 84 23 4 242 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K204 1.86e-05 50 26 7 203 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2SJ99 1.04e-115 353 39 4 494 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q2SJ99 1.72e-17 88 25 3 231 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
P32721 1.08e-114 350 38 7 486 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
P32721 2.27e-13 75 25 3 223 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
Q1MHS1 2.95e-114 350 38 4 496 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q576H3 2e-113 347 38 7 505 3 xylG Xylose import ATP-binding protein XylG Brucella abortus biovar 1 (strain 9-941)
Q576H3 9.55e-13 73 25 7 231 3 xylG Xylose import ATP-binding protein XylG Brucella abortus biovar 1 (strain 9-941)
Q2YJE7 2e-113 347 38 7 505 3 xylG Xylose import ATP-binding protein XylG Brucella abortus (strain 2308)
Q2YJE7 9.55e-13 73 25 7 231 3 xylG Xylose import ATP-binding protein XylG Brucella abortus (strain 2308)
Q1R528 1.06e-112 345 37 7 501 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q1R528 4.54e-12 72 25 7 246 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q8YDN0 1.11e-112 345 38 7 505 3 xylG Xylose import ATP-binding protein XylG Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YDN0 1.02e-12 73 25 7 231 3 xylG Xylose import ATP-binding protein XylG Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FCE2 1.79e-112 345 37 8 504 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCE2 1.4e-12 73 25 7 246 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBN5 1.79e-112 345 37 8 504 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBN5 1.4e-12 73 25 7 246 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q31V51 2.18e-112 345 37 7 501 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q31V51 2.56e-12 72 25 7 246 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q8XDM1 2.18e-112 345 37 7 501 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q8XDM1 2.56e-12 72 25 7 246 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q0SY86 4.39e-112 344 37 7 501 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q0SY86 4.19e-12 72 25 7 246 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
P37388 5.22e-112 344 37 7 501 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
P37388 2.84e-12 72 25 7 246 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
Q92MP8 6.11e-112 343 40 3 490 3 R02565 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium meliloti (strain 1021)
Q92MP8 2.59e-14 79 27 4 231 3 R02565 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium meliloti (strain 1021)
Q8FUR8 3.07e-111 342 38 7 505 3 xylG Xylose import ATP-binding protein XylG Brucella suis biovar 1 (strain 1330)
Q8FUR8 1.46e-12 73 25 7 231 3 xylG Xylose import ATP-binding protein XylG Brucella suis biovar 1 (strain 1330)
Q83J33 8.24e-111 341 37 7 501 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q83J33 3.19e-12 72 25 7 246 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q6BEX0 8.98e-111 340 35 2 491 1 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli (strain K12)
Q6BEX0 6.74e-18 89 24 4 241 1 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli (strain K12)
P63299 9.17e-111 340 35 2 491 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
P63299 6.33e-18 90 24 4 241 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
Q398W2 1.65e-110 340 39 5 482 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q398W2 5.8e-15 80 25 3 229 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0B7X0 1.97e-110 340 39 6 482 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B7X0 3.25e-14 78 25 3 229 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q98K15 4.13e-110 339 38 4 495 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P77509 8.39e-110 338 37 3 472 3 yphE Uncharacterized ABC transporter ATP-binding protein YphE Escherichia coli (strain K12)
P77509 5.16e-12 71 24 3 221 3 yphE Uncharacterized ABC transporter ATP-binding protein YphE Escherichia coli (strain K12)
Q2K9A3 1.78e-109 337 38 4 497 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1BPL3 2.56e-108 334 40 6 482 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia orbicola (strain AU 1054)
Q1BPL3 2.04e-13 75 26 3 229 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia orbicola (strain AU 1054)
A0B1M7 2.56e-108 334 40 6 482 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia cenocepacia (strain HI2424)
A0B1M7 2.04e-13 75 26 3 229 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia cenocepacia (strain HI2424)
Q663Y5 7.28e-108 333 36 7 501 3 xylG Xylose import ATP-binding protein XylG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q663Y5 5.18e-13 74 26 7 246 3 xylG Xylose import ATP-binding protein XylG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CDC0 7.28e-108 333 36 7 501 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDC0 5.18e-13 74 26 7 246 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CFR2 7.28e-108 333 36 7 501 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis
Q7CFR2 5.18e-13 74 26 7 246 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis
Q1C0D5 7.28e-108 333 36 7 501 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C0D5 5.18e-13 74 26 7 246 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Antiqua)
Q1BG93 1.54e-107 332 36 7 505 3 xylG Xylose import ATP-binding protein XylG Burkholderia orbicola (strain AU 1054)
A0KE53 1.54e-107 332 36 7 505 3 xylG Xylose import ATP-binding protein XylG Burkholderia cenocepacia (strain HI2424)
Q13RB6 1.06e-106 330 37 7 502 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
Q8XPK6 1.18e-105 327 37 8 507 3 xylG Xylose import ATP-binding protein XylG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XPK6 5.46e-11 68 25 5 230 3 xylG Xylose import ATP-binding protein XylG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8G847 3.26e-105 326 37 4 481 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q8G847 8.27e-16 83 25 3 222 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q4ZSF3 9.1e-104 323 37 7 505 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. syringae (strain B728a)
Q0B1U4 1.09e-103 323 36 9 508 3 xylG Xylose import ATP-binding protein XylG Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0I348 1.45e-102 319 36 8 503 3 xylG Xylose import ATP-binding protein XylG Histophilus somni (strain 129Pt)
