Homologs in group_713

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03095 FBDBKF_03095 77.0 Morganella morganii S1 arcB aerobic respiration two-component sensor histidine kinase ArcB
EHELCC_07440 EHELCC_07440 77.0 Morganella morganii S2 arcB aerobic respiration two-component sensor histidine kinase ArcB
NLDBIP_07765 NLDBIP_07765 77.0 Morganella morganii S4 arcB aerobic respiration two-component sensor histidine kinase ArcB
LHKJJB_07300 LHKJJB_07300 77.0 Morganella morganii S3 arcB aerobic respiration two-component sensor histidine kinase ArcB
HKOGLL_03630 HKOGLL_03630 77.0 Morganella morganii S5 arcB aerobic respiration two-component sensor histidine kinase ArcB
F4V73_RS11825 F4V73_RS11825 76.1 Morganella psychrotolerans arcB aerobic respiration two-component sensor histidine kinase ArcB

Distribution of the homologs in the orthogroup group_713

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_713

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AEC4 0.0 1159 74 4 783 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 0.0 1159 74 4 783 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 0.0 1158 74 4 783 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P44578 1.21e-59 208 52 2 211 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44578 1.18e-15 82 42 0 94 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HUI3 1.38e-57 216 32 15 523 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9P896 2.26e-52 197 31 12 444 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P58402 4.04e-52 200 28 23 659 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q8D5Z6 8.02e-52 197 34 6 367 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q7MD16 8.81e-52 197 34 6 367 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
P30855 1.19e-51 199 28 23 660 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q87GU5 3.04e-51 196 31 7 402 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P54302 3.49e-49 190 30 7 407 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P58356 3.14e-48 187 27 11 490 3 torS Sensor protein TorS Escherichia coli O157:H7
P0C0F7 5.51e-48 185 26 15 542 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P39453 1.09e-47 186 27 11 490 1 torS Sensor protein TorS Escherichia coli (strain K12)
P0C0F6 1.3e-47 184 26 15 542 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P16575 6.46e-47 184 27 14 536 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P40330 2.6e-46 182 26 11 585 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q9KLK7 3.82e-46 181 31 10 401 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P26762 1.04e-45 181 26 11 585 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9SSY6 1.08e-45 178 31 10 397 2 ETR1 Ethylene receptor 1 Cucumis sativus
O82436 1.58e-45 177 31 10 397 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q86CZ2 7.18e-45 178 30 9 392 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q9XH57 5.14e-44 173 30 11 401 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
O48929 7.21e-44 173 30 9 396 2 ETR1 Ethylene receptor Nicotiana tabacum
Q9M7M1 8.28e-44 172 30 8 396 2 ETR1 Ethylene receptor Prunus persica
P49333 2.04e-43 171 30 10 399 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q9XH58 2.42e-43 171 30 8 398 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
O49230 5.6e-43 170 30 9 388 2 ETR1 Ethylene receptor 1 Brassica oleracea
P48027 9.85e-43 171 35 9 337 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P48027 2.26e-10 68 25 8 237 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
O49187 1.22e-42 169 30 9 394 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
Q9ZWL6 2.97e-42 168 30 11 396 2 ETR1 Ethylene receptor Passiflora edulis
O81122 1.05e-41 166 29 10 398 2 ETR1 Ethylene receptor Malus domestica
P59342 3.89e-41 166 29 6 381 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P59342 1.03e-13 79 26 7 245 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
Q41342 6.04e-41 164 28 9 396 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
P0AEC5 6.09e-41 165 37 3 239 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC5 6.33e-14 79 26 7 245 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 6.09e-41 165 37 3 239 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC6 6.33e-14 79 26 7 245 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 6.09e-41 165 37 3 239 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P0AEC7 6.33e-14 79 26 7 245 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
Q9F8D7 6.47e-41 165 34 7 335 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q9F8D7 5.81e-14 79 25 9 292 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q9KHI5 8.55e-41 164 33 9 354 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5A599 4.84e-40 162 29 13 437 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A599 3.4e-16 87 39 4 147 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q54YZ9 8.94e-40 162 33 5 318 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q54YZ9 4.57e-15 83 38 2 118 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q54YH4 3.85e-37 154 36 3 249 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q54YH4 1.22e-15 85 42 5 127 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q54U87 5.57e-37 154 35 5 258 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q54U87 3.49e-05 51 29 7 155 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q869S5 1.67e-36 152 36 6 267 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q869S5 1.73e-13 78 41 1 112 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q8ZPP5 2.66e-36 150 26 15 516 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9C5U1 6.86e-36 149 28 9 438 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q9C5U1 9.87e-11 69 30 4 147 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q54RP6 1.5e-34 146 30 12 414 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q54RP6 1.58e-15 85 38 3 121 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q5AHA0 3.85e-34 145 31 8 315 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5AHA0 5.58e-11 70 40 3 126 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q551X9 1.64e-33 142 31 6 317 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q551X9 2.7e-06 55 31 3 119 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q8DKG0 2.16e-33 140 33 9 298 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9C5U2 5.61e-33 140 27 13 446 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q9C5U2 2.87e-10 67 30 4 143 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q2T0V9 6.04e-33 138 28 11 388 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
