Homologs in group_16

Help

18 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04505 FBDBKF_04505 39.0 Morganella morganii S1 mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
FBDBKF_04700 FBDBKF_04700 40.0 Morganella morganii S1 xylG ABC-type sugar transport system, ATPase component
FBDBKF_15410 FBDBKF_15410 41.2 Morganella morganii S1 rbsA ribose ABC transporter ATP-binding protein RbsA
EHELCC_05795 EHELCC_05795 39.0 Morganella morganii S2 mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
EHELCC_05990 EHELCC_05990 40.0 Morganella morganii S2 xylG ABC-type sugar transport system, ATPase component
EHELCC_15770 EHELCC_15770 41.2 Morganella morganii S2 rbsA ribose ABC transporter ATP-binding protein RbsA
NLDBIP_06115 NLDBIP_06115 39.0 Morganella morganii S4 mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
NLDBIP_06310 NLDBIP_06310 40.0 Morganella morganii S4 xylG ABC-type sugar transport system, ATPase component
NLDBIP_16600 NLDBIP_16600 41.2 Morganella morganii S4 rbsA ribose ABC transporter ATP-binding protein RbsA
LHKJJB_02995 LHKJJB_02995 39.0 Morganella morganii S3 mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
LHKJJB_03190 LHKJJB_03190 40.0 Morganella morganii S3 xylG ABC-type sugar transport system, ATPase component
LHKJJB_16205 LHKJJB_16205 41.2 Morganella morganii S3 rbsA ribose ABC transporter ATP-binding protein RbsA
HKOGLL_06470 HKOGLL_06470 39.0 Morganella morganii S5 mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
HKOGLL_06665 HKOGLL_06665 40.0 Morganella morganii S5 xylG ABC-type sugar transport system, ATPase component
HKOGLL_15975 HKOGLL_15975 41.2 Morganella morganii S5 rbsA ribose ABC transporter ATP-binding protein RbsA
F4V73_RS09175 F4V73_RS09175 41.2 Morganella psychrotolerans - sugar ABC transporter ATP-binding protein
F4V73_RS17735 F4V73_RS17735 41.4 Morganella psychrotolerans rbsA ribose ABC transporter ATP-binding protein RbsA
PMI_RS00440 PMI_RS00440 41.4 Proteus mirabilis HI4320 rbsA ribose ABC transporter ATP-binding protein RbsA

Distribution of the homologs in the orthogroup group_16

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_16

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ENB3 3.11e-150 441 47 2 487 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q02XM9 1.43e-145 429 47 3 487 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. cremoris (strain SK11)
Q9CF44 4.64e-144 425 47 3 487 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. lactis (strain IL1403)
Q3K3R2 2.5e-143 423 45 1 486 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8E281 6.78e-143 422 45 1 486 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7N9 8.34e-143 421 45 1 486 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q65E55 1.19e-142 421 46 4 493 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q13FD9 6.27e-141 417 45 6 484 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q13FD9 7.22e-15 80 25 4 226 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q13FD9 8.07e-12 70 23 5 240 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q21TR5 1.78e-140 416 47 7 483 3 Rfer_3129 Putative ribose/galactose/methyl galactoside import ATP-binding protein Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21TR5 2.77e-13 75 22 4 245 3 Rfer_3129 Putative ribose/galactose/methyl galactoside import ATP-binding protein Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
P36947 1.94e-139 413 45 3 490 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
Q1BQ82 1.71e-138 411 45 5 484 3 Bcen_3328 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia orbicola (strain AU 1054)
Q1BQ82 2.16e-15 82 25 4 239 3 Bcen_3328 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia orbicola (strain AU 1054)
Q1BQ82 6.84e-13 74 23 3 225 3 Bcen_3328 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia orbicola (strain AU 1054)
A0B297 1.71e-138 411 45 5 484 3 Bcen2424_5039 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia cenocepacia (strain HI2424)
A0B297 2.16e-15 82 25 4 239 3 Bcen2424_5039 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia cenocepacia (strain HI2424)
A0B297 6.84e-13 74 23 3 225 3 Bcen2424_5039 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia cenocepacia (strain HI2424)
Q63FX9 3.23e-138 410 46 5 489 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ZK / E33L)
Q6HNE7 3.45e-138 410 46 7 492 3 rbsA Ribose import ATP-binding protein RbsA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81V36 3.45e-138 410 46 7 492 3 rbsA Ribose import ATP-binding protein RbsA Bacillus anthracis
Q73DH7 6.13e-138 409 46 5 489 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q03CA4 1.31e-137 409 44 2 487 3 rbsA Ribose import ATP-binding protein RbsA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q81HW8 1.32e-137 408 46 7 492 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q399X3 9.16e-137 407 44 5 484 3 Bcep18194_B0624 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q399X3 4.25e-15 81 24 5 241 3 Bcep18194_B0624 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q399X3 1.97e-11 69 23 3 220 3 Bcep18194_B0624 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q5KUX3 1.31e-136 405 46 5 489 3 rbsA Ribose import ATP-binding protein RbsA Geobacillus kaustophilus (strain HTA426)
Q5KYQ7 2.29e-136 405 44 3 488 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q5KYQ7 3.22e-11 68 21 4 228 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q0B775 3.21e-135 403 44 5 484 3 Bamb_4447 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B775 2.22e-16 85 25 4 239 3 Bamb_4447 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B775 2.58e-10 66 22 3 225 3 Bamb_4447 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q9X051 1.76e-134 401 46 4 491 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X051 1.39e-16 85 26 5 227 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X051 4.96e-15 80 26 5 236 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9K6J9 2.96e-134 400 44 6 491 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q1AXG5 3.97e-134 399 43 5 485 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q2RGX2 4.75e-134 399 44 8 501 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q9KN37 1.01e-133 399 43 1 486 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KN37 1.92e-18 91 29 4 229 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87H79 2.53e-133 397 43 1 486 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87H79 4.14e-19 93 29 3 225 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KAG5 8.01e-133 397 44 6 492 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KAG5 1.33e-12 73 24 3 250 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8RBQ1 1.67e-132 395 45 5 486 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RBQ1 4.58e-15 80 26 5 225 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD43 7.28e-131 391 43 3 488 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q7MEV1 1.39e-130 390 43 1 486 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q7MEV1 8.86e-18 89 28 4 230 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q664G2 4.22e-130 389 41 5 490 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q664G2 2.38e-19 94 27 4 237 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q5WC31 1.08e-129 388 43 4 489 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q9WXX0 1.53e-129 389 43 8 499 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q7NTN6 1.81e-129 388 43 4 488 3 rbsA Ribose import ATP-binding protein RbsA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q6LH11 3.35e-129 387 42 1 483 3 rbsA Ribose import ATP-binding protein RbsA Photobacterium profundum (strain SS9)
Q6LH11 6.58e-20 95 29 3 231 3 rbsA Ribose import ATP-binding protein RbsA Photobacterium profundum (strain SS9)
Q1CDJ0 3.72e-129 387 41 5 490 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDJ0 2.36e-19 94 27 4 237 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CG00 3.72e-129 387 41 5 490 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q7CG00 2.36e-19 94 27 4 237 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q1C1B8 3.72e-129 387 41 5 490 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C1B8 2.36e-19 94 27 4 237 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
Q5E4V6 3.82e-129 387 42 1 486 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E4V6 8.41e-20 95 28 3 231 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8D7T7 5.3e-129 387 43 1 486 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q8D7T7 7.47e-18 89 28 4 230 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q7UU57 8.18e-129 386 42 3 488 3 rbsA Ribose import ATP-binding protein RbsA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7UU57 2.16e-11 69 25 4 224 3 rbsA Ribose import ATP-binding protein RbsA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7UU57 1.11e-09 64 24 4 225 3 rbsA Ribose import ATP-binding protein RbsA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q3MB44 4.03e-128 385 42 6 494 3 rbsA Ribose import ATP-binding protein RbsA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q11C01 4.13e-128 384 43 7 490 3 rbsA Ribose import ATP-binding protein RbsA Chelativorans sp. (strain BNC1)
Q891M1 4.76e-128 384 42 4 489 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q1R4I3 7.06e-128 384 42 4 489 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain UTI89 / UPEC)
Q1R4I3 1.69e-13 76 25 3 224 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain UTI89 / UPEC)
Q7NA79 1.66e-127 383 43 4 489 3 rbsA Ribose import ATP-binding protein RbsA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7NA79 1.24e-16 85 26 3 230 3 rbsA Ribose import ATP-binding protein RbsA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0SSJ0 1.7e-127 383 42 4 490 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
P04983 2.79e-127 382 42 4 489 1 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain K12)
P04983 1.61e-13 76 25 3 224 1 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain K12)
Q0TAW0 2.79e-127 382 42 4 489 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TAW0 1.61e-13 76 25 3 224 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TPX5 4.7e-127 382 42 4 490 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8U9B0 5.02e-127 381 42 3 487 3 Atu3818 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U9B0 2.96e-13 75 25 3 224 3 Atu3818 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q3YVK8 5.52e-127 381 42 4 489 3 rbsA Ribose import ATP-binding protein RbsA Shigella sonnei (strain Ss046)
Q3YVK8 1.6e-13 76 25 3 224 3 rbsA Ribose import ATP-binding protein RbsA Shigella sonnei (strain Ss046)
Q6DB87 7.16e-127 381 42 4 489 3 rbsA Ribose import ATP-binding protein RbsA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6DB87 6.36e-16 83 26 3 231 3 rbsA Ribose import ATP-binding protein RbsA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8FBS3 8.16e-127 381 42 4 489 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FBS3 1.63e-13 76 25 3 224 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XJX3 1.1e-126 380 42 4 490 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q0BGD7 1.63e-126 380 43 7 486 3 Bamb_1228 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BGD7 3.65e-14 78 27 4 237 3 Bamb_1228 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8XAW7 1.67e-126 380 42 4 489 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Escherichia coli O157:H7