Q3J3V9 6.21e-102 317 35 5 482 3 rbsA Ribose import ATP-binding protein RbsA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3J3V9 4.09e-11 68 23 5 219 3 rbsA Ribose import ATP-binding protein RbsA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6DB03 7.59e-102 318 35 9 503 3 xylG Xylose import ATP-binding protein XylG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6DB03 1.34e-10 67 25 6 255 3 xylG Xylose import ATP-binding protein XylG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2SVU4 1.58e-101 317 38 4 476 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVU4 8.87e-13 73 25 4 249 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q88J90 2.4e-101 316 35 4 490 3 rbsA Ribose import ATP-binding protein RbsA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88J90 2.8e-19 94 28 5 223 3 rbsA Ribose import ATP-binding protein RbsA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88J90 6.78e-16 84 25 4 234 3 rbsA Ribose import ATP-binding protein RbsA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q2SW38 7.4e-101 315 36 9 508 3 xylG Xylose import ATP-binding protein XylG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
O05253 1.09e-100 315 35 4 485 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
O05253 4.93e-16 84 26 3 223 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
O05253 1.9e-07 57 23 10 251 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
Q880Z2 1.5e-100 315 37 8 506 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3KDW2 1.56e-100 314 36 8 505 3 xylG Xylose import ATP-binding protein XylG Pseudomonas fluorescens (strain Pf0-1)
Q48J74 7.39e-100 313 37 8 505 3 xylG Xylose import ATP-binding protein XylG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q62K91 1.06e-95 301 37 4 494 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia mallei (strain ATCC 23344)
Q62K91 9.52e-13 73 24 4 249 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia mallei (strain ATCC 23344)
P45046 1.93e-95 301 34 7 501 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A2RKA7 6.42e-92 292 34 6 501 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
A4TQL5 1.03e-91 292 34 9 515 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis (strain Pestoides F)
Q1CN15 1.03e-91 292 34 9 515 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R074 1.03e-91 292 34 9 515 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Angola)
Q0WJP9 1.03e-91 292 34 9 515 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis
Q1C138 1.03e-91 292 34 9 515 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Antiqua)
Q66EY9 1.07e-91 292 34 10 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3G1 1.07e-91 292 34 10 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B1JLQ0 1.25e-91 291 35 9 514 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FMJ7 3.3e-91 291 35 9 514 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q8ZKQ4 1.04e-90 289 34 8 484 1 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3JSI8 1.07e-90 298 37 4 495 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia pseudomallei (strain 1710b)
P0C886 3.5e-90 287 34 8 484 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella choleraesuis (strain SC-B67)
A9MZG1 5.32e-90 287 34 8 484 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJE7 5.32e-90 287 34 8 484 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A1JJ55 2.57e-89 286 33 8 513 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8Z2X5 5.12e-89 285 34 8 484 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella typhi
Q2PBM0 4.29e-88 282 33 9 507 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus luminescens
Q7N2D9 3.63e-87 280 33 7 506 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A6TEB8 4.66e-85 274 33 8 500 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A6TEB8 0.00065 45 19 5 225 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
D4GPW3 3.05e-84 273 33 11 523 3 tsgD13 Glucose import ATP-binding protein TsgD13 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GPW3 1.4e-14 79 24 5 249 3 tsgD13 Glucose import ATP-binding protein TsgD13 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GPW3 3.61e-09 62 23 9 251 3 tsgD13 Glucose import ATP-binding protein TsgD13 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q2PBM3 1.51e-83 270 32 7 499 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus temperata
A4WER4 2.09e-82 267 35 10 500 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Enterobacter sp. (strain 638)
A4WER4 0.000633 45 22 6 227 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Enterobacter sp. (strain 638)
B1IRU7 9.95e-82 265 33 8 501 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P77257 1.59e-81 265 32 7 501 1 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain K12)
B1XEA1 1.59e-81 265 32 7 501 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain K12 / DH10B)
B1LFA2 8.81e-81 263 32 7 501 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain SMS-3-5 / SECEC)
A8A066 1.67e-80 262 32 8 501 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli O9:H4 (strain HS)
Q8XAY7 3.36e-80 261 32 9 505 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli O157:H7
Q83L12 2.97e-79 259 31 7 501 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Shigella flexneri
Q0T4L9 3.67e-79 259 31 7 501 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Shigella flexneri serotype 5b (strain 8401)
P55570 4.61e-71 237 32 11 484 3 NGR_a02480 Uncharacterized ABC transporter ATP-binding protein y4mK Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P75516 6.39e-54 193 29 18 553 3 MPN_258 Putative carbohydrate transport ATP-binding protein MPN_258 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75516 1.07e-10 67 23 4 230 3 MPN_258 Putative carbohydrate transport ATP-binding protein MPN_258 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75516 0.00011 48 23 5 236 3 MPN_258 Putative carbohydrate transport ATP-binding protein MPN_258 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
A7ZLX1 9.15e-45 163 33 6 311 5 lsrA Putative autoinducer 2 import ATP-binding protein LsrA homolog Escherichia coli O139:H28 (strain E24377A / ETEC)
A7ZLX1 6.11e-16 82 29 4 208 5 lsrA Putative autoinducer 2 import ATP-binding protein LsrA homolog Escherichia coli O139:H28 (strain E24377A / ETEC)
P47365 1.01e-43 165 27 16 547 3 MG119 Putative carbohydrate transport ATP-binding protein MG119 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P0DTT6 5.27e-38 142 35 2 236 1 xylG Xylose/arabinose import ATP-binding protein XylG Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P0DTT6 4.05e-17 84 26 2 202 1 xylG Xylose/arabinose import ATP-binding protein XylG Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q9F9B0 7.82e-37 139 34 3 226 1 frcA Fructose import ATP-binding protein FrcA Rhizobium meliloti
Q9F9B0 4.32e-15 78 27 4 221 1 frcA Fructose import ATP-binding protein FrcA Rhizobium meliloti