O14002 5.79e-32 138 32 4 267 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14002 0.000247 48 33 4 106 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A2WYI4 1.13e-31 136 29 6 326 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A2WYI4 1.9e-10 68 29 4 142 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A1A697 2.22e-31 135 25 10 448 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
A1A697 2.06e-09 65 28 4 142 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
A1A696 2.47e-31 135 28 6 326 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
A1A696 2e-10 68 29 4 142 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
Q9P7Q7 8.18e-31 134 28 9 409 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P7Q7 5.1e-09 63 31 3 122 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0DMC5 2.41e-30 132 34 5 247 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC5 7.97e-09 63 33 2 109 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC6 2.93e-30 132 34 5 247 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DMC6 1.59e-08 62 33 2 109 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q56128 3.19e-30 132 34 5 247 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q56128 8.36e-10 66 30 3 136 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P58662 4.81e-30 131 33 3 246 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P58662 2.88e-09 64 30 3 136 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q95PI2 5.92e-29 128 35 2 224 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
P74111 7.72e-29 127 29 16 406 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P23545 1.65e-28 124 31 7 271 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
B8AY75 4.48e-28 124 32 4 241 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q3S4A7 5.2e-28 124 26 18 483 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q3S4A7 7.88e-12 72 29 5 184 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q8KIY1 5.35e-28 124 27 15 433 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 7.08e-11 69 25 7 257 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q0DKM0 5.75e-28 123 32 4 241 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q52969 2.29e-27 120 31 5 273 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
A1A698 7.27e-26 118 26 14 473 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
A1A698 4.91e-13 76 33 4 144 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q8FZ86 9.76e-26 117 28 10 307 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
A9M715 1.01e-25 117 28 10 307 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
T2KMF4 1.03e-25 117 26 10 388 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
B0CI82 1.05e-25 117 28 10 307 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRX4 8.28e-25 114 29 11 307 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57BR6 8.64e-25 114 29 11 307 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 8.64e-25 114 29 11 307 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 8.64e-25 114 29 11 307 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
A6X5X4 9.01e-25 114 29 9 299 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8YIM6 9.1e-25 114 29 11 307 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9C5U0 1.2e-24 114 34 1 189 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q9C5U0 1.67e-10 68 33 4 140 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q9C5U0 9.34e-05 50 38 1 75 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q03228 1.43e-24 112 33 9 263 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9SXL4 2.59e-24 113 28 5 282 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9SXL4 4.73e-07 57 29 4 143 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
E0X9C7 5.52e-24 112 26 15 446 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 5.35e-11 70 21 8 393 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
Q53RH0 9.42e-24 110 31 4 247 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 9.42e-24 110 31 4 247 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
A5W4E3 9.76e-24 111 26 15 446 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 4.67e-11 70 21 8 393 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P37894 1.02e-23 110 33 8 248 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9ZTP3 1.37e-22 107 25 12 395 1 EIN4 Protein EIN4 Arabidopsis thaliana
A1A699 1.61e-22 107 37 0 147 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
A1A699 2.37e-11 71 28 4 161 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
A1A699 9.05e-09 62 28 9 240 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
Q38846 2.3e-22 105 33 4 242 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
P08400 2.68e-22 103 26 13 381 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
A5A2P0 3.15e-22 103 28 9 266 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q45614 4.87e-22 104 28 9 270 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q7XX84 1.19e-21 104 23 13 407 1 ETR2 Ethylene receptor 2 Oryza sativa subsp. japonica
P35164 1.79e-21 102 28 11 292 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
P45609 2.93e-21 100 26 11 381 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q8H1X1 3.38e-21 102 23 13 407 2 ETR2 Ethylene receptor 2 Oryza sativa subsp. indica
Q8CU87 5.74e-21 101 29 11 268 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 5.74e-21 101 29 11 268 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P23621 9.34e-21 99 30 8 260 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DPL8 1.01e-20 99 28 14 379 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 1.01e-20 99 28 14 379 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q08408 1.22e-20 99 30 6 227 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