Q8XAW7 1.31e-13 76 25 3 224 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Escherichia coli O157:H7
Q92UI2 3.36e-126 379 44 9 492 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium meliloti (strain 1021)
Q92UI2 7.11e-14 77 25 4 227 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium meliloti (strain 1021)
Q92UI2 1.26e-11 70 24 2 243 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium meliloti (strain 1021)
Q8X5Q4 3.82e-126 379 41 6 491 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Escherichia coli O157:H7
Q1ARR5 5.46e-126 379 41 4 488 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q57HW1 6.25e-126 379 42 4 489 3 rbsA Ribose import ATP-binding protein RbsA Salmonella choleraesuis (strain SC-B67)
Q57HW1 6.49e-13 74 25 3 224 3 rbsA Ribose import ATP-binding protein RbsA Salmonella choleraesuis (strain SC-B67)
Q82CM5 1.08e-125 379 42 4 483 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82CM5 8.81e-14 77 24 3 254 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8ZKV9 1.12e-125 378 42 4 486 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZKV9 6.61e-13 74 25 3 224 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1BGC0 4.7e-125 377 44 6 487 3 Bcen_6474 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia orbicola (strain AU 1054)
Q1BGC0 3.1e-19 94 27 3 236 3 Bcen_6474 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia orbicola (strain AU 1054)
A0KE25 4.7e-125 377 44 6 487 3 Bcen2424_6709 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia cenocepacia (strain HI2424)
A0KE25 3.1e-19 94 27 3 236 3 Bcen2424_6709 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia cenocepacia (strain HI2424)
Q65WJ1 7.95e-125 376 43 7 486 3 araG Arabinose import ATP-binding protein AraG Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65WJ1 2.93e-12 72 27 7 246 3 araG Arabinose import ATP-binding protein AraG Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5PJX5 1.21e-124 375 42 4 489 3 rbsA Ribose import ATP-binding protein RbsA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PJX5 7.82e-13 73 25 3 224 3 rbsA Ribose import ATP-binding protein RbsA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q2SJ99 2.27e-124 375 42 6 481 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q8Z2R4 3.15e-124 374 42 4 486 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhi
Q8Z2R4 2.61e-12 72 25 3 224 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhi
Q1J3P2 4.82e-124 374 40 3 487 3 rbsA Ribose import ATP-binding protein RbsA Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q2SMT0 2.12e-123 373 42 5 483 3 HCH_01167 Putative ribose/galactose/methyl galactoside import ATP-binding protein Hahella chejuensis (strain KCTC 2396)
Q2SMT0 6.41e-10 65 22 7 248 3 HCH_01167 Putative ribose/galactose/methyl galactoside import ATP-binding protein Hahella chejuensis (strain KCTC 2396)
Q28P50 3.91e-123 372 40 2 485 3 rbsA Ribose import ATP-binding protein RbsA Jannaschia sp. (strain CCS1)
Q6VMN4 4.48e-123 372 42 5 497 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q8NR12 5.17e-123 372 41 4 486 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q9RDI1 1.68e-122 370 41 4 483 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q4QN44 4.57e-122 369 41 4 485 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain 86-028NP)
Q4QN44 1.31e-16 85 27 5 226 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain 86-028NP)
P32721 4.75e-122 369 41 7 498 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
P32721 4.53e-11 68 26 7 238 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
Q1BX03 7.88e-122 369 41 5 483 3 Bcen_0943 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia orbicola (strain AU 1054)
Q1BX03 7.07e-08 58 22 4 225 3 Bcen_0943 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia orbicola (strain AU 1054)
A0K6Q0 7.88e-122 369 41 5 483 3 Bcen2424_1425 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia cenocepacia (strain HI2424)
A0K6Q0 7.07e-08 58 22 4 225 3 Bcen2424_1425 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia cenocepacia (strain HI2424)
Q4KDI2 1.33e-121 368 39 2 486 3 PFL_2594 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q87ZE0 1.47e-121 368 40 4 488 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87ZE0 8.14e-12 70 23 3 229 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P44735 1.53e-121 367 41 4 485 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44735 1.85e-14 79 26 5 226 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6D4W8 3.24e-121 367 41 5 486 3 araG Arabinose import ATP-binding protein AraG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4W8 1.89e-12 72 25 5 233 3 araG Arabinose import ATP-binding protein AraG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q329G7 1.23e-120 365 41 8 493 3 rbsA Ribose import ATP-binding protein RbsA Shigella dysenteriae serotype 1 (strain Sd197)
Q8UBN2 1.81e-120 365 42 8 496 3 Atu2819 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6LUY1 1.93e-120 365 39 5 492 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q6LUY1 3.13e-09 62 23 5 242 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q6LUY1 4.18e-07 56 21 5 228 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q1BZA2 2.57e-120 364 41 6 487 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia orbicola (strain AU 1054)
A0K4E8 2.57e-120 364 41 6 487 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia cenocepacia (strain HI2424)
Q2KAW9 3.04e-120 365 40 4 492 3 RHE_CH01212 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8UAK2 3.31e-120 364 41 6 486 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UAK2 2.78e-08 59 23 4 226 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q13LX0 3.96e-120 364 40 4 483 3 rbsA Ribose import ATP-binding protein RbsA Paraburkholderia xenovorans (strain LB400)
Q13LX0 4.78e-15 80 26 5 240 3 rbsA Ribose import ATP-binding protein RbsA Paraburkholderia xenovorans (strain LB400)
Q48GY7 4.06e-120 365 40 4 488 3 PSPPH_3184 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48GY7 2.11e-12 72 24 4 231 3 PSPPH_3184 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9CL63 6.68e-120 364 39 3 487 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q9CP98 7.01e-120 363 40 3 485 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Pasteurella multocida (strain Pm70)
Q9CP98 1.36e-11 70 24 5 237 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Pasteurella multocida (strain Pm70)
Q39HA1 1.31e-119 363 41 5 483 3 Bcep18194_A4569 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39HA1 2.71e-14 78 26 5 240 3 Bcep18194_A4569 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39HA1 2.45e-07 57 21 4 225 3 Bcep18194_A4569 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0S9A4 1.56e-119 362 39 2 487 3 rbsA Ribose import ATP-binding protein RbsA Rhodococcus jostii (strain RHA1)
Q0S9A4 3.7e-13 75 24 3 242 3 rbsA Ribose import ATP-binding protein RbsA Rhodococcus jostii (strain RHA1)
Q92S10 2.05e-119 362 38 2 488 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium meliloti (strain 1021)
Q92S10 3.33e-14 78 25 3 227 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium meliloti (strain 1021)
Q1MAA2 2.17e-119 362 42 5 483 3 RL4654 Putative ribose/galactose/methyl galactoside import ATP-binding protein Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MAA2 1.18e-08 60 22 6 237 3 RL4654 Putative ribose/galactose/methyl galactoside import ATP-binding protein Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8UA86 3.87e-119 362 39 2 487 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0BG60 4.83e-119 362 41 3 480 3 Bamb_1305 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BG60 1.55e-14 79 26 4 239 3 Bamb_1305 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BG60 3.47e-07 56 21 4 225 3 Bamb_1305 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q39JR1 6.73e-119 361 40 6 487 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GY8 8.78e-119 361 39 9 484 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GY8 1.96e-17 88 27 6 236 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q4ZRC6 1.11e-118 361 40 4 488 3 Psyr_3264 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. syringae (strain B728a)
Q4ZRC6 2.45e-12 72 25 4 232 3 Psyr_3264 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. syringae (strain B728a)
Q0BFU0 1.73e-118 360 39 7 482 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BFU0 3.04e-16 84 26 6 236 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q5KYS1 2.57e-118 359 41 10 503 3 xylG Xylose import ATP-binding protein XylG Geobacillus kaustophilus (strain HTA426)
Q1R528 4.48e-118 359 40 8 494 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q1R528 4.9e-08 58 24 6 229 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q31V51 4.83e-118 359 40 8 494 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q31V51 4.99e-08 58 24 6 229 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q8XDM1 4.83e-118 359 40 8 494 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q8XDM1 4.99e-08 58 24 6 229 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q8Y003 5.56e-118 359 41 5 483 3 RSc1242 Putative ribose/galactose/methyl galactoside import ATP-binding protein Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8Y003 7.23e-07 55 21 4 225 3 RSc1242 Putative ribose/galactose/methyl galactoside import ATP-binding protein Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8CK44 6.93e-118 358 38 4 485 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q0SY86 7.05e-118 358 40 8 494 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q0SY86 8.29e-08 58 23 6 229 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q2K353 7.85e-118 358 41 5 483 3 RHE_CH03989 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K353 1.2e-07 57 22 5 227 3 RHE_CH03989 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1M5X4 9.66e-118 358 40 4 488 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1BWN5 1.31e-117 358 39 9 484 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia orbicola (strain AU 1054)
Q1BWN5 1.67e-16 85 26 5 233 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia orbicola (strain AU 1054)
A0K718 1.31e-117 358 39 9 484 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia cenocepacia (strain HI2424)
A0K718 1.67e-16 85 26 5 233 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia cenocepacia (strain HI2424)
P37388 1.33e-117 358 40 8 494 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
P37388 1.7e-07 57 23 6 229 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
Q825P1 1.81e-117 357 38 4 485 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q13RB6 4.36e-117 357 40 5 493 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