Q8PUE7 3.88e-27 117 25 14 473 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 3.34e-11 68 23 6 232 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 8.65e-08 58 23 7 222 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q87G35 1.15e-26 117 24 20 551 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87G35 2.98e-09 63 22 4 227 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q58663 1.87e-25 108 30 4 236 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58663 2.39e-10 64 23 2 209 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8PSR0 1.8e-24 110 23 23 555 3 MM_3016 Putative ABC transporter ATP-binding protein MM_3016 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PSR0 4.76e-15 81 27 5 214 3 MM_3016 Putative ABC transporter ATP-binding protein MM_3016 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P94440 1.57e-23 104 31 6 231 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 2.77e-11 68 25 5 219 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
O28881 1.36e-22 100 27 4 249 3 livG Probable branched-chain amino acid transport ATP-binding protein LivG Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O28881 3.82e-07 55 22 5 216 3 livG Probable branched-chain amino acid transport ATP-binding protein LivG Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O83321 2.61e-22 103 22 12 519 1 rfuB Probable riboflavin import ATP-binding protein RfuB Treponema pallidum (strain Nichols)
Q74I62 3.49e-22 103 23 16 518 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74I62 1.35e-08 60 25 5 245 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8XXY9 1.07e-21 99 29 6 230 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXY9 2.5e-13 74 24 5 220 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q897I2 1.45e-21 100 26 12 375 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 1.53e-10 66 25 6 216 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 2.35e-05 50 28 1 91 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q73R11 1.53e-21 100 23 13 486 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73R11 6.27e-07 55 24 4 226 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P54537 3.23e-21 95 32 7 229 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
P54537 7.35e-14 74 27 6 216 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
O86311 3.49e-21 97 32 7 228 1 Rv1218c Multidrug efflux system ATP-binding protein Rv1218c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O86311 3.76e-08 58 25 5 201 1 Rv1218c Multidrug efflux system ATP-binding protein Rv1218c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q2JPW6 4.87e-21 95 30 7 267 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q2JPW6 1.08e-06 53 24 7 200 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q4KC87 2.04e-20 95 31 7 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KC87 4.75e-18 89 31 6 225 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8TQ05 2.53e-20 97 22 21 549 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQ05 2.65e-14 79 27 4 215 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9Z3I3 3.05e-20 94 27 8 279 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q9Z3I3 1.71e-09 62 24 7 205 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
O34362 3.94e-20 97 21 15 517 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 1.79e-14 79 27 9 247 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q1LKJ2 4.66e-20 94 26 5 258 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LKJ2 9.44e-12 69 23 4 208 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8YUV1 4.85e-20 93 28 4 242 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8YUV1 1.89e-09 62 23 7 229 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q02QM1 5.01e-20 93 29 6 233 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02QM1 3.38e-10 64 24 7 225 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
O07016 5.68e-20 94 29 4 223 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
O07016 2.85e-12 70 22 2 214 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
P26050 5.91e-20 94 28 8 275 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P26050 1.52e-10 65 22 4 203 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9HYL7 6.01e-20 93 29 6 233 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HYL7 3.78e-10 64 24 7 225 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q92CK1 6.77e-20 92 29 6 220 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92CK1 2.71e-12 70 25 5 204 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q72FW5 7.96e-20 94 28 6 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72FW5 1.12e-16 85 29 8 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q2FRT7 8.76e-20 94 29 10 276 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q2FRT7 7.87e-14 76 26 7 220 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q1BWI2 1.07e-19 93 28 10 266 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q1BWI2 5.41e-16 82 26 4 210 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q5WKG4 1.39e-19 91 26 8 283 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q5WKG4 8.79e-12 68 26 6 210 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q1QE80 1.46e-19 94 28 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QE80 2.01e-15 81 28 9 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q6RCE0 2.07e-19 91 28 8 253 3 phnC Phosphonates import ATP-binding protein PhnC Stutzerimonas stutzeri
Q6RCE0 2.71e-11 67 25 7 217 3 phnC Phosphonates import ATP-binding protein PhnC Stutzerimonas stutzeri
Q39GT7 2.43e-19 92 28 10 266 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GT7 3.01e-15 80 25 4 208 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P9WQL3 2.59e-19 92 30 5 213 1 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL3 3.84e-17 86 27 4 209 1 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL2 2.59e-19 92 30 5 213 3 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQL2 3.84e-17 86 27 4 209 3 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8U4K3 3.94e-19 92 29 6 247 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U4K3 1.42e-14 78 27 7 222 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P21630 4.39e-19 89 28 3 213 3 braG High-affinity branched-chain amino acid transport ATP-binding protein BraG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P21630 1.02e-11 68 26 3 219 3 braG High-affinity branched-chain amino acid transport ATP-binding protein BraG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q28VL7 4.72e-19 89 29 7 226 3 thiQ Thiamine import ATP-binding protein ThiQ Jannaschia sp. (strain CCS1)
Q28VL7 4.72e-10 63 24 4 214 3 thiQ Thiamine import ATP-binding protein ThiQ Jannaschia sp. (strain CCS1)