Q9RDT3 2.93e-20 97 28 11 275 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q9RQQ9 4.56e-20 99 29 4 247 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q4A159 5.61e-20 98 29 10 251 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q54SP4 7.25e-20 99 26 7 294 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 6.72e-19 95 27 8 292 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q6GKS6 8.64e-20 97 28 11 275 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q7A215 9.03e-20 97 28 11 275 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 9.03e-20 97 28 11 275 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 9.03e-20 97 28 11 275 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 9.03e-20 97 28 11 275 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 9.03e-20 97 28 11 275 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 9.03e-20 97 28 11 275 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 9.03e-20 97 28 11 275 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 9.03e-20 97 28 11 275 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 9.03e-20 97 28 11 275 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 9.03e-20 97 28 11 275 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 9.03e-20 97 28 11 275 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 9.03e-20 97 28 11 275 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
A6QD58 9.27e-20 97 28 11 275 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q4LAJ8 1.51e-19 97 27 10 268 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q6T5K2 1.87e-19 97 23 14 395 2 ETR3 Ethylene receptor 3 Oryza sativa subsp. indica
O22267 2.7e-19 97 27 6 281 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
O22267 2.18e-05 52 26 6 174 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
Q06067 3.13e-19 95 26 12 353 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q1XD95 4.25e-19 95 25 18 482 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q8Z332 7.79e-19 94 30 6 228 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q0DWC7 8.75e-19 95 23 15 399 2 ETR3 Ethylene receptor 3 Oryza sativa subsp. japonica
P37461 8.92e-19 93 30 6 228 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9APE0 2.43e-18 92 29 8 258 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q54W36 4.98e-18 93 34 2 165 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54W36 1.32e-10 68 51 1 70 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54W36 2.76e-09 64 32 4 123 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q6GGK7 7.13e-18 91 27 11 281 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q7A5H7 7.13e-18 91 26 11 283 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 7.13e-18 91 26 11 283 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q0WPQ2 8.73e-18 92 24 14 413 1 ETR2 Ethylene receptor 2 Arabidopsis thaliana
Q8NWF3 9.69e-18 91 26 11 283 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 9.69e-18 91 26 11 283 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 9.69e-18 91 26 11 283 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 9.69e-18 91 26 11 283 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0QR01 1.05e-17 89 26 5 244 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q54Q69 1.4e-17 92 26 8 292 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q54Q69 6.71e-13 76 35 2 120 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q9L523 1.71e-17 90 26 11 281 1 srrB Sensor protein SrrB Staphylococcus aureus
Q5SML4 9.5e-17 89 25 9 304 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
Q5SML4 6.48e-10 66 28 5 166 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
A2YA15 9.5e-17 89 25 9 304 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
A2YA15 6.48e-10 66 28 5 166 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
Q8DMT2 1e-16 86 28 6 246 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P94414 1.13e-16 87 25 4 240 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
P20169 1.22e-16 87 32 8 231 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P45608 1.47e-16 86 25 13 370 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
P51392 1.64e-16 87 24 17 477 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
E5KK10 3.08e-16 87 30 13 232 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q55932 4.61e-16 85 27 6 228 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P14377 8.59e-16 84 30 6 216 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
P0DOA0 1.04e-15 85 26 12 335 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
O74539 1.84e-15 85 25 6 252 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O74539 0.000182 49 30 6 124 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O34206 2.12e-15 84 26 8 246 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
B1WYT4 3.47e-15 81 24 5 259 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
P39764 6.65e-15 81 23 12 396 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q8X614 9.17e-15 81 30 6 216 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q5HPC4 9.32e-15 81 30 10 235 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8G5E7 1.02e-14 80 31 9 241 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q93CB7 1.05e-14 81 28 7 223 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q7V6P7 1.32e-14 79 30 9 228 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q9LCC2 1.91e-14 81 29 8 239 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A2BRQ6 2.04e-14 79 30 9 241 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
P10955 2.12e-14 80 24 13 396 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
Q8CSL7 2.18e-14 80 29 10 235 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P9WGK9 2.21e-14 80 27 7 223 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK8 2.37e-14 80 27 7 223 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 2.37e-14 80 27 7 223 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGK5 2.61e-14 79 26 5 236 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 2.61e-14 79 26 5 236 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 2.61e-14 79 26 5 236 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A3PDI2 2.67e-14 79 30 9 241 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