Q13RB6 1.82e-08 60 23 4 233 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
Q0BIE1 6.1e-117 356 40 6 487 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8FCE2 6.52e-117 356 40 8 494 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCE2 4.86e-08 58 24 6 229 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBN5 6.52e-117 356 40 8 494 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBN5 4.86e-08 58 24 6 229 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q6LK34 1.37e-116 355 41 7 491 3 mglA1 Galactose/methyl galactoside import ATP-binding protein MglA 1 Photobacterium profundum (strain SS9)
Q6LK34 9.99e-08 58 18 4 237 3 mglA1 Galactose/methyl galactoside import ATP-binding protein MglA 1 Photobacterium profundum (strain SS9)
Q83J33 2.6e-116 354 40 8 494 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q83J33 4.22e-07 56 23 6 228 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q398W2 1.52e-115 352 41 6 474 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q398W2 1.99e-10 66 23 6 234 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q92TS8 2.38e-115 352 40 5 483 3 RB1420 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium meliloti (strain 1021)
Q92TS8 1.04e-12 73 26 5 222 3 RB1420 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium meliloti (strain 1021)
Q92TS8 1.8e-09 63 22 5 227 3 RB1420 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium meliloti (strain 1021)
Q8U949 2.44e-115 352 40 5 488 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U949 3.69e-10 65 26 6 224 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2SZC2 2.48e-115 352 40 6 487 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q1AVD3 3.14e-115 352 39 3 489 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q4ZTW1 4.36e-115 351 41 6 484 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. syringae (strain B728a)
Q4ZTW1 4.08e-15 81 26 5 226 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. syringae (strain B728a)
Q1BG93 4.48e-115 352 39 6 493 3 xylG Xylose import ATP-binding protein XylG Burkholderia orbicola (strain AU 1054)
Q1BG93 2.61e-08 60 23 5 233 3 xylG Xylose import ATP-binding protein XylG Burkholderia orbicola (strain AU 1054)
A0KE53 4.48e-115 352 39 6 493 3 xylG Xylose import ATP-binding protein XylG Burkholderia cenocepacia (strain HI2424)
A0KE53 2.61e-08 60 23 5 233 3 xylG Xylose import ATP-binding protein XylG Burkholderia cenocepacia (strain HI2424)
Q663Y5 5.38e-115 351 39 8 494 3 xylG Xylose import ATP-binding protein XylG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q663Y5 8.39e-09 61 23 5 228 3 xylG Xylose import ATP-binding protein XylG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CDC0 5.38e-115 351 39 8 494 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDC0 8.39e-09 61 23 5 228 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CFR2 5.38e-115 351 39 8 494 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis
Q7CFR2 8.39e-09 61 23 5 228 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis
Q1C0D5 5.38e-115 351 39 8 494 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C0D5 8.39e-09 61 23 5 228 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Antiqua)
Q1GHE5 9.1e-115 350 38 5 493 3 rbsA Ribose import ATP-binding protein RbsA Ruegeria sp. (strain TM1040)
Q3JHZ1 9.38e-115 350 38 9 499 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia pseudomallei (strain 1710b)
Q32HC7 1.13e-114 350 40 7 485 3 araG Arabinose import ATP-binding protein AraG Shigella dysenteriae serotype 1 (strain Sd197)
Q0B1U4 1.58e-114 350 39 4 493 3 xylG Xylose import ATP-binding protein XylG Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B1U4 9.96e-08 58 23 5 233 3 xylG Xylose import ATP-binding protein XylG Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1RAN8 1.66e-114 349 40 7 485 3 araG Arabinose import ATP-binding protein AraG Escherichia coli (strain UTI89 / UPEC)
Q0TGT7 1.75e-114 349 40 7 485 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q882I8 1.83e-114 349 40 6 484 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q882I8 8.71e-16 83 27 5 226 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q322L1 1.95e-114 349 40 7 485 3 araG Arabinose import ATP-binding protein AraG Shigella boydii serotype 4 (strain Sb227)
Q8XPK6 2.08e-114 350 39 6 493 3 xylG Xylose import ATP-binding protein XylG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XPK6 2.31e-05 50 21 5 233 3 xylG Xylose import ATP-binding protein XylG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q48IS7 2.37e-114 349 40 6 484 3 araG Arabinose import ATP-binding protein AraG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48IS7 1.25e-14 79 26 5 226 3 araG Arabinose import ATP-binding protein AraG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q63P06 2.79e-114 349 38 9 499 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia pseudomallei (strain K96243)
Q3JNJ9 3.65e-114 348 39 6 487 3 araG Arabinose import ATP-binding protein AraG Burkholderia pseudomallei (strain 1710b)
P0AAF3 4.57e-114 348 40 7 485 1 araG Arabinose import ATP-binding protein AraG Escherichia coli (strain K12)
P0AAF4 4.57e-114 348 40 7 485 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF5 4.57e-114 348 40 7 485 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O157:H7
Q62GY9 5.1e-114 348 39 6 487 3 araG Arabinose import ATP-binding protein AraG Burkholderia mallei (strain ATCC 23344)
Q2K0S7 5.83e-114 348 38 3 489 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6DB03 5.86e-114 348 39 7 497 3 xylG Xylose import ATP-binding protein XylG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6DB03 3.57e-07 56 21 5 228 3 xylG Xylose import ATP-binding protein XylG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P45046 6.33e-114 348 39 8 503 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45046 2.74e-12 72 28 7 229 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2T8T6 1.15e-113 348 39 7 480 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T8T6 5.94e-14 77 27 4 225 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q164K3 1.2e-113 347 38 2 488 3 rbsA Ribose import ATP-binding protein RbsA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q3Z2S7 1.82e-113 347 40 7 485 3 araG Arabinose import ATP-binding protein AraG Shigella sonnei (strain Ss046)
Q9CM08 3.11e-113 346 39 4 487 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Pasteurella multocida (strain Pm70)
Q9CM08 1.11e-07 57 21 7 247 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Pasteurella multocida (strain Pm70)
Q13U53 3.45e-113 347 39 6 487 3 araG Arabinose import ATP-binding protein AraG Paraburkholderia xenovorans (strain LB400)
Q63QQ7 5.54e-113 345 39 6 487 3 araG Arabinose import ATP-binding protein AraG Burkholderia pseudomallei (strain K96243)
Q83KP2 9.18e-113 345 40 7 485 3 araG Arabinose import ATP-binding protein AraG Shigella flexneri
Q0I348 2.15e-112 344 39 6 493 3 xylG Xylose import ATP-binding protein XylG Histophilus somni (strain 129Pt)
Q0I348 7.53e-11 67 24 4 224 3 xylG Xylose import ATP-binding protein XylG Histophilus somni (strain 129Pt)
Q66AF5 2.61e-112 344 41 6 482 3 araG Arabinose import ATP-binding protein AraG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AF5 1.73e-11 70 23 2 236 3 araG Arabinose import ATP-binding protein AraG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CIX6 2.61e-112 344 41 6 482 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CIX6 1.73e-11 70 23 2 236 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WER5 2.61e-112 344 41 6 482 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis
Q0WER5 1.73e-11 70 23 2 236 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis
Q1C7J0 2.61e-112 344 41 6 482 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C7J0 1.73e-11 70 23 2 236 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis bv. Antiqua (strain Antiqua)
Q2T4S8 2.98e-112 344 38 7 490 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4S8 4.7e-11 68 24 3 224 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9S472 5.39e-112 343 38 5 498 3 araG L-arabinose transport ATP-binding protein AraG Geobacillus stearothermophilus
Q1BJW2 5.72e-112 343 39 5 483 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
Q1BJW2 8.95e-12 70 25 6 230 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
A0B3Z7 5.72e-112 343 39 5 483 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
A0B3Z7 8.95e-12 70 25 6 230 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
Q1MBG4 7.65e-112 342 40 7 484 3 araG Arabinose import ATP-binding protein AraG Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q73KK2 8.16e-112 342 39 5 487 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q92W60 1.81e-111 342 37 4 491 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q2NUD6 2.54e-111 341 39 6 488 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Sodalis glossinidius (strain morsitans)
Q2NUD6 1.55e-09 63 22 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Sodalis glossinidius (strain morsitans)
Q39BJ8 2.86e-111 342 38 5 486 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39BJ8 8.23e-12 70 24 3 224 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q896Y2 3.27e-111 341 39 4 488 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium tetani (strain Massachusetts / E88)
Q896Y2 1.75e-07 57 26 6 226 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium tetani (strain Massachusetts / E88)
Q896Y2 2.01e-06 53 21 5 228 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium tetani (strain Massachusetts / E88)
Q88J90 3.42e-111 341 37 4 489 3 rbsA Ribose import ATP-binding protein RbsA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0B5V4 4.39e-111 341 38 5 483 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B5V4 1.92e-12 72 25 4 225 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1JUP7 5.2e-111 341 38 5 488 3 araG Arabinose import ATP-binding protein AraG Azospirillum brasilense
Q1JUP7 3.36e-11 68 24 3 224 3 araG Arabinose import ATP-binding protein AraG Azospirillum brasilense
Q2SW38 7.78e-111 340 38 5 493 3 xylG Xylose import ATP-binding protein XylG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SW38 2.45e-09 63 23 5 233 3 xylG Xylose import ATP-binding protein XylG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q1BPL3 8.77e-111 340 41 7 476 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia orbicola (strain AU 1054)
Q1BPL3 4.24e-10 65 25 6 231 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia orbicola (strain AU 1054)
A0B1M7 8.77e-111 340 41 7 476 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia cenocepacia (strain HI2424)
A0B1M7 4.24e-10 65 25 6 231 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia cenocepacia (strain HI2424)
Q2K3Y7 8.97e-111 340 39 5 484 3 araG Arabinose import ATP-binding protein AraG Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q65UW1 3.38e-110 338 39 5 488 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65UW1 4.97e-09 62 21 5 231 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q87FK7 3.38e-110 338 39 7 490 3 araG Arabinose import ATP-binding protein AraG Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q4ZSF3 1.05e-109 338 38 5 493 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. syringae (strain B728a)