Q7NWX3 5.33e-19 92 32 6 242 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NWX3 3.97e-15 80 26 8 241 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q882S0 6.25e-19 90 27 8 248 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q882S0 1.47e-11 68 24 7 217 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8UH62 7.35e-19 91 30 6 211 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UH62 1.74e-12 72 24 5 215 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4ZU82 8.32e-19 89 27 8 253 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas syringae pv. syringae (strain B728a)
Q4ZU82 1.58e-11 68 24 7 217 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas syringae pv. syringae (strain B728a)
O29527 9e-19 90 28 4 213 3 AF_0731 Putative ABC transporter ATP-binding protein AF_0731 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P42246 9.74e-19 90 27 9 249 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
P42246 8.61e-10 63 28 9 216 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
P56344 1.02e-18 88 26 6 258 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
P56344 8.41e-15 77 28 8 205 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
O34677 1.03e-18 89 30 5 218 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
O34677 3.28e-11 67 24 3 225 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q0SBZ1 1.06e-18 90 29 8 264 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q0SBZ1 3.5e-18 89 28 3 204 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q8Z8W8 1.39e-18 90 28 5 223 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q8Z8W8 3.03e-11 68 26 5 206 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q5PFQ7 1.49e-18 90 28 5 223 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PFQ7 3.03e-11 68 26 5 206 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5JEB0 1.5e-18 90 25 6 247 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5JEB0 5.25e-15 79 27 8 228 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P94420 1.55e-18 88 28 8 249 1 yclP Petrobactin import ATP-binding protein YclP Bacillus subtilis (strain 168)
P94420 6.56e-06 51 25 6 217 1 yclP Petrobactin import ATP-binding protein YclP Bacillus subtilis (strain 168)
Q720M2 1.8e-18 88 29 6 220 3 LMOf2365_1216 Putative ABC transporter ATP-binding protein LMOf2365_1216 Listeria monocytogenes serotype 4b (strain F2365)
Q720M2 8.3e-12 68 24 6 213 3 LMOf2365_1216 Putative ABC transporter ATP-binding protein LMOf2365_1216 Listeria monocytogenes serotype 4b (strain F2365)
Q8PY26 1.98e-18 89 28 4 206 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PY26 2.23e-13 73 27 7 205 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8KLG1 2.31e-18 89 29 6 235 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 5.87e-13 73 25 6 211 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q48HL2 2.35e-18 88 26 6 248 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48HL2 1.82e-09 62 24 8 215 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8Y7R4 2.42e-18 88 29 6 220 3 lmo1207 Putative ABC transporter ATP-binding protein lmo1207 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y7R4 7.85e-12 69 24 6 205 3 lmo1207 Putative ABC transporter ATP-binding protein lmo1207 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q04EY4 2.99e-18 88 30 5 217 3 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04EY4 2.32e-09 62 25 7 207 3 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
O31339 3e-18 89 31 8 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
O31339 8.78e-12 70 24 4 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q832R5 3.04e-18 91 21 17 515 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q3KCC5 3.4e-18 89 29 6 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q3KCC5 9.69e-16 82 30 8 225 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
P24693 3.75e-18 87 27 2 232 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
P24693 7.24e-11 65 23 6 208 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
A0A0H2ZLL3 3.97e-18 87 32 8 206 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A0A0H2ZLL3 1.19e-12 71 24 6 207 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P63354 4.36e-18 89 28 6 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63354 2.46e-12 72 26 5 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 4.36e-18 89 28 6 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P63353 2.46e-12 72 26 5 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q50966 4.43e-18 89 33 5 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q50966 1.93e-17 87 28 7 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q4QP85 4.64e-18 89 30 7 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q4QP85 4.78e-13 73 29 8 209 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q9KUI0 5.68e-18 89 29 6 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KUI0 6.12e-09 61 23 5 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q3IWB5 5.77e-18 86 28 4 206 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9AB70 6.26e-18 87 27 7 262 3 phnC Phosphonates import ATP-binding protein PhnC Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9AB70 2.81e-07 55 25 9 236 3 phnC Phosphonates import ATP-binding protein PhnC Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P96063 7e-18 88 27 5 223 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P96063 3.11e-11 68 26 5 206 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5FA19 7.13e-18 88 32 6 212 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5FA19 2.5e-17 87 28 7 237 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q0S0Z3 7.81e-18 88 29 8 264 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q0S0Z3 3.12e-17 86 27 3 204 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
P44513 7.94e-18 88 30 7 230 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44513 3.34e-12 71 27 9 234 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2W450 9.55e-18 85 31 6 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2W450 0.000144 47 24 7 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q5L222 9.88e-18 88 24 5 266 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5L222 6.34e-12 70 25 6 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
P0A191 1.08e-17 85 26 2 205 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A191 2.02e-17 85 27 4 221 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A192 1.08e-17 85 26 2 205 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhi
P0A192 2.02e-17 85 27 4 221 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhi
Q04G50 1.23e-17 87 26 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04G50 1.59e-11 69 27 6 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q1R597 1.33e-17 85 26 6 248 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q1R597 1.15e-07 56 22 7 210 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q57SD6 1.36e-17 87 27 5 223 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q57SD6 6.62e-11 67 25 5 206 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