B7KFU0 3.22e-14 79 23 14 409 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
P54883 4.54e-14 79 27 4 231 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q55E44 6.47e-14 79 29 1 165 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q55E44 2.93e-08 61 45 1 70 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q55E44 4.38e-05 51 31 5 122 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q9CCJ1 7.66e-14 78 27 7 223 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
A2C884 7.93e-14 77 29 9 228 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q55168 1.05e-13 78 27 8 233 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7V113 1.23e-13 77 29 8 245 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q2JWK9 1.47e-13 76 34 3 132 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
O34989 1.77e-13 77 26 9 243 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q31AE8 2.22e-13 76 29 8 245 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
A0QTK3 2.72e-13 77 27 8 234 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q2JKD9 2.76e-13 75 34 3 132 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
O34638 2.86e-13 76 26 9 220 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q7BWI3 2.87e-13 75 24 9 255 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q8CTI3 3.76e-13 75 27 8 254 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 3.76e-13 75 27 8 254 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9R6X3 4.16e-13 76 24 8 234 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P21865 7.3e-13 76 27 8 240 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
A3BE68 8.28e-13 75 31 1 138 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A3BE68 3.83e-12 73 29 3 146 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A3BE68 9.13e-08 59 34 2 108 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
P94608 8.78e-13 75 27 6 227 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9P4U6 9.17e-13 75 26 8 319 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9P4U6 9.31e-05 50 31 3 97 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A2YFR6 9.26e-13 75 31 1 138 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A2YFR6 4.03e-12 73 29 3 146 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A2YFR6 9.61e-08 59 34 2 108 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
P38889 1.08e-12 75 32 4 150 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B2J946 1.16e-12 74 25 9 264 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q7U871 1.27e-12 73 37 2 114 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
P36505 1.65e-12 75 24 13 353 2 PHY1 Phytochrome 1 Physcomitrium patens
Q75KW7 2.13e-12 68 36 4 122 3 RR41 Two-component response regulator ORR41 Oryza sativa subsp. japonica
F4JZT3 3.14e-12 68 33 3 128 2 ARR24 Two-component response regulator 24 Arabidopsis thaliana
Q06904 4.11e-12 72 39 3 112 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9ZHD4 5.76e-12 72 26 8 242 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q06240 6.36e-12 71 23 6 249 1 vanS Sensor protein VanS Enterococcus faecium
P71380 7.68e-12 71 25 11 295 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q07737 1e-11 72 24 6 239 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
O35044 1.09e-11 70 31 12 242 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
Q0IBF4 1.27e-11 70 35 2 114 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
P87323 1.69e-11 71 29 4 169 4 mcs4 Response regulator mcs4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q55630 1.97e-11 70 24 7 235 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5A4X5 2.29e-11 70 36 3 123 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
O69729 3.05e-11 70 26 5 211 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q49XM6 4.56e-11 69 28 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B0JK50 4.78e-11 68 25 6 232 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q8FW53 5.19e-11 63 31 2 120 3 divK Polar-differentiation response regulator DivK Brucella suis biovar 1 (strain 1330)
A9WYT1 5.19e-11 63 31 2 120 3 divK Polar-differentiation response regulator DivK Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VUU3 5.19e-11 63 31 2 120 3 divK Polar-differentiation response regulator DivK Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YC73 5.19e-11 63 31 2 120 3 divK Polar-differentiation response regulator DivK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBQ2 5.19e-11 63 31 2 120 3 divK Polar-differentiation response regulator DivK Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q7BBW0 5.19e-11 63 31 2 120 1 divK Polar-differentiation response regulator DivK Brucella abortus biovar 1 (strain 9-941)
Q2YKN1 5.19e-11 63 31 2 120 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain 2308)
B2SB45 5.19e-11 63 31 2 120 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain S19)
Q8FK37 5.55e-11 69 23 5 233 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A7HD43 6.46e-11 68 26 8 223 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
B7K3M6 7.43e-11 68 22 6 263 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q3AYV8 8.57e-11 68 28 8 227 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
Q47457 8.85e-11 68 23 3 220 3 pcoS Probable sensor protein PcoS Escherichia coli
Q8GP19 8.93e-11 68 23 3 219 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
P72292 1.21e-10 68 24 6 233 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
P0A4I6 1.25e-10 68 29 11 237 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 1.25e-10 68 29 11 237 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A6X580 1.38e-10 62 32 2 120 3 divK Polar-differentiation response regulator DivK Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
O34903 1.52e-10 65 38 2 114 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q2FWH7 1.64e-10 68 25 8 264 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q39557 1.94e-10 68 26 8 234 3 PHY2 Phytochrome 2 Ceratodon purpureus