Q4ZSF3 1.71e-06 54 23 4 230 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. syringae (strain B728a)
Q0B7X0 1.09e-109 337 40 6 475 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B7X0 6.82e-10 64 24 4 229 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q92MP8 2.43e-109 336 40 3 482 3 R02565 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium meliloti (strain 1021)
Q92MP8 5.77e-09 62 25 7 242 3 R02565 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium meliloti (strain 1021)
Q92MP8 4.61e-07 55 24 4 238 3 R02565 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium meliloti (strain 1021)
Q2SVU4 4.59e-109 335 41 7 472 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVU4 7.29e-11 67 26 5 225 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q92W56 5.42e-109 335 38 5 484 3 araG Arabinose import ATP-binding protein AraG Rhizobium meliloti (strain 1021)
P44884 5.51e-109 335 38 6 490 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44884 3.83e-08 59 22 7 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QM77 5.51e-109 335 38 6 490 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain 86-028NP)
Q4QM77 3.83e-08 59 22 7 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain 86-028NP)
Q8REE1 7.73e-109 335 39 5 488 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8REE1 5.66e-09 62 19 7 234 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q576H3 8.46e-109 335 37 6 498 3 xylG Xylose import ATP-binding protein XylG Brucella abortus biovar 1 (strain 9-941)
Q576H3 1.39e-09 63 22 4 229 3 xylG Xylose import ATP-binding protein XylG Brucella abortus biovar 1 (strain 9-941)
Q2YJE7 8.46e-109 335 37 6 498 3 xylG Xylose import ATP-binding protein XylG Brucella abortus (strain 2308)
Q2YJE7 1.39e-09 63 22 4 229 3 xylG Xylose import ATP-binding protein XylG Brucella abortus (strain 2308)
Q8XKQ2 4.03e-108 333 39 8 489 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
Q8XKQ2 2.53e-13 75 23 5 231 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
Q8YDN0 5.4e-108 333 36 6 498 3 xylG Xylose import ATP-binding protein XylG Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YDN0 1.39e-09 63 22 4 229 3 xylG Xylose import ATP-binding protein XylG Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q3K8M7 9.57e-108 332 39 7 491 3 araG Arabinose import ATP-binding protein AraG Pseudomonas fluorescens (strain Pf0-1)
Q3K8M7 1.17e-09 64 25 6 226 3 araG Arabinose import ATP-binding protein AraG Pseudomonas fluorescens (strain Pf0-1)
Q0TQU8 1.09e-107 332 39 8 489 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TQU8 2.94e-13 75 23 5 231 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q9K7C3 1.89e-107 332 38 7 500 3 araG L-arabinose transport ATP-binding protein AraG Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8FUR8 6.09e-107 330 36 6 498 3 xylG Xylose import ATP-binding protein XylG Brucella suis biovar 1 (strain 1330)
Q8FUR8 4.97e-10 65 23 4 229 3 xylG Xylose import ATP-binding protein XylG Brucella suis biovar 1 (strain 1330)
Q880Z2 1.34e-106 330 37 5 493 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q880Z2 3.44e-05 50 23 4 225 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3KDW2 2.44e-106 329 37 5 493 3 xylG Xylose import ATP-binding protein XylG Pseudomonas fluorescens (strain Pf0-1)
Q3KDW2 5.56e-07 55 24 5 230 3 xylG Xylose import ATP-binding protein XylG Pseudomonas fluorescens (strain Pf0-1)
Q0ST95 6.71e-106 328 39 8 489 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain SM101 / Type A)
Q0ST95 1.61e-12 73 23 5 231 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain SM101 / Type A)
Q48J74 1.75e-105 327 37 5 493 3 xylG Xylose import ATP-binding protein XylG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48J74 6.07e-07 55 24 5 230 3 xylG Xylose import ATP-binding protein XylG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6LG59 1.78e-105 326 38 5 488 3 mglA2 Galactose/methyl galactoside import ATP-binding protein MglA 2 Photobacterium profundum (strain SS9)
Q6LG59 9.71e-09 61 23 4 225 3 mglA2 Galactose/methyl galactoside import ATP-binding protein MglA 2 Photobacterium profundum (strain SS9)
Q8XVS2 2.5e-105 326 38 7 490 3 araG Arabinose import ATP-binding protein AraG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P23924 2.59e-105 326 38 5 488 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23924 2.06e-10 66 24 4 225 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56342 4.38e-105 325 37 5 487 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema pallidum (strain Nichols)
Q56342 2.27e-10 66 22 8 243 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema pallidum (strain Nichols)
Q66C83 2.31e-104 323 37 5 487 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66C83 2.2e-09 63 22 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGT1 2.31e-104 323 37 5 487 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CGT1 2.2e-09 63 22 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CHQ3 2.31e-104 323 37 5 487 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis
Q7CHQ3 2.2e-09 63 22 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis
Q1C9V1 2.31e-104 323 37 5 487 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C9V1 2.2e-09 63 22 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Antiqua)
Q8D4H4 3.12e-104 323 38 6 489 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain CMCP6)
Q8D4H4 1.45e-08 60 22 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain CMCP6)
Q7MG07 3.19e-104 323 38 5 488 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain YJ016)
Q7MG07 1.4e-08 60 22 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain YJ016)
Q1QYT1 4.77e-104 322 38 8 482 3 araG Arabinose import ATP-binding protein AraG Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8X5D9 5.34e-104 322 38 5 489 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O157:H7
Q8X5D9 2.55e-09 63 23 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O157:H7
Q8FFU7 6.41e-104 322 38 5 489 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FFU7 2.48e-09 63 23 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFU2 6.41e-104 322 38 5 489 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TFU2 2.48e-09 63 23 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8G847 8.12e-104 322 36 7 488 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q8G847 6.39e-17 87 25 3 225 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q1R9S4 1.62e-103 321 38 5 489 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain UTI89 / UPEC)
Q1R9S4 3.95e-09 62 23 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain UTI89 / UPEC)
Q3Z057 2.28e-103 321 38 5 489 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella sonnei (strain Ss046)
Q3Z057 2.36e-09 63 23 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella sonnei (strain Ss046)
P0AAG9 2.28e-103 321 38 5 489 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri
P0AAG9 2.36e-09 63 23 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri
P0AAG8 2.28e-103 321 38 5 489 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain K12)
P0AAG8 2.36e-09 63 23 4 225 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain K12)
Q0T2X5 2.31e-103 321 38 5 489 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri serotype 5b (strain 8401)
Q0T2X5 2.57e-09 63 23 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri serotype 5b (strain 8401)
Q1M360 6.2e-103 320 37 5 492 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q31YV7 1.29e-102 319 37 5 488 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella boydii serotype 4 (strain Sb227)
Q31YV7 2.2e-09 63 23 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella boydii serotype 4 (strain Sb227)
Q9KSD1 2.31e-102 318 38 5 488 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KSD1 1.66e-07 57 21 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P63299 9.72e-102 317 37 5 483 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
P63299 2.32e-12 72 27 8 234 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
Q987E7 2.11e-101 316 37 3 487 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q987E7 6.12e-12 71 22 4 229 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6BEX0 4.06e-101 315 38 7 484 1 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli (strain K12)
Q6BEX0 2.38e-12 72 27 8 234 1 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli (strain K12)
Q2K204 1.25e-100 314 39 6 492 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q62K91 1.54e-100 313 41 7 472 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia mallei (strain ATCC 23344)
Q62K91 5.06e-10 65 25 6 225 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia mallei (strain ATCC 23344)
Q3JSI8 2.94e-96 312 41 7 472 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia pseudomallei (strain 1710b)
Q3JSI8 6.37e-09 62 25 6 225 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia pseudomallei (strain 1710b)
A4TQL5 3.05e-96 303 36 5 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis (strain Pestoides F)
A4TQL5 2.48e-11 69 26 6 235 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis (strain Pestoides F)
Q1CN15 3.05e-96 303 36 5 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CN15 2.48e-11 69 26 6 235 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R074 3.05e-96 303 36 5 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Angola)
A9R074 2.48e-11 69 26 6 235 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Angola)
Q0WJP9 3.05e-96 303 36 5 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis
Q0WJP9 2.48e-11 69 26 6 235 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis
Q1C138 3.05e-96 303 36 5 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C138 2.48e-11 69 26 6 235 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Antiqua)
B1JLQ0 5.5e-95 300 36 5 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
B1JLQ0 8.89e-11 67 25 6 243 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EY9 1.13e-94 299 36 5 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66EY9 7.39e-11 68 25 6 243 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3G1 1.13e-94 299 36 5 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B2K3G1 7.39e-11 68 25 6 243 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FMJ7 1.27e-94 299 36 5 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A7FMJ7 8.51e-11 67 25 6 243 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A6TEB8 2.27e-94 297 37 10 509 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4WER4 1.31e-93 295 37 7 502 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Enterobacter sp. (strain 638)
A1JJ55 4.94e-93 295 35 7 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P77509 2.44e-92 292 36 9 473 3 yphE Uncharacterized ABC transporter ATP-binding protein YphE Escherichia coli (strain K12)