A3CMQ7 1.36e-17 88 26 7 263 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
A3CMQ7 1.33e-09 63 25 7 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
P37624 1.38e-17 89 23 12 489 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 4.53e-08 59 22 11 298 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
Q9K789 1.54e-17 87 24 10 355 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K789 1.96e-09 62 24 6 216 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0ASQ1 1.62e-17 85 27 7 254 3 phnC Phosphonates import ATP-binding protein PhnC Maricaulis maris (strain MCS10)
Q0ASQ1 1.99e-07 55 23 8 220 3 phnC Phosphonates import ATP-binding protein PhnC Maricaulis maris (strain MCS10)
Q8RI39 1.66e-17 87 28 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8RI39 7.06e-09 61 24 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8PC11 1.66e-17 87 29 6 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PC11 1.42e-10 66 26 6 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q44848 1.76e-17 88 22 16 483 3 BB_0318 Uncharacterized ABC transporter ATP-binding protein BB_0318 Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q32AY3 1.79e-17 85 27 5 232 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q32AY3 1.88e-08 58 23 7 210 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q8FCJ1 1.81e-17 85 26 6 248 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCJ1 2.85e-08 58 23 7 210 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 1.81e-17 85 26 6 248 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBU8 2.85e-08 58 23 7 210 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q92UV5 2.12e-17 87 30 8 224 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q92UV5 1.26e-07 57 26 6 219 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q3A9G5 2.17e-17 86 25 6 256 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3A9G5 8.66e-16 82 28 6 213 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q98G43 2.21e-17 87 26 12 342 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98G43 5.2e-14 77 29 6 209 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
O31427 2.77e-17 84 27 5 228 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
O31427 8.91e-14 74 26 5 227 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
P46920 2.97e-17 87 30 4 223 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
P46920 6.9e-09 61 25 5 201 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
Q92WJ0 2.98e-17 86 30 7 210 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q92WJ0 1.76e-13 75 26 5 217 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q9RR46 3.12e-17 87 28 6 227 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q9RR46 2.25e-10 66 27 4 207 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
O70014 3.14e-17 84 27 5 232 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
O70014 2e-08 58 23 7 210 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
Q8X5N2 3.14e-17 84 26 6 248 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q8X5N2 3.42e-08 58 22 7 210 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q8TI16 3.25e-17 85 27 5 222 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TI16 2.08e-10 65 26 4 219 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q4W575 3.49e-17 86 32 6 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4W575 4e-16 83 30 9 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 3.49e-17 86 32 6 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JVH1 4e-16 83 30 9 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q52815 3.68e-17 84 28 5 232 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q52815 1.28e-11 68 23 4 230 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q6D0F3 3.8e-17 84 31 7 203 3 thiQ Thiamine import ATP-binding protein ThiQ Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D0F3 2.64e-09 61 24 6 202 3 thiQ Thiamine import ATP-binding protein ThiQ Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4K681 4.45e-17 86 28 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K681 1.07e-11 70 26 8 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7CJG3 5.27e-17 87 28 7 232 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis
Q7CJG3 3.85e-08 59 25 8 213 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis
Q1C5W7 5.27e-17 87 28 7 232 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C5W7 3.85e-08 59 25 8 213 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q1CJW8 5.27e-17 87 28 7 232 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJW8 3.85e-08 59 25 8 213 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q60AI1 5.27e-17 86 31 7 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q60AI1 4.06e-16 83 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q668L6 5.41e-17 87 28 7 232 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668L6 3.82e-08 59 25 8 213 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
O66646 5.47e-17 83 28 4 221 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
O66646 1.81e-09 61 26 5 211 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
Q8DZJ0 5.47e-17 86 25 6 260 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DZJ0 1.83e-11 69 26 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 5.47e-17 86 25 6 260 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q8E554 1.83e-11 69 26 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 5.47e-17 86 25 6 260 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K0Y6 1.83e-11 69 26 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P46342 5.83e-17 84 29 9 252 3 pstB1 Phosphate import ATP-binding protein PstB 1 Bacillus subtilis (strain 168)
P46342 1.37e-05 50 22 8 219 3 pstB1 Phosphate import ATP-binding protein PstB 1 Bacillus subtilis (strain 168)
Q9TKX3 5.89e-17 85 26 5 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9TKX3 3.38e-15 80 27 7 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9WXX8 6e-17 83 32 9 215 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX8 2.04e-05 49 22 5 199 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P23703 6.08e-17 85 29 6 232 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P23703 1.18e-10 66 23 7 223 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q81GU1 6.11e-17 85 30 7 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GU1 6.57e-12 70 24 4 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A3DDF6 7.59e-17 85 26 6 267 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A3DDF6 1.93e-12 72 29 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q6D2F6 7.97e-17 85 31 6 206 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D2F6 2.24e-12 72 28 9 230 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9MUN1 8.29e-17 85 29 5 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9MUN1 1.88e-15 81 29 8 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