Q8YR50 2.13e-10 67 31 4 132 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P77485 2.27e-10 67 22 4 231 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q7A0W5 2.33e-10 67 27 10 240 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 2.33e-10 67 27 10 240 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 2.33e-10 67 27 10 240 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 2.33e-10 67 27 10 240 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 2.33e-10 67 27 10 240 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 2.33e-10 67 27 10 240 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 2.33e-10 67 27 10 240 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q6GGZ4 2.37e-10 67 27 10 240 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
O31661 2.46e-10 67 23 7 243 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q3M8A7 2.54e-10 67 31 4 132 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P30847 2.56e-10 67 26 8 229 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
Q4L6C5 2.7e-10 67 27 8 231 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
O25918 2.92e-10 64 31 3 129 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
Q6T5K3 2.98e-10 67 23 16 407 2 ETR4 Ethylene receptor 4 Oryza sativa subsp. indica
Q2YY04 2.98e-10 67 27 10 240 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
O31671 3.27e-10 67 28 7 232 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
A7MRY4 3.28e-10 67 24 8 286 1 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio campbellii (strain ATCC BAA-1116)
P0C5S6 3.57e-10 67 24 8 287 3 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio harveyi
P42245 3.59e-10 65 25 7 228 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q8XBY4 3.81e-10 66 22 4 227 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
P15939 5.73e-10 66 21 14 407 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P0DMK6 5.87e-10 66 22 4 211 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
Q7D9K0 6.16e-10 63 33 2 114 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 6.16e-10 63 33 2 114 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q5HHW5 6.3e-10 65 25 9 263 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 6.3e-10 65 25 9 263 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 6.3e-10 65 25 9 263 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q840P7 7.14e-10 65 25 9 263 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q9M8Y4 8.38e-10 61 27 2 120 2 ARR22 Two-component response regulator ARR22 Arabidopsis thaliana
Q04804 8.46e-10 65 27 8 209 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P9WGL2 1e-09 65 23 7 251 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WGL3 1.04e-09 65 23 7 251 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7F239 1.19e-09 65 22 15 421 2 ETR4 Ethylene receptor 4 Oryza sativa subsp. japonica
Q54SK5 1.21e-09 66 37 4 121 3 dhkM Hybrid signal transduction histidine kinase M Dictyostelium discoideum
Q86AT9 1.24e-09 65 30 3 120 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 1.54e-08 62 30 5 189 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 5.02e-08 60 39 2 87 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q742C0 1.33e-09 65 23 7 230 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8XA47 1.34e-09 65 23 7 226 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q7A1J2 1.49e-09 64 24 9 263 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1.49e-09 64 24 9 263 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1.49e-09 64 24 9 263 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1.49e-09 64 24 9 263 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1.49e-09 64 24 9 263 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GIT7 1.5e-09 63 24 9 263 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
I1WSZ3 1.7e-09 64 22 4 211 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
A3Q5L8 1.8e-09 64 24 7 231 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q1B3X9 1.88e-09 64 24 7 231 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 1.88e-09 64 24 7 231 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
O34971 1.95e-09 65 24 6 234 3 kdpD Sensor protein KdpD Rathayibacter rathayi
Q40762 2.31e-09 65 25 7 247 2 None Phytochrome Picea abies
Q07084 2.51e-09 64 30 5 157 1 SSK1 Osmolarity two-component system protein SSK1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0QBR0 2.6e-09 64 23 7 230 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q9Z5G7 3.86e-09 63 25 8 225 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
Q04943 3.86e-09 63 25 9 268 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P16497 4.74e-09 63 25 6 248 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
P52101 5.02e-09 63 22 7 226 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
P18769 6.56e-09 63 31 1 118 1 frzE Gliding motility regulatory protein Myxococcus xanthus
P37739 7.11e-09 63 23 13 348 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
Q881J7 7.64e-09 62 26 7 203 1 PSPTO_2896 Blue-light-activated protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5AKU6 8.07e-09 62 31 5 155 1 SSK1 Oxidative stress response two-component system protein SSK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
O14283 9.24e-09 62 35 3 104 1 prr1 Transcription factor prr1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P76340 9.25e-09 60 34 2 113 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
P43501 9.74e-09 57 30 0 113 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q01549 1.03e-08 62 24 5 245 3 PHY1 Phytochrome 1 Selaginella martensii
P9WGN1 1.14e-08 59 28 8 198 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 1.14e-08 59 28 8 198 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P06594 1.28e-08 62 26 10 240 1 PHYA4 Phytochrome A type 4 Avena sativa
Q44006 1.35e-08 59 29 3 150 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9K620 1.42e-08 60 25 7 234 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5A872 1.46e-08 62 31 2 148 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A872 4.58e-07 57 40 1 77 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A872 1.25e-06 56 27 4 131 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q4ZSY3 1.66e-08 61 26 7 201 3 Psyr_2700 Blue-light-activated protein Pseudomonas syringae pv. syringae (strain B728a)