P77509 1.09e-16 86 27 3 212 3 yphE Uncharacterized ABC transporter ATP-binding protein YphE Escherichia coli (strain K12)
P77509 8.64e-12 70 26 9 233 3 yphE Uncharacterized ABC transporter ATP-binding protein YphE Escherichia coli (strain K12)
A8A066 1.04e-91 291 36 9 496 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli O9:H4 (strain HS)
B1IRU7 4.77e-91 289 36 9 496 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q3J3V9 4.81e-91 289 33 6 475 3 rbsA Ribose import ATP-binding protein RbsA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3J3V9 3.91e-07 56 23 4 223 3 rbsA Ribose import ATP-binding protein RbsA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P77257 9.46e-91 288 36 9 496 1 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain K12)
B1XEA1 9.46e-91 288 36 9 496 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain K12 / DH10B)
Q8Z2X5 1.55e-90 288 36 7 499 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella typhi
Q2PBM0 2.18e-90 288 35 6 497 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus luminescens
P0C886 2.97e-90 287 36 7 499 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella choleraesuis (strain SC-B67)
Q8XAY7 3.14e-90 287 36 10 496 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli O157:H7
B1LFA2 4.81e-90 286 36 9 496 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain SMS-3-5 / SECEC)
Q7N2D9 6.42e-90 286 35 9 500 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0T4L9 9.04e-90 286 36 10 496 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Shigella flexneri serotype 5b (strain 8401)
Q8ZKQ4 9.14e-90 286 35 7 499 1 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MZG1 9.64e-90 286 35 7 499 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJE7 9.64e-90 286 35 7 499 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q83L12 4.08e-89 284 36 10 496 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Shigella flexneri
Q2PBM3 3.18e-87 280 34 5 495 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus temperata
Q1MHS1 4.82e-87 279 33 6 487 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q98K15 3.43e-83 269 33 7 503 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2K9A3 7.58e-82 265 34 6 487 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A2RKA7 9.82e-76 249 32 8 503 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
A2RKA7 7.2e-16 83 27 3 230 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
D4GPW3 1.95e-75 249 31 7 523 3 tsgD13 Glucose import ATP-binding protein TsgD13 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
O05253 4.38e-74 245 31 6 494 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
P55570 4.9e-72 239 34 12 489 3 NGR_a02480 Uncharacterized ABC transporter ATP-binding protein y4mK Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A7ZLX1 5.56e-55 190 38 5 303 5 lsrA Putative autoinducer 2 import ATP-binding protein LsrA homolog Escherichia coli O139:H28 (strain E24377A / ETEC)
A7ZLX1 4.37e-08 58 23 5 209 5 lsrA Putative autoinducer 2 import ATP-binding protein LsrA homolog Escherichia coli O139:H28 (strain E24377A / ETEC)
P75516 8.72e-41 157 35 4 273 3 MPN_258 Putative carbohydrate transport ATP-binding protein MPN_258 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75516 1.85e-21 100 29 5 222 3 MPN_258 Putative carbohydrate transport ATP-binding protein MPN_258 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75516 2.9e-14 79 27 8 255 3 MPN_258 Putative carbohydrate transport ATP-binding protein MPN_258 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47365 1.17e-38 151 34 4 284 3 MG119 Putative carbohydrate transport ATP-binding protein MG119 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47365 3.54e-20 97 31 5 211 3 MG119 Putative carbohydrate transport ATP-binding protein MG119 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47365 5.13e-14 78 29 5 225 3 MG119 Putative carbohydrate transport ATP-binding protein MG119 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8G838 1.11e-31 132 25 18 515 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8G838 1.41e-15 83 28 6 209 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8G838 3.74e-07 56 25 5 211 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q9F9B0 8.38e-31 123 32 4 240 1 frcA Fructose import ATP-binding protein FrcA Rhizobium meliloti
Q9F9B0 3.8e-16 81 27 3 232 1 frcA Fructose import ATP-binding protein FrcA Rhizobium meliloti
P0DTT6 1.61e-29 119 37 7 232 1 xylG Xylose/arabinose import ATP-binding protein XylG Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P0DTT6 6.4e-13 72 24 3 220 1 xylG Xylose/arabinose import ATP-binding protein XylG Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q44848 1.74e-27 118 26 13 500 3 BB_0318 Uncharacterized ABC transporter ATP-binding protein BB_0318 Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q73P93 3.25e-26 114 23 16 491 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 5.06e-05 49 20 5 233 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q2JLH7 7.53e-26 109 33 4 219 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q2JLH7 5.95e-08 57 25 6 209 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q9CN78 1.72e-25 107 30 6 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q9CN78 1.19e-09 62 25 7 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
P94440 2.38e-25 109 28 6 281 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 8.17e-09 60 24 6 222 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q8XK20 9.38e-25 110 25 17 529 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 9.02e-15 80 28 6 220 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
O83321 1.77e-24 110 21 16 523 1 rfuB Probable riboflavin import ATP-binding protein RfuB Treponema pallidum (strain Nichols)
Q609Q1 2.89e-24 107 30 2 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q609Q1 4.12e-07 55 25 8 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P45247 2.5e-23 101 29 5 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45247 2.26e-08 58 24 6 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QKQ9 2.5e-23 101 29 5 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
Q4QKQ9 2.26e-08 58 24 6 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
Q32EX7 2.7e-23 101 28 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q32EX7 2.72e-11 67 24 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q8XED0 2.89e-23 106 32 4 205 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli O157:H7
Q8XED0 7.56e-08 58 23 7 228 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli O157:H7
Q11SW8 3.73e-23 100 31 4 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q11SW8 3.68e-09 60 26 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q1RE44 4.12e-23 106 32 4 205 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli (strain UTI89 / UPEC)
Q1RE44 9.52e-09 61 24 7 228 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli (strain UTI89 / UPEC)
Q0TJH0 4.12e-23 106 32 4 205 1 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TJH0 9.77e-09 61 24 7 228 1 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A9B7 4.12e-23 106 32 4 205 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Escherichia coli O1:K1 / APEC
A1A9B7 9.52e-09 61 24 7 228 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Escherichia coli O1:K1 / APEC
P75831 4.35e-23 106 32 4 205 1 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli (strain K12)
P75831 1.28e-08 61 24 7 228 1 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli (strain K12)
P75957 4.46e-23 100 28 5 212 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
P75957 4.87e-11 66 24 7 231 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q7VMV4 4.55e-23 100 30 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7VMV4 0.000878 44 22 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q83LR7 4.55e-23 106 32 4 205 3 macB Macrolide export ATP-binding/permease protein MacB Shigella flexneri
Q83LR7 1.36e-09 64 24 7 228 3 macB Macrolide export ATP-binding/permease protein MacB Shigella flexneri
Q3Z3Q4 4.59e-23 106 32 4 205 3 macB Macrolide export ATP-binding/permease protein MacB Shigella sonnei (strain Ss046)
Q3Z3Q4 2.59e-08 60 24 7 219 3 macB Macrolide export ATP-binding/permease protein MacB Shigella sonnei (strain Ss046)
Q8NQU4 4.96e-23 101 29 4 227 1 argV Arginine transport ATP-binding protein ArgV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NQU4 1.11e-08 59 25 7 216 1 argV Arginine transport ATP-binding protein ArgV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q0BZD8 9.15e-23 100 28 4 207 3 phnC Phosphonates import ATP-binding protein PhnC Hyphomonas neptunium (strain ATCC 15444)
Q0BZD8 5.78e-09 60 27 7 213 3 phnC Phosphonates import ATP-binding protein PhnC Hyphomonas neptunium (strain ATCC 15444)
Q8GNH6 9.76e-23 102 30 4 214 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q8GNH6 3.06e-11 68 25 5 209 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q323M3 9.92e-23 105 32 4 205 3 macB Macrolide export ATP-binding/permease protein MacB Shigella boydii serotype 4 (strain Sb227)
Q323M3 1.53e-07 57 23 7 228 3 macB Macrolide export ATP-binding/permease protein MacB Shigella boydii serotype 4 (strain Sb227)
O34362 1.23e-22 104 24 15 494 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 3.48e-17 87 28 4 203 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q32DZ9 1.34e-22 104 32 4 205 3 macB Macrolide export ATP-binding/permease protein MacB Shigella dysenteriae serotype 1 (strain Sd197)
Q32DZ9 5.63e-08 58 23 7 228 3 macB Macrolide export ATP-binding/permease protein MacB Shigella dysenteriae serotype 1 (strain Sd197)
Q31ZH4 1.78e-22 99 28 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q31ZH4 1.53e-10 64 26 9 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q8TQW9 1.98e-22 103 22 11 474 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQW9 3.82e-09 62 23 6 214 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q897I2 2.7e-22 102 25 12 391 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 5.88e-15 80 34 5 183 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 3.34e-06 53 26 1 97 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q3Z300 2.79e-22 98 28 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q3Z300 3.92e-11 66 25 8 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 2.79e-22 98 28 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q1RD37 3.92e-11 66 25 8 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 2.79e-22 98 28 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FIM7 3.92e-11 66 25 8 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 2.79e-22 98 28 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TIV6 3.92e-11 66 25 8 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8ES39 2.82e-22 103 23 10 472 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ES39 2.91e-08 59 23 4 213 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ES39 6.32e-05 49 19 6 221 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q58663 2.97e-22 99 32 6 221 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58663 3.33e-05 48 24 6 213 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q83RS0 3.14e-22 98 28 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