P72335 8.33e-17 84 28 6 242 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P72335 2.39e-11 68 22 4 227 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q8RQL7 8.86e-17 83 27 3 220 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8RQL7 7.53e-14 74 27 5 207 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8A1M1 9.05e-17 82 29 7 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8A1M1 3.32e-10 63 26 7 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q73F11 9.07e-17 85 29 8 236 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73F11 2.73e-10 65 28 7 210 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q52666 9.4e-17 83 28 3 207 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q52666 2.41e-13 73 23 6 243 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q0RYP7 9.5e-17 85 29 6 217 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q0RYP7 5.98e-16 82 28 5 210 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q8UCD5 9.88e-17 85 29 6 213 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UCD5 6.61e-15 79 28 4 206 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
P34712 9.93e-17 87 30 7 222 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P34712 6.29e-08 59 28 5 190 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P34712 5.97e-06 52 24 8 209 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P34712 4.9e-05 50 23 7 207 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
Q7MPC5 1.01e-16 82 28 5 207 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain YJ016)
Q7MPC5 1.87e-07 55 23 4 215 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain YJ016)
Q8DE95 1.01e-16 82 28 5 207 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain CMCP6)
Q8DE95 1.87e-07 55 23 4 215 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain CMCP6)
Q8EAN3 1.02e-16 85 29 11 265 3 modC Molybdenum import ATP-binding protein ModC Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8EAN3 2.53e-13 74 24 6 217 3 modC Molybdenum import ATP-binding protein ModC Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q31DV4 1.03e-16 83 26 8 242 3 phnC Phosphonates import ATP-binding protein PhnC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31DV4 4.68e-10 63 22 5 211 3 phnC Phosphonates import ATP-binding protein PhnC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q9K876 1.05e-16 85 29 8 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K876 2.08e-12 72 27 5 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5X627 1.06e-16 85 31 6 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q5X627 1.47e-13 75 25 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q5ZWE4 1.14e-16 85 29 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZWE4 1.59e-12 72 23 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q2JLH7 1.15e-16 83 28 8 235 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q2JLH7 1.7e-08 59 23 5 221 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8FV85 1.27e-16 85 25 4 233 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8FV85 2.01e-14 78 27 5 209 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 1.27e-16 85 25 4 233 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YD40 2.01e-14 78 27 5 209 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 1.27e-16 85 25 4 233 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q579H8 2.01e-14 78 27 5 209 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 1.27e-16 85 25 4 233 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q2YIV5 2.01e-14 78 27 5 209 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q659V4 1.3e-16 83 27 7 261 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damselae subsp. damselae
Q659V4 1.16e-06 53 21 6 214 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damselae subsp. damselae
Q2K9R2 1.44e-16 82 28 5 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K9R2 2.78e-09 60 25 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8F6Z1 1.58e-16 84 30 6 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8F6Z1 4.07e-10 65 24 4 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 1.58e-16 84 30 6 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q72PE5 4.07e-10 65 24 4 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P33982 1.6e-16 83 27 4 209 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P33982 1.53e-14 77 26 6 242 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q1MIJ4 1.66e-16 82 26 4 224 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MIJ4 5.08e-08 57 25 6 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8DIA0 1.68e-16 84 29 6 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8DIA0 9.53e-13 72 27 6 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q50294 1.7e-16 83 30 8 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q50294 2.5e-13 73 25 4 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q46TK4 1.8e-16 83 26 7 245 3 phnC Phosphonates import ATP-binding protein PhnC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46TK4 3.7e-07 55 21 6 220 3 phnC Phosphonates import ATP-binding protein PhnC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8RGC8 1.85e-16 84 27 5 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8RGC8 4.24e-13 74 26 6 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q81VM2 1.88e-16 84 30 8 236 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q81VM2 2.36e-10 65 28 5 207 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q5LT65 1.98e-16 84 29 5 209 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LT65 2.6e-09 62 27 5 212 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P27675 2.19e-16 82 29 7 218 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
P27675 3.41e-15 78 26 3 222 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q6ME20 2.36e-16 84 31 7 203 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
Q6ME20 9.84e-13 72 27 5 201 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
Q4FMG5 2.48e-16 82 31 6 199 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
Q4FMG5 8.53e-12 68 24 10 246 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
P46903 2.56e-16 82 27 4 205 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
P46903 1.14e-12 71 28 8 226 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
Q9X196 2.65e-16 84 27 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X196 1.63e-12 72 26 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q0I2Z4 2.79e-16 83 25 5 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q0I2Z4 1.08e-12 72 28 8 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