P23222 1.67e-08 61 25 17 402 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P0A4I0 1.79e-08 59 35 2 115 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 1.79e-08 59 35 2 115 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
P76339 2.05e-08 61 26 10 218 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
A0A0H3GPN8 2.11e-08 61 27 8 224 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P37478 2.5e-08 58 34 3 120 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q48IV1 2.85e-08 60 26 7 203 3 PSPPH_2483 Blue-light-activated protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P42244 2.94e-08 58 35 1 109 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
Q4L482 3.69e-08 59 21 5 212 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
P07168 3.71e-08 60 23 14 343 3 virA Wide host range VirA protein Rhizobium radiobacter
B8GZM2 3.8e-08 60 33 0 103 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 3.8e-08 60 33 0 103 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P19862 4.36e-08 60 26 10 258 3 PHYA1 Phytochrome A Zea mays
Q9I4F9 4.37e-08 58 33 1 115 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4L6C6 4.62e-08 57 36 4 115 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
P0ACZ8 4.74e-08 58 30 2 130 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 4.74e-08 58 30 2 130 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 4.74e-08 58 30 2 130 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
A0A4P7TSF2 5.19e-08 59 28 11 242 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 5.19e-08 59 28 11 242 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 5.19e-08 59 28 11 242 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
P26489 5.65e-08 59 24 14 377 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P0A4H8 5.86e-08 57 34 3 112 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 5.86e-08 57 34 3 112 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P39928 6.87e-08 60 31 3 147 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39928 1.05e-07 59 30 9 178 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39928 2.16e-05 52 36 2 91 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P30843 7.54e-08 57 35 1 114 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
Q8DMC5 8.58e-08 58 28 5 160 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9TLQ4 9.03e-08 57 36 4 114 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
O25153 9.62e-08 59 30 4 126 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
P06218 9.73e-08 58 24 14 361 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
Q10DU0 9.88e-08 59 26 10 251 2 PHYA Phytochrome A Oryza sativa subsp. japonica
A2XLG5 9.88e-08 59 26 10 251 3 PHYA Phytochrome A Oryza sativa subsp. indica
P0AE82 1.01e-07 58 27 8 224 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 1.01e-07 58 27 8 224 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 1.01e-07 58 27 8 224 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
P10799 1.06e-07 59 23 14 343 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
P14712 1.27e-07 59 22 6 273 1 PHYA Phytochrome A Arabidopsis thaliana
Q44007 1.36e-07 58 21 4 233 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A0PWB3 1.5e-07 58 23 7 230 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
Q49VK4 1.52e-07 57 27 4 132 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
G0SB31 1.9e-07 58 33 3 112 1 SKN7 Transcription factor SKN7 Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
Q41046 2.13e-07 58 23 8 239 2 None Phytochrome Pinus sylvestris
P73276 2.27e-07 57 35 4 116 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9HV31 2.29e-07 57 24 8 203 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P19906 2.42e-07 57 22 12 344 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
Q49XM7 2.59e-07 55 35 4 114 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P0A4I8 2.98e-07 57 22 7 240 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 2.98e-07 57 22 7 240 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P33639 2.99e-07 57 22 6 226 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0C001 3.19e-07 55 37 2 89 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 3.19e-07 55 37 2 89 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 3.19e-07 55 37 2 89 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 3.19e-07 55 37 2 89 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 3.19e-07 55 37 2 89 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 3.19e-07 55 37 2 89 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 3.19e-07 55 37 2 89 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 3.19e-07 55 37 2 89 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
Q99U73 3.4e-07 55 37 2 89 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
P42422 3.49e-07 56 27 3 118 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
Q8FZ93 3.98e-07 55 28 3 128 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 3.98e-07 55 28 3 128 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 3.98e-07 55 28 3 128 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 3.98e-07 55 28 3 128 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 3.98e-07 55 28 3 128 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 3.98e-07 55 28 3 128 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 3.98e-07 55 28 3 128 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 3.98e-07 55 28 3 128 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
P33113 4.02e-07 57 25 8 228 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
Q9ZHD3 4.57e-07 55 34 3 113 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P09431 4.68e-07 56 25 17 348 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q4WUG7 4.7e-07 57 28 5 170 3 sska Response regulator sskA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
L7N689 4.74e-07 55 34 2 113 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0PWB4 4.93e-07 55 33 1 89 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