Q83RS0 4.76e-10 63 26 9 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
P61482 3.6e-22 98 28 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61482 1.29e-10 65 24 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 3.6e-22 98 28 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
P61481 1.29e-10 65 24 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 3.6e-22 98 28 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGR6 1.29e-10 65 24 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
O52618 4.61e-22 100 29 4 211 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
O52618 8.81e-12 69 24 5 226 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q57QD7 5.92e-22 97 27 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q57QD7 8.47e-11 65 25 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
P27675 6.83e-22 97 29 2 211 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
P27675 1.48e-16 82 27 5 209 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
O34392 8.63e-22 97 34 6 227 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
O34392 1.99e-08 58 26 6 190 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
O34979 1.11e-21 97 30 5 220 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
O34979 2.79e-11 66 25 5 211 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
Q7MU65 1.41e-21 96 31 5 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q7MU65 3.49e-07 54 22 4 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q8X8E3 1.62e-21 96 28 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q8X8E3 1.71e-10 64 25 8 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q8PNN4 2.06e-21 98 27 6 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q8PNN4 1.86e-08 59 25 6 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q6D664 2.26e-21 96 27 5 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D664 7.33e-08 56 24 7 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5LI72 2.34e-21 95 31 5 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q5LI72 2.47e-06 52 27 9 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q39GT7 2.59e-21 97 26 4 214 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GT7 1.68e-09 62 22 3 210 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0I3C2 2.63e-21 95 29 5 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q0I3C2 1.9e-10 64 25 6 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q8NR42 2.86e-21 96 28 5 215 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NR42 1.21e-05 50 25 8 208 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q73R11 3.56e-21 99 22 17 511 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P54537 3.57e-21 95 30 7 240 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
P54537 1.59e-11 67 25 6 211 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q8A1M1 3.84e-21 95 30 4 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8A1M1 4.99e-06 51 25 7 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q64Z80 4.09e-21 95 31 5 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain YCH46)
Q64Z80 2.21e-06 52 27 9 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain YCH46)
P0A9V4 4.93e-21 95 27 1 209 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V4 1.07e-09 62 26 6 226 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V1 4.93e-21 95 27 1 209 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V1 1.07e-09 62 26 6 226 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V2 4.93e-21 95 27 1 209 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V2 1.07e-09 62 26 6 226 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V3 4.93e-21 95 27 1 209 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
P0A9V3 1.07e-09 62 26 6 226 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
Q6D201 5.09e-21 97 28 2 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D201 1.36e-07 57 27 8 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q01937 7.96e-21 97 31 4 226 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q01937 3.17e-09 62 23 7 220 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q65TB7 9e-21 94 29 5 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65TB7 7.65e-10 62 26 8 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P23703 1.05e-20 96 27 4 211 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P23703 4.11e-12 70 26 6 209 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q20ZS6 1.08e-20 94 29 7 222 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopseudomonas palustris (strain BisB18)
Q20ZS6 2.35e-07 55 24 7 212 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopseudomonas palustris (strain BisB18)
Q8F6L8 1.14e-20 94 29 3 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8F6L8 2.37e-05 49 22 6 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P0A9U0 1.15e-20 94 30 5 205 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Shigella flexneri
P0A9U0 4.49e-09 60 26 8 208 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Shigella flexneri
P0A9T8 1.15e-20 94 30 5 205 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli (strain K12)
P0A9T8 4.49e-09 60 26 8 208 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli (strain K12)
P0A9T9 1.15e-20 94 30 5 205 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli O157:H7
P0A9T9 4.49e-09 60 26 8 208 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli O157:H7
Q97KD5 1.15e-20 95 30 4 215 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KD5 8e-10 63 25 6 209 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P72335 1.23e-20 95 27 3 209 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P72335 2.12e-10 65 24 8 231 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q72PP0 1.26e-20 94 29 3 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q72PP0 2.02e-05 49 22 7 243 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q87DT9 1.34e-20 96 27 4 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87DT9 2.67e-08 59 26 7 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PDN2 1.34e-20 96 27 4 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q9PDN2 1.92e-08 59 26 7 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q8KLG1 1.46e-20 95 28 4 208 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 9.38e-12 69 25 6 224 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q7N6Z2 1.6e-20 96 28 4 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N6Z2 2.42e-11 68 28 9 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q31GF5 1.89e-20 93 30 4 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31GF5 0.000366 45 21 4 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q88AS5 2.04e-20 95 27 2 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88AS5 8.84e-09 60 26 8 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9EYM2 2.14e-20 93 28 4 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9EYM2 5.04e-05 48 20 6 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P55476 2.22e-20 95 27 4 214 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55476 5.62e-12 70 24 5 229 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8RQL7 2.33e-20 93 28 4 213 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8RQL7 5.49e-13 72 30 7 206 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8UA73 2.61e-20 95 24 5 236 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UA73 1.92e-09 62 24 7 211 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4L8L7 2.69e-20 92 32 7 223 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q4L8L7 1.69e-05 49 22 7 214 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q46ZU5 3.2e-20 94 29 3 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46ZU5 3.24e-08 58 26 8 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q03ZQ0 3.88e-20 95 28 3 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03ZQ0 2.82e-08 59 25 9 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q5QU46 4.74e-20 92 28 6 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q5QU46 3.96e-08 57 25 5 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1K323 5.1e-20 97 30 5 215 3 macB Macrolide export ATP-binding/permease protein MacB Azoarcus sp. (strain BH72)
A1K323 4.77e-10 65 24 7 217 3 macB Macrolide export ATP-binding/permease protein MacB Azoarcus sp. (strain BH72)
P45073 5.1e-20 92 27 3 238 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45073 2.17e-07 55 24 5 211 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q65TH4 5.31e-20 96 32 3 206 3 macB Macrolide export ATP-binding/permease protein MacB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65TH4 3.54e-09 62 24 5 209 3 macB Macrolide export ATP-binding/permease protein MacB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q2EHL8 5.56e-20 96 32 4 209 1 macB Macrolide export ATP-binding/permease protein MacB Aggregatibacter actinomycetemcomitans
Q2EHL8 2.34e-10 66 24 6 215 1 macB Macrolide export ATP-binding/permease protein MacB Aggregatibacter actinomycetemcomitans
Q8PUE7 5.63e-20 96 22 12 480 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 5.05e-07 55 21 4 213 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q58429 5.83e-20 92 29 4 214 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58429 2.23e-12 70 28 6 206 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9CM47 6.03e-20 96 31 4 206 3 macB Macrolide export ATP-binding/permease protein MacB Pasteurella multocida (strain Pm70)
Q9CM47 1.36e-08 60 21 4 217 3 macB Macrolide export ATP-binding/permease protein MacB Pasteurella multocida (strain Pm70)
Q9I6L0 6.11e-20 94 27 2 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I6L0 5.68e-09 61 27 10 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1WVI7 6.37e-20 94 29 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q1WVI7 5.54e-13 73 26 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q0BN75 6.62e-20 92 29 5 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain OSU18)
Q0BN75 1.66e-06 52 24 6 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain OSU18)
Q5HVG3 6.8e-20 96 30 4 214 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni (strain RM1221)
Q5HVG3 5.1e-14 78 25 8 240 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni (strain RM1221)
Q5F8K2 6.82e-20 92 28 4 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5F8K2 1.27e-08 58 27 6 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q0PAR0 7.99e-20 96 30 4 214 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q0PAR0 5.38e-14 78 25 8 240 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q7MJ01 8.39e-20 91 29 5 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio vulnificus (strain YJ016)
Q7MJ01 2.02e-12 70 26 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio vulnificus (strain YJ016)
Q8DAV6 8.39e-20 91 29 5 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio vulnificus (strain CMCP6)
Q8DAV6 2.02e-12 70 26 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio vulnificus (strain CMCP6)
Q07PZ0 9.57e-20 92 30 5 215 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisA53)