D4GP38 2.83e-16 84 30 7 211 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GP38 1.6e-15 81 25 17 358 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P22731 3.16e-16 81 26 4 221 1 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Escherichia coli (strain K12)
P22731 6.97e-16 80 26 3 206 1 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Escherichia coli (strain K12)
Q7UC29 3.34e-16 83 27 6 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q7UC29 3.41e-09 62 25 6 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q831K6 3.4e-16 83 25 6 257 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q831K6 8.59e-10 63 24 6 216 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q8XBJ8 3.46e-16 83 27 6 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q8XBJ8 4.31e-09 62 25 6 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q73P93 3.47e-16 84 21 16 493 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 2.78e-09 63 23 4 213 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 0.000171 47 23 5 207 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P16676 3.53e-16 83 27 6 212 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
P16676 4.23e-09 62 25 6 219 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q6MCV4 3.58e-16 83 30 5 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q6MCV4 3.35e-11 68 27 7 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q87JM4 3.64e-16 85 27 5 229 3 macB Macrolide export ATP-binding/permease protein MacB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87JM4 3.22e-09 63 24 7 238 3 macB Macrolide export ATP-binding/permease protein MacB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3JSQ0 3.66e-16 82 27 7 257 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q3JSQ0 9.12e-15 78 25 4 210 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 3.66e-16 82 27 7 257 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q62K72 9.12e-15 78 25 4 210 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q63TX3 3.79e-16 82 27 7 257 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q63TX3 8.47e-15 78 25 4 210 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q9PDN2 3.85e-16 83 30 6 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q9PDN2 4.61e-10 64 25 6 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
P45073 4.03e-16 81 25 3 241 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45073 1e-13 74 26 5 207 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q45460 4.2e-16 83 28 10 248 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q45460 1.78e-12 72 27 7 212 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q8FFB3 4.28e-16 83 27 6 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FFB3 4.19e-09 62 25 6 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5WXF0 4.52e-16 83 29 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q5WXF0 2.22e-12 72 23 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q63H29 4.62e-16 82 30 8 236 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q63H29 2.45e-10 65 28 5 207 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
P48243 4.69e-16 81 27 5 230 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P48243 2.84e-14 75 29 5 206 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q88AS5 4.74e-16 82 28 7 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88AS5 3.99e-12 70 25 4 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5LBT4 4.86e-16 84 29 7 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q5LBT4 2.06e-15 82 26 7 277 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q9CM80 4.9e-16 82 25 5 229 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q9CM80 2.87e-13 74 27 7 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q70GD4 4.9e-16 81 26 7 261 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damsela subsp. piscicida
Q70GD4 3.91e-07 55 21 6 214 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damsela subsp. piscicida
Q9I6L0 4.95e-16 82 29 6 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I6L0 1.89e-11 68 25 4 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1J6Q6 5.11e-16 83 26 6 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1J6Q6 1.15e-09 63 25 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 5.11e-16 83 26 6 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JGY7 1.15e-09 63 25 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 5.11e-16 83 26 6 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JLT7 1.15e-09 63 25 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 5.11e-16 83 26 6 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1JBV6 1.15e-09 63 25 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q0K9I2 5.15e-16 82 28 7 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0K9I2 4.32e-10 64 27 4 219 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1LQB5 5.36e-16 81 26 7 245 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LQB5 1.03e-06 53 22 8 247 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5KX47 5.36e-16 81 28 9 239 3 pstB Phosphate import ATP-binding protein PstB Geobacillus kaustophilus (strain HTA426)
Q5KX47 2.12e-06 52 32 1 78 3 pstB Phosphate import ATP-binding protein PstB Geobacillus kaustophilus (strain HTA426)
Q64SQ6 5.41e-16 84 29 7 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q64SQ6 1.9e-15 82 26 7 277 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q5XCA4 5.5e-16 83 26 6 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5XCA4 1.66e-09 63 25 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P47425 5.58e-16 81 28 7 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47425 4.38e-13 73 25 3 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q6D3Q6 5.72e-16 82 27 6 237 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D3Q6 3.07e-15 80 27 8 250 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q92VJ2 5.74e-16 82 27 6 208 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q92VJ2 1.05e-10 67 23 6 218 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
P0CZ35 5.76e-16 83 26 6 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ35 1.63e-09 63 25 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 5.76e-16 83 26 6 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q48TP4 1.63e-09 63 25 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 5.76e-16 83 26 6 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0CZ34 1.63e-09 63 25 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8A883 6.02e-16 83 29 7 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8A883 1.79e-13 75 24 6 272 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q11SW8 6.2e-16 80 28 6 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q11SW8 5.61e-07 53 21 5 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q6XYT0 6.24e-16 81 30 11 251 3 pstB Phosphate import ATP-binding protein PstB Spiroplasma kunkelii