A6WZ81 5.26e-07 55 36 1 83 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P13792 5.72e-07 55 31 3 139 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q9HV32 5.84e-07 54 35 5 137 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A2D9 5.89e-07 55 25 8 241 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 5.89e-07 55 25 8 241 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
A1TEL7 5.92e-07 54 33 1 89 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P94413 5.96e-07 54 33 6 126 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q9CD68 7.33e-07 54 32 1 94 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
O69730 7.38e-07 54 30 1 108 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P36556 7.4e-07 54 32 1 114 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q08430 7.47e-07 56 23 8 234 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
P39663 8.28e-07 54 30 3 149 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A1KHB8 8.86e-07 55 22 7 224 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 8.86e-07 55 22 7 224 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P08982 9.02e-07 55 26 9 223 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 9.02e-07 55 26 9 223 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P0AFB7 9.26e-07 55 25 8 241 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 9.26e-07 55 25 8 241 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 9.26e-07 55 25 8 241 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
Q8XBS3 9.95e-07 53 33 2 113 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
A7N6S2 1.03e-06 56 24 14 330 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
P39664 1.18e-06 55 22 3 187 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q02482 1.21e-06 55 28 5 138 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
A0R3I7 1.21e-06 55 23 9 239 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P52076 1.23e-06 53 33 2 113 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
A1TEL6 1.31e-06 55 23 8 232 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
O06979 1.38e-06 55 28 3 114 3 yvcQ Sensor histidine kinase YvcQ Bacillus subtilis (strain 168)
A1KHB7 1.4e-06 53 33 1 89 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 1.4e-06 53 33 1 89 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q742C1 1.43e-06 53 33 1 89 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 1.43e-06 53 33 1 89 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
P06593 1.47e-06 55 26 11 253 1 PHYA3 Phytochrome A type 3 Avena sativa
B8H358 1.58e-06 53 30 1 115 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 1.58e-06 53 30 1 115 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q4L8M0 1.75e-06 55 24 6 222 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
P66795 1.81e-06 53 33 1 112 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 1.81e-06 53 33 1 112 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
P9WGL1 1.82e-06 55 22 7 224 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 1.82e-06 55 22 7 224 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 1.82e-06 55 22 7 224 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q1B3X8 1.84e-06 53 33 1 89 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 1.84e-06 53 33 1 89 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 1.84e-06 53 33 1 89 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q9AE24 2.18e-06 53 32 3 112 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
P9WGM9 2.24e-06 53 33 1 89 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 2.24e-06 53 33 1 89 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 2.24e-06 53 33 1 89 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P93526 2.35e-06 55 25 10 258 2 PHYA Phytochrome a Sorghum bicolor
Q47745 2.5e-06 54 24 5 195 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
P08401 2.99e-06 54 21 3 202 1 creC Sensor protein CreC Escherichia coli (strain K12)
P33529 3.03e-06 54 23 7 244 2 PHY Phytochrome Mougeotia scalaris
P48259 3.17e-06 52 33 6 148 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
Q03069 3.58e-06 53 22 6 245 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
Q8CQ17 3.72e-06 52 30 4 132 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 3.72e-06 52 30 4 132 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q87MX7 3.74e-06 53 33 2 112 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P30733 3.87e-06 54 23 8 269 2 PHYA Phytochrome A Solanum tuberosum
Q01473 3.93e-06 54 30 4 143 3 rcaC Protein RcaC Microchaete diplosiphon
Q7MM78 4.04e-06 53 33 2 112 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 4.04e-06 53 33 2 112 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P0C5S5 4.41e-06 53 33 2 112 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 4.41e-06 53 33 2 112 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q4LAJ9 4.42e-06 52 37 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
P51586 4.48e-06 50 31 2 119 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
P28835 4.59e-06 52 36 2 96 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
Q55890 4.72e-06 52 30 0 93 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7A1J1 4.8e-06 52 32 5 115 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 4.8e-06 52 32 5 115 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 4.8e-06 52 32 5 115 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 4.8e-06 52 32 5 115 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 4.8e-06 52 32 5 115 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 4.8e-06 52 32 5 115 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 4.8e-06 52 32 5 115 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 4.8e-06 52 32 5 115 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 4.8e-06 52 32 5 115 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 4.8e-06 52 32 5 115 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q9KQD5 4.83e-06 50 30 3 120 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 4.83e-06 50 30 3 120 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A0R3I8 4.96e-06 52 31 3 116 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P55701 4.96e-06 52 34 1 89 4 NGR_a00800 Probable transcriptional regulatory protein y4xI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q49ZT9 5.04e-06 53 22 5 237 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2HWG1 5.09e-06 49 28 2 116 2 RR12 Two-component response regulator ORR12 Oryza sativa subsp. japonica