Q9WYI7 9.7e-20 91 31 5 220 3 TM_0352 Uncharacterized ABC transporter ATP-binding protein TM_0352 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WYI7 1.97e-08 58 26 7 222 3 TM_0352 Uncharacterized ABC transporter ATP-binding protein TM_0352 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8PC11 1.05e-19 93 27 6 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PC11 1.27e-09 63 24 9 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q729H7 1.09e-19 91 28 4 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
P47425 1.09e-19 92 29 8 245 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47425 7.84e-10 63 22 7 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9G4F5 1.12e-19 93 26 2 212 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q9G4F5 3.55e-05 49 23 7 210 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q8PHQ3 1.23e-19 92 28 4 209 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q8PHQ3 1.08e-05 50 34 1 79 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q88CL2 1.27e-19 93 26 2 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88CL2 3.57e-08 58 25 7 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q87R20 1.28e-19 91 30 5 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87R20 4.43e-12 69 25 6 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5NHP2 1.32e-19 90 29 5 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q5NHP2 3.83e-07 54 23 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q2A4V5 1.32e-19 90 29 5 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain LVS)
Q2A4V5 3.83e-07 54 23 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain LVS)
Q14J44 1.32e-19 90 29 5 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain FSC 198)
Q14J44 3.83e-07 54 23 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain FSC 198)
P26050 1.33e-19 92 26 4 211 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P26050 5.81e-13 73 24 6 230 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6MPX9 1.41e-19 95 30 4 207 3 macB Macrolide export ATP-binding/permease protein MacB Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q6MPX9 7.01e-07 55 24 5 205 3 macB Macrolide export ATP-binding/permease protein MacB Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
P48243 1.72e-19 90 28 2 213 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P48243 3.63e-11 66 28 7 211 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q7VMF9 1.75e-19 95 30 3 202 3 macB Macrolide export ATP-binding/permease protein MacB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7VMF9 2.35e-10 66 23 5 217 3 macB Macrolide export ATP-binding/permease protein MacB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q0T9T7 1.89e-19 91 28 5 221 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0T9T7 3.99e-12 70 26 8 242 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q6WB63 2.01e-19 91 29 5 227 3 phnC Phosphonates import ATP-binding protein PhnC Alcaligenes faecalis
Q6WB63 3.58e-06 52 23 7 234 3 phnC Phosphonates import ATP-binding protein PhnC Alcaligenes faecalis
A1VYW8 2.1e-19 95 30 4 214 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A1VYW8 3.61e-13 75 25 9 239 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q3IL62 2.22e-19 90 30 4 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas translucida (strain TAC 125)
Q3IL62 9.54e-09 59 27 8 196 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas translucida (strain TAC 125)
Q1GFI8 2.25e-19 90 29 4 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Ruegeria sp. (strain TM1040)
Q1GFI8 4.86e-05 48 22 7 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Ruegeria sp. (strain TM1040)
Q080S4 2.35e-19 90 29 7 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella frigidimarina (strain NCIMB 400)
Q080S4 9.25e-07 53 23 6 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella frigidimarina (strain NCIMB 400)
Q5X2Z8 2.51e-19 90 28 5 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q5X2Z8 2.18e-07 55 23 6 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
P10346 2.61e-19 90 28 3 215 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
P10346 8.85e-14 74 25 7 231 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q8XDV7 2.64e-19 90 28 5 219 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O157:H7
Q8XDV7 1.85e-12 70 26 8 242 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O157:H7
Q1CI46 2.86e-19 90 27 5 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CI46 1.09e-07 56 23 7 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZFR4 2.86e-19 90 27 5 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis
Q8ZFR4 1.09e-07 56 23 7 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis
Q1C6Q8 2.86e-19 90 27 5 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C6Q8 1.09e-07 56 23 7 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Antiqua)
Q2SJY7 3.24e-19 92 27 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q2SJY7 8.57e-05 48 25 6 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q5LT05 3.7e-19 92 27 9 282 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LT05 4.94e-08 58 33 2 107 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1LPJ9 3.73e-19 90 28 6 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LPJ9 4.05e-05 48 27 4 124 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8CUY0 4.14e-19 90 32 7 229 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8CUY0 6.86e-07 54 26 10 222 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8UH62 4.28e-19 92 27 4 235 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UH62 1.78e-12 72 25 6 210 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q89UD2 4.34e-19 92 28 5 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89UD2 2.58e-08 59 26 8 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1IGL4 4.64e-19 90 28 5 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q1IGL4 1.26e-08 59 23 7 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q2NU23 4.71e-19 89 26 4 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q2NU23 2.52e-08 58 24 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q18C09 4.97e-19 91 27 5 217 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q18C09 2.21e-09 62 25 7 213 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q38VW6 5.16e-19 92 29 6 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q38VW6 3.89e-10 65 26 6 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q3A558 5.38e-19 89 29 7 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q3A558 1.31e-10 64 25 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A1TXH7 5.43e-19 92 27 4 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1TXH7 7.75e-07 54 24 6 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q72FW5 5.82e-19 91 27 4 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72FW5 3.52e-11 68 26 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8EIL8 5.88e-19 93 29 4 207 3 macB Macrolide export ATP-binding/permease protein MacB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8EIL8 3.28e-05 50 21 5 216 3 macB Macrolide export ATP-binding/permease protein MacB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8REG7 6.4e-19 89 27 6 223 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8REG7 4.3e-12 69 25 8 216 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q6N999 6.58e-19 89 28 7 219 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6N999 4.39e-10 63 23 6 210 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q16BC5 6.95e-19 89 28 6 231 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q16BC5 2.46e-05 49 22 6 216 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q669P3 6.96e-19 89 27 5 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q669P3 3.2e-08 57 24 7 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q9Z3R9 7.15e-19 91 31 6 218 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q9Z3R9 1.44e-08 60 26 10 221 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
P21410 7.23e-19 91 30 4 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
P21410 2.95e-07 55 25 6 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
Q0VT01 7.34e-19 93 30 4 204 3 macB Macrolide export ATP-binding/permease protein MacB Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VT01 7.74e-08 58 21 6 240 3 macB Macrolide export ATP-binding/permease protein MacB Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q2JPW6 7.79e-19 89 30 7 218 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q88R93 8.01e-19 89 28 5 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88R93 1.02e-06 53 22 5 211 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q2K4V4 8.15e-19 91 28 3 207 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K4V4 1.68e-07 57 25 9 232 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1LNM0 8.18e-19 90 27 4 211 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LNM0 2.22e-05 49 20 4 206 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1BWI2 8.64e-19 90 25 4 211 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q1BWI2 1.22e-09 63 24 5 210 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q65UE1 8.89e-19 91 26 3 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65UE1 7.34e-13 73 26 4 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q12B04 9.07e-19 91 26 8 308 3 metN Methionine import ATP-binding protein MetN Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q12B04 6.77e-05 48 23 6 206 3 metN Methionine import ATP-binding protein MetN Polaromonas sp. (strain JS666 / ATCC BAA-500)
P57066 9.16e-19 88 27 6 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P57066 2.8e-12 69 27 8 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8U648 9.22e-19 89 28 5 207 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U648 1.61e-10 65 26 7 207 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4QP85 9.53e-19 90 27 6 285 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q4QP85 2.01e-14 78 29 7 211 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q329I3 1.03e-18 89 27 5 221 3 phnC Phosphonates import ATP-binding protein PhnC Shigella dysenteriae serotype 1 (strain Sd197)
Q329I3 7.09e-11 66 26 7 219 3 phnC Phosphonates import ATP-binding protein PhnC Shigella dysenteriae serotype 1 (strain Sd197)
A0L0V9 1.03e-18 92 30 4 206 3 macB Macrolide export ATP-binding/permease protein MacB Shewanella sp. (strain ANA-3)
A0L0V9 2.85e-05 50 21 5 216 3 macB Macrolide export ATP-binding/permease protein MacB Shewanella sp. (strain ANA-3)