Q6XYT0 9.62e-06 50 23 9 224 3 pstB Phosphate import ATP-binding protein PstB Spiroplasma kunkelii
Q9CNP9 6.32e-16 80 31 6 205 3 thiQ Thiamine import ATP-binding protein ThiQ Pasteurella multocida (strain Pm70)
Q9CNP9 1.14e-11 67 23 4 212 3 thiQ Thiamine import ATP-binding protein ThiQ Pasteurella multocida (strain Pm70)
Q7NQN5 6.48e-16 82 28 6 249 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NQN5 4.1e-11 68 25 5 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q85A69 6.57e-16 82 28 4 218 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q85A69 6.26e-15 80 26 7 212 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
P44531 6.59e-16 82 24 5 229 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44531 1.46e-13 75 28 8 210 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KHT9 6.64e-16 83 30 11 231 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
Q9KHT9 9.56e-16 82 30 7 212 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 6.64e-16 83 30 11 231 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
G2JZ44 9.56e-16 82 30 7 212 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
P23878 6.68e-16 81 26 5 248 1 fepC Ferric enterobactin transport ATP-binding protein FepC Escherichia coli (strain K12)
P23878 7.78e-06 51 20 4 207 1 fepC Ferric enterobactin transport ATP-binding protein FepC Escherichia coli (strain K12)
Q8CUY0 6.83e-16 80 28 7 249 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8CUY0 1.35e-05 50 22 6 216 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q30V33 7.13e-16 82 26 6 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q30V33 2.15e-12 72 26 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q0SFY5 7.41e-16 82 27 5 243 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodococcus jostii (strain RHA1)
Q0SFY5 4.42e-07 55 24 7 215 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodococcus jostii (strain RHA1)
O86751 7.55e-16 82 27 7 212 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O86751 1.86e-09 62 27 7 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q4A5A5 7.68e-16 80 28 9 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasmopsis synoviae (strain 53)
Q4A5A5 1.05e-09 62 24 8 213 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasmopsis synoviae (strain 53)
Q7CN92 7.71e-16 82 26 6 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q7CN92 1.59e-09 63 25 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 7.71e-16 82 26 6 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q99ZS8 1.59e-09 63 25 7 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
D8KFN1 7.76e-16 82 27 8 233 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain NZ9000)
D8KFN1 3.88e-08 58 20 6 224 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain NZ9000)
P0CI33 7.76e-16 82 27 8 233 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain MG1363)
P0CI33 3.88e-08 58 20 6 224 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain MG1363)
Q8DPC2 7.85e-16 82 27 6 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DPC2 2.7e-09 62 25 5 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 7.85e-16 82 27 6 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97Q42 2.7e-09 62 25 5 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 7.85e-16 82 27 6 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q04JW0 2.7e-09 62 25 5 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P44662 7.92e-16 81 28 10 237 3 HI_0361 Probable iron transport system ATP-binding protein HI_0361 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44662 5.08e-10 64 22 5 221 3 HI_0361 Probable iron transport system ATP-binding protein HI_0361 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0SVB6 8.04e-16 80 31 7 211 3 pstB Phosphate import ATP-binding protein PstB Clostridium perfringens (strain SM101 / Type A)
Q0SVB6 7.38e-06 51 25 11 224 3 pstB Phosphate import ATP-binding protein PstB Clostridium perfringens (strain SM101 / Type A)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09175
Feature type CDS
Gene -
Product sugar ABC transporter ATP-binding protein
Location 1920980 - 1922479 (strand: 1)
Length 1500 (nucleotides) / 499 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_16
Orthogroup size 19
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1129 Carbohydrate transport and metabolism (G) G ABC-type sugar transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K17207 putative xylitol transport system ATP-binding protein ABC transporters -

Protein Sequence

MTASVADNDELLRVEGVRKAFGQVVALKNAQFSLKKGSVHALCGGNGAGKSTFLSILMGFIRPDAGEIYVKGKRCEFHQPIEALHAGIAIVQQELSSIPDLTVAENIWLGREPRRFGFVDFKKLNQQTTELLADLHFDISPTEKMRNLSVAEQQLVEIAKALSHADADIIIMDEPTSAIGEEDARKIFDVITRLTEKGKGIIYVSHRLSEIFQIADTFTIFRDGTFITDGPLADINREKLIELIIGREIKDEFAKFNEPTNETIMDIAGLSRDNHVHDISLNLKKGEILGIYGLVGSGRTEFLDLIFGIEHADKGTIHINGQHLDKHSPKDAINAGIAYVTEDRKETGLMLGRSINENINIASFGTISKGGFINDKKEQARSNDMIELFNVKTPDAGQLVGNLSGGNQQKVVLGRWALIEPEVMLLDEPTRGVDVGAKKEIYRFMSEFALQGKGIVMVSSELSEIIGMSDRIIVFRDGRIAGELTAANATQSDLMKLAV

Flanking regions ( +/- flanking 50bp)

TATCAGAATTACCTCACTTTACTGACATCAGAATATCCGGAGGTCACATTATGACGGCATCTGTGGCAGACAATGACGAGTTACTGCGGGTTGAAGGGGTACGCAAGGCCTTTGGGCAGGTTGTGGCACTGAAAAATGCGCAGTTCTCGCTGAAAAAAGGCTCTGTTCACGCCCTGTGCGGCGGGAACGGTGCCGGTAAATCCACCTTTCTCAGCATCCTGATGGGATTTATCCGTCCGGATGCCGGTGAGATTTATGTCAAAGGCAAGCGCTGCGAATTTCATCAGCCGATTGAAGCGCTGCACGCCGGTATTGCTATCGTTCAGCAGGAATTAAGTTCAATTCCTGACCTGACGGTCGCGGAAAATATCTGGCTGGGACGCGAGCCGCGCCGCTTTGGTTTTGTCGATTTCAAAAAGCTGAACCAGCAGACGACTGAATTACTGGCTGATTTGCATTTCGACATCTCCCCGACCGAAAAAATGCGCAATTTGAGTGTGGCCGAGCAGCAACTGGTGGAAATCGCCAAAGCGCTCTCTCATGCCGATGCTGACATCATCATTATGGATGAACCAACCTCCGCCATTGGCGAGGAAGATGCACGGAAGATTTTTGATGTTATCACCCGCCTGACGGAAAAAGGTAAAGGCATTATTTATGTCTCCCACCGCCTGTCCGAGATTTTTCAGATAGCCGATACCTTCACCATTTTTCGTGACGGTACGTTTATCACTGACGGACCGCTGGCAGATATCAACCGTGAGAAGCTGATCGAGCTGATTATCGGGCGTGAAATCAAAGATGAATTTGCCAAATTCAATGAGCCGACGAATGAAACCATTATGGATATCGCAGGGCTTTCCCGCGATAACCATGTGCATGACATCAGTCTGAACCTGAAAAAAGGTGAGATCCTGGGAATTTATGGTCTGGTCGGCTCCGGGCGCACTGAGTTTCTCGATCTGATTTTCGGGATCGAACACGCGGACAAAGGCACCATTCATATTAACGGGCAGCATCTGGATAAACATTCGCCGAAAGACGCTATCAATGCCGGTATCGCCTATGTCACGGAAGATCGCAAAGAAACCGGGCTGATGCTCGGGCGCTCCATTAATGAAAACATTAATATTGCGTCCTTCGGAACCATCAGCAAGGGCGGCTTTATCAATGACAAGAAAGAACAGGCGCGGTCGAATGACATGATTGAGCTGTTCAATGTGAAAACGCCGGATGCCGGGCAATTAGTCGGCAATCTCAGCGGCGGCAACCAGCAGAAAGTGGTTCTCGGGCGCTGGGCGCTGATTGAGCCGGAAGTGATGCTGCTTGATGAGCCGACACGCGGCGTGGATGTCGGCGCCAAAAAAGAAATCTACCGTTTTATGTCCGAATTTGCATTACAGGGCAAAGGTATCGTGATGGTCTCTTCTGAGCTGTCCGAAATTATCGGGATGAGTGATCGCATTATTGTCTTTCGTGACGGGCGGATCGCCGGAGAGCTGACCGCAGCTAATGCCACTCAGTCCGATTTAATGAAACTTGCGGTGTGATGATGCACAGCCGTTCACCCGTCATCGCACGCATGAATAAAGAGAAGTTA