Q31S42 5.15e-06 52 35 0 67 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P93528 5.36e-06 53 23 7 247 2 PHYC Phytochrome C Sorghum bicolor
Q9HWA7 5.78e-06 53 25 14 285 1 pprA Two-component sensor PprA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02541 5.94e-06 53 24 5 199 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q1XDE4 6.03e-06 51 28 2 134 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P54443 6.49e-06 51 35 2 113 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
P41406 6.64e-06 53 26 9 223 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
Q9KT84 7.57e-06 52 29 1 111 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P21866 7.58e-06 51 36 1 111 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q51455 7.94e-06 49 31 4 121 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HU20 8.54e-06 53 22 5 226 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P48359 9.02e-06 50 28 0 95 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
Q9F868 9.34e-06 51 33 1 114 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q70FH0 9.49e-06 51 31 1 112 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
O33071 9.83e-06 52 27 11 244 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
P9WGL9 1.01e-05 51 33 1 113 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 1.01e-05 51 33 1 113 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 1.01e-05 51 33 1 113 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
C5M3F1 1.04e-05 51 29 2 116 3 SRR1 Stress response regulator protein 1 Candida tropicalis (strain ATCC MYA-3404 / T1)
P45337 1.06e-05 50 29 2 123 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8CQK0 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A216 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 1.12e-05 50 36 2 94 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 1.12e-05 50 36 2 94 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 1.12e-05 50 36 2 94 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 1.12e-05 50 36 2 94 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS18300
Feature type CDS
Gene arcB
Product aerobic respiration two-component sensor histidine kinase ArcB
Location 4018571 - 4020907 (strand: 1)
Length 2337 (nucleotides) / 778 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_713
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00512 His Kinase A (phospho-acceptor) domain
PF00989 PAS fold
PF01627 Hpt domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
PF18415 Histidine kinase receptor ArcB trans-membrane domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07648 two-component system, OmpR family, aerobic respiration control sensor histidine kinase ArcB [EC:2.7.13.3] Two-component system
Biofilm formation - Escherichia coli		 -

Protein Sequence

MKLLKGLAQYYVDLMMRLGLIRFSLLLASALVVLAMVVQMAVTFLLAGDVTSIDLVRSIFFGLIITPWAVYFLSVVVEQLEESRRRLSRMVDKLGVMRQRDLELNSQLKENIEQLNLEIQEREKVEKAHLELLEKLKSEMKRRELTQIELEQQSSLLRSFLDASPDLVYYRNEDNEFSGCNRATELLTGKSEKQLIGLTPLDVYDEDIAVKVMETDEKVFRHNVSLTYEQWLVYPDGRKACFELRKVPFYDRIGKRHGLMGFGRDITERKRYQDALENASRDKTTFISTISHELRTPLNGIVGLSRILLDTELSPEQLNYLKTIHVSAITLGNIFNDVIEMDKIERRKIQLDNQPIDFTEFISDLENLSGLLVQPKGLKFTLEAQETLPHKITTDGTRLRQILWNLIGNAVKFTQEGEIKVRIWQEAPDKLFFEVKDSGIGIPQGELEKIFAMYYQVNDSQGGRSATGTGIGLAVSKRLAQHMGGDIHVESELGHGSIFTLSIVAPAIKEQSDFEEDDELLLPALNILLVEDIELNVIVACSVLEKLGNMVDVAMTGQEALQMFKPGEYDLVLLDIQLPDMTGFDISRKLRQEFDSSELPPLIALTANVLKDKKEYLDAGMNDVLSKPLSVDALTAIINKFWGDEAVSVTSSESPQLLSKNEELLDIDMLNQYIELVGPQLITDGLDVFEKMMPSYLSVLESNLTARDQKGITEEGHKIKGAAGSIGLKHLQQLAKQIQSPELPAWWDNVQEWVDELERDWRKDVESLRNWLADARKK

Flanking regions ( +/- flanking 50bp)

AATGTATTTTTAAGGTATCATTCTCTAGATTCAATCTATTGGAGTTTTCAATGAAATTGCTCAAAGGGCTTGCCCAATATTATGTAGATTTAATGATGAGGCTAGGGTTAATCCGCTTCTCATTACTGTTAGCATCCGCATTGGTTGTATTAGCGATGGTCGTACAGATGGCCGTGACATTCCTACTTGCCGGTGATGTCACTAGTATCGATCTGGTACGCTCTATCTTCTTTGGTTTGATTATTACCCCTTGGGCTGTCTATTTTCTTTCCGTGGTGGTAGAGCAACTTGAAGAATCACGACGTCGTTTATCGCGGATGGTCGATAAATTAGGCGTAATGCGACAGCGAGACTTAGAGCTGAATTCACAATTAAAAGAGAATATTGAGCAATTAAATTTAGAGATCCAAGAGCGTGAAAAAGTAGAAAAAGCCCATCTTGAACTATTGGAAAAACTCAAAAGTGAAATGAAGCGTCGTGAATTGACGCAAATTGAACTAGAGCAACAATCTTCCTTGTTACGCTCCTTCTTAGATGCCTCGCCAGATCTGGTCTACTATCGCAACGAAGATAATGAATTTTCTGGTTGTAACCGTGCTACAGAGCTATTGACCGGTAAAAGTGAAAAGCAATTAATTGGCTTAACACCTCTGGATGTGTATGACGAAGATATCGCCGTCAAAGTGATGGAAACCGATGAGAAAGTCTTTCGCCATAATGTGTCACTCACTTATGAGCAGTGGTTGGTGTATCCGGATGGGCGTAAAGCGTGTTTTGAGTTACGCAAAGTGCCCTTTTATGACCGAATTGGTAAGCGTCACGGCTTAATGGGCTTTGGACGTGACATTACAGAGCGTAAGCGCTATCAAGACGCGTTAGAAAATGCTAGCCGTGATAAGACCACCTTTATTTCTACAATCAGCCATGAGCTACGTACGCCGCTTAATGGGATTGTGGGGTTAAGTCGTATTTTATTGGATACCGAATTATCACCAGAACAGCTCAACTACTTAAAAACTATCCATGTCAGTGCCATAACGTTAGGTAATATTTTTAATGATGTGATTGAAATGGATAAAATTGAGCGCAGAAAGATCCAGCTTGATAATCAACCTATCGACTTTACTGAATTTATCTCTGATTTAGAAAACCTATCGGGATTATTAGTCCAACCTAAAGGGTTAAAATTCACCTTAGAAGCGCAAGAAACGTTACCGCATAAAATTACCACCGATGGGACTCGTTTGCGTCAAATCTTATGGAACTTAATTGGTAATGCGGTGAAATTTACCCAAGAAGGGGAAATTAAAGTACGTATTTGGCAAGAAGCGCCTGATAAGTTGTTCTTTGAGGTGAAAGATAGTGGTATTGGTATCCCTCAAGGTGAACTTGAGAAAATCTTTGCCATGTACTATCAGGTCAACGACAGTCAAGGTGGACGTTCTGCAACGGGAACAGGTATTGGTCTTGCTGTCTCAAAACGCTTAGCACAGCATATGGGAGGCGATATTCATGTGGAGAGTGAGTTAGGACATGGTTCTATCTTTACGCTTTCCATTGTCGCTCCTGCGATTAAAGAGCAAAGTGATTTTGAAGAGGATGATGAATTATTGCTTCCTGCCCTTAATATCTTACTGGTTGAGGATATTGAGCTAAATGTTATCGTAGCATGTTCAGTATTAGAAAAATTAGGCAACATGGTAGATGTGGCGATGACTGGGCAAGAGGCTTTGCAAATGTTTAAGCCGGGTGAATACGATTTAGTGCTGTTAGACATTCAATTACCTGATATGACCGGATTTGATATTTCAAGAAAATTACGTCAAGAGTTTGATAGCAGTGAATTGCCGCCATTGATTGCCTTAACCGCCAATGTCTTAAAAGACAAAAAAGAGTATTTAGACGCTGGAATGAATGATGTGCTCAGTAAACCGCTTTCTGTGGATGCGTTGACAGCCATTATTAATAAATTCTGGGGAGATGAAGCGGTTTCCGTGACATCTAGTGAGTCACCTCAATTGTTGAGTAAAAATGAAGAGTTACTCGATATCGACATGCTGAATCAATACATCGAACTTGTCGGACCTCAATTAATCACGGATGGTTTAGATGTTTTTGAAAAGATGATGCCAAGTTACCTGTCTGTCCTTGAATCTAATCTGACGGCACGTGATCAAAAGGGCATCACTGAGGAAGGACATAAAATCAAAGGCGCGGCAGGCTCTATAGGTTTAAAACATTTACAGCAACTGGCAAAACAGATCCAATCTCCAGAATTACCTGCATGGTGGGATAATGTTCAGGAATGGGTAGACGAGTTAGAAAGAGATTGGAGAAAGGATGTAGAAAGTTTAAGAAACTGGTTGGCAGACGCTAGAAAAAAATAACCCCAACCGAAGGTTGGGGTGCGCGAATACTGCGCCAACACCAGGGAAAC