Q8E8K8 1.09e-18 90 28 2 207 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8E8K8 1.37e-09 63 24 6 216 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8Y0X3 1.12e-18 90 29 5 205 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8Y0X3 4.67e-05 49 24 8 216 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q04DA7 1.18e-18 90 29 6 218 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04DA7 2.01e-10 65 26 8 233 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q2W450 1.21e-18 88 30 8 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2W450 2.79e-07 55 24 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q5M397 1.26e-18 90 30 5 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M397 2.37e-09 62 25 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q03JH1 1.27e-18 90 30 5 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q03JH1 2.63e-09 62 25 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5ZT78 1.31e-18 88 28 5 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZT78 7.66e-08 56 23 6 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5LYN4 1.33e-18 90 30 5 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q5LYN4 2.28e-09 62 25 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q8T664 1.33e-18 92 29 4 206 3 abcH2 ABC transporter H family member 2 Dictyostelium discoideum
Q8T664 7.25e-06 52 39 2 79 3 abcH2 ABC transporter H family member 2 Dictyostelium discoideum
P0C2H2 1.36e-18 92 32 3 202 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli
P0C2H2 4.18e-08 59 25 7 219 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli
P0C2H3 1.36e-18 92 32 3 202 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Escherichia coli O1:K1 / APEC
P0C2H3 4.18e-08 59 25 7 219 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Escherichia coli O1:K1 / APEC
Q1R3F6 1.41e-18 89 27 5 221 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain UTI89 / UPEC)
Q1R3F6 2.98e-12 70 26 8 242 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain UTI89 / UPEC)
Q8FAV1 1.45e-18 89 27 5 221 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FAV1 9.67e-12 68 26 8 242 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7NX01 1.54e-18 90 27 2 212 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1BHS6 1.67e-18 88 27 5 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia orbicola (strain AU 1054)
Q1BHS6 1.37e-05 50 22 6 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia orbicola (strain AU 1054)
P96117 1.68e-18 88 26 4 209 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
P96117 2.75e-06 52 23 6 233 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
Q5PMK1 1.69e-18 90 29 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PMK1 2.36e-10 65 26 6 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1J6Q6 1.7e-18 90 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1J6Q6 1.19e-11 69 25 7 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 1.7e-18 90 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JGY7 1.19e-11 69 25 7 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 1.7e-18 90 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JLT7 1.19e-11 69 25 7 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 1.7e-18 90 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1JBV6 1.19e-11 69 25 7 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8Z7H7 1.73e-18 90 29 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q8Z7H7 2.87e-10 65 26 6 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q6LPK2 1.73e-18 87 28 5 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Photobacterium profundum (strain SS9)
Q6LPK2 6.63e-16 80 28 5 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Photobacterium profundum (strain SS9)
Q1M7W6 1.74e-18 89 27 3 208 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M7W6 1.41e-12 72 25 8 233 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P40790 1.74e-18 90 29 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P40790 2.56e-10 65 26 6 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 1.74e-18 90 29 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q57QC8 2.56e-10 65 26 6 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q2YKZ7 1.76e-18 90 31 5 211 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q2YKZ7 1.23e-06 54 23 6 210 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 1.76e-18 90 31 5 211 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q578M5 1.23e-06 54 23 6 210 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q8FVT0 1.8e-18 90 31 5 211 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q8FVT0 1.3e-06 53 23 6 210 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q7CN92 1.99e-18 90 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q7CN92 1.52e-11 69 25 7 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 1.99e-18 90 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q99ZS8 1.52e-11 69 25 7 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
P44513 2e-18 90 26 6 285 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44513 7.58e-15 79 29 7 211 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3YUN6 2.15e-18 88 27 5 221 3 phnC Phosphonates import ATP-binding protein PhnC Shigella sonnei (strain Ss046)
Q3YUN6 2.25e-12 70 26 8 242 3 phnC Phosphonates import ATP-binding protein PhnC Shigella sonnei (strain Ss046)
Q31TP8 2.24e-18 88 27 5 221 3 phnC Phosphonates import ATP-binding protein PhnC Shigella boydii serotype 4 (strain Sb227)
Q31TP8 3.22e-11 67 25 8 242 3 phnC Phosphonates import ATP-binding protein PhnC Shigella boydii serotype 4 (strain Sb227)
Q2SXD1 2.45e-18 87 27 5 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SXD1 7.1e-08 57 24 6 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q5WUF8 2.47e-18 87 28 5 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Lens)
Q5WUF8 2.62e-08 58 23 6 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Lens)
Q89ER4 2.54e-18 88 27 3 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89ER4 1.32e-09 62 22 5 221 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5XCA4 2.62e-18 90 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5XCA4 2.12e-11 68 24 7 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q39EV3 2.77e-18 87 27 5 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39EV3 1.41e-05 50 22 6 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2IYS5 2.81e-18 88 29 4 215 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
Q2IYS5 8.08e-05 48 23 8 221 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
P0CZ35 2.9e-18 90 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ35 2.04e-11 69 24 7 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 2.9e-18 90 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q48TP4 2.04e-11 69 24 7 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 2.9e-18 90 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0CZ34 2.04e-11 69 24 7 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P77795 2.97e-18 89 23 3 210 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
P77795 5.28e-07 55 25 5 203 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q2K9R2 3.03e-18 87 26 3 199 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K9R2 1.59e-06 52 23 7 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P16677 3.04e-18 87 26 6 225 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain K12)
P16677 3.25e-11 67 26 8 242 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain K12)
Q5E0B3 3.16e-18 87 27 5 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E0B3 1.24e-11 68 24 7 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q66D26 3.19e-18 88 28 4 214 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CFV9 3.19e-18 88 28 4 214 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGU5 3.19e-18 88 28 4 214 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis
Q1C9L0 3.19e-18 88 28 4 214 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis bv. Antiqua (strain Antiqua)
Q8Y0C6 3.25e-18 87 27 6 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8Y0C6 4.04e-05 48 35 3 88 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P56344 3.38e-18 87 28 3 212 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
P56344 3.34e-09 60 23 7 212 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
O34814 3.43e-18 87 27 5 219 1 ftsE Cell division ATP-binding protein FtsE Bacillus subtilis (strain 168)
O34814 7.61e-08 56 24 5 207 1 ftsE Cell division ATP-binding protein FtsE Bacillus subtilis (strain 168)
Q7CS28 3.47e-18 89 28 4 209 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7CS28 5.09e-08 58 23 5 206 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5FUV5 3.47e-18 87 28 5 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Gluconobacter oxydans (strain 621H)
Q5FUV5 1.94e-06 52 23 7 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Gluconobacter oxydans (strain 621H)
P14788 3.48e-18 89 31 6 214 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P14788 3.49e-08 58 24 7 211 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q1GB17 3.59e-18 89 30 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q1GB17 4.61e-08 58 28 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09120
Feature type CDS
Gene -
Product sugar ABC transporter ATP-binding protein
Location 1907432 - 1908892 (strand: 1)
Length 1461 (nucleotides) / 486 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_16
Orthogroup size 19
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1129 Carbohydrate transport and metabolism (G) G ABC-type sugar transport system, ATPase component

Protein Sequence

MHHIIKSFNQVEVLKGVDFTLYAGEVHCLVGENGAGKSTLCKIIAGIYPANGGSMTLFEQPYNPLNVKEAQLKGIGFIHQELLLVSELTVLENIFLGSEKHNIFGQMKWREMYDLAKEVIDELELDISPDAKISSLSLAQQQMVEIAKAIIHNYKIIIFDEPTASISRKNTETLFRIIHQLKEKGVGMVYISHRLEEFNHIADRITVLRDGVRTGTMLYKDTNNNEIIRLMVGRDIKASDEVDHTNFSHIKLNVCDLQNAYVEKISFNVYQGEILGFAGLVGAGRTEILRAIFGADESSGDIYIDDIKQKIRSPKDAVKAGIGFLTEDRKGQGLVLGASIRKNVTLPILHRLWNGLFINQSEEKICVQKNMEKLRIVASSQEQTANTLSGGNQQKVVLARWMESNVKILFFDEPTRGIDVGAKAEIYDLMRAFTKDGGTVVMVSSDLPELLLLSNRIIVMRQGSMVGEILRKDASEEKLMHLMVGI

Flanking regions ( +/- flanking 50bp)

TCTGGAATTATAATAATATGACTGAGATTAATAAAAAGATTGTTTTTGACATGCATCACATTATTAAATCCTTTAATCAGGTAGAGGTTCTGAAAGGCGTTGATTTCACCCTGTATGCCGGAGAGGTTCATTGCCTGGTCGGGGAAAATGGCGCAGGAAAATCAACACTTTGCAAAATAATCGCCGGAATATATCCCGCAAACGGCGGCAGTATGACGCTATTTGAACAGCCCTATAACCCGCTGAATGTAAAAGAAGCACAGCTGAAAGGAATCGGCTTTATTCATCAGGAGTTATTGCTGGTTTCTGAATTAACTGTATTAGAAAATATATTCTTAGGCAGTGAAAAGCATAATATATTCGGTCAAATGAAATGGCGTGAAATGTACGACCTTGCCAAAGAAGTCATTGATGAACTTGAGCTTGATATATCCCCGGATGCAAAAATAAGTTCTTTATCTCTGGCTCAGCAGCAAATGGTAGAAATAGCTAAAGCAATAATCCATAATTATAAAATAATCATCTTCGACGAACCCACTGCATCTATCTCCCGTAAAAATACAGAAACACTGTTCCGGATCATCCATCAGCTGAAAGAAAAGGGTGTCGGCATGGTTTATATTTCCCATCGCTTAGAAGAATTTAATCATATTGCGGATCGCATCACAGTTTTAAGAGATGGTGTGCGGACCGGCACTATGCTGTATAAAGATACCAATAACAATGAAATAATTCGGTTAATGGTCGGACGGGATATTAAAGCATCTGATGAAGTGGATCATACTAATTTCAGTCATATTAAATTAAACGTTTGTGACCTTCAAAATGCATATGTCGAAAAAATATCGTTCAATGTGTATCAGGGCGAAATTTTAGGGTTTGCAGGATTAGTCGGTGCCGGAAGAACTGAAATTCTGCGCGCCATATTTGGTGCCGACGAAAGCAGCGGTGATATTTACATTGATGATATTAAGCAAAAAATCCGCTCACCTAAAGATGCGGTAAAAGCGGGTATCGGATTTTTAACAGAAGACCGCAAAGGACAGGGTTTGGTTTTAGGTGCCAGCATCCGGAAAAATGTGACACTTCCTATCTTGCACCGGCTATGGAATGGTTTATTTATTAACCAGTCAGAAGAAAAAATATGTGTGCAAAAGAATATGGAAAAATTGCGCATTGTTGCCAGCAGCCAGGAGCAGACAGCAAATACATTATCCGGTGGTAATCAGCAAAAAGTCGTATTAGCCCGGTGGATGGAAAGTAATGTCAAAATCTTATTTTTTGATGAGCCGACACGCGGTATTGATGTCGGTGCAAAAGCTGAAATTTATGATTTGATGCGGGCATTTACAAAAGATGGCGGCACCGTCGTGATGGTGTCTTCCGATTTACCCGAGCTATTGTTGCTGTCAAACCGCATTATTGTTATGCGCCAGGGGTCAATGGTGGGCGAAATTTTACGCAAAGATGCCTCAGAAGAAAAATTAATGCATTTAATGGTGGGTATATAAGCCCGGAACAACCACAGAATTGACCAATAGTTGGTAACATAATTATGCAA