Homologs in group_784

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03095 FBDBKF_03095 92.5 Morganella morganii S1 arcB aerobic respiration two-component sensor histidine kinase ArcB
EHELCC_07440 EHELCC_07440 92.5 Morganella morganii S2 arcB aerobic respiration two-component sensor histidine kinase ArcB
NLDBIP_07765 NLDBIP_07765 92.5 Morganella morganii S4 arcB aerobic respiration two-component sensor histidine kinase ArcB
LHKJJB_07300 LHKJJB_07300 92.5 Morganella morganii S3 arcB aerobic respiration two-component sensor histidine kinase ArcB
HKOGLL_03630 HKOGLL_03630 92.5 Morganella morganii S5 arcB aerobic respiration two-component sensor histidine kinase ArcB
PMI_RS18300 PMI_RS18300 76.1 Proteus mirabilis HI4320 arcB aerobic respiration two-component sensor histidine kinase ArcB

Distribution of the homologs in the orthogroup group_784

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_784

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AEC4 0.0 1102 71 4 779 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 0.0 1102 71 4 779 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 0.0 1102 71 4 779 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P44578 9.93e-58 202 51 2 211 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44578 2.44e-15 81 43 0 95 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HUI3 1.42e-52 201 33 16 514 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P58356 2.2e-51 197 29 13 492 3 torS Sensor protein TorS Escherichia coli O157:H7
Q8D5Z6 2.95e-51 196 33 6 365 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
P16575 6.78e-51 196 29 16 545 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7MD16 9.44e-51 194 33 6 365 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q9P896 2.54e-50 191 31 15 448 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P40330 4.19e-50 194 29 14 544 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P39453 1.5e-49 191 28 12 491 1 torS Sensor protein TorS Escherichia coli (strain K12)
P26762 1.57e-49 192 29 14 544 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P54302 2.15e-48 187 29 8 409 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
Q87GU5 1.36e-47 185 28 6 407 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P49333 3.58e-47 182 31 8 391 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q9XH58 1.54e-46 181 30 8 396 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q86CZ2 1.62e-46 183 31 12 391 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q9XH57 3.22e-46 180 29 9 398 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
P0C0F6 4.61e-46 179 26 17 573 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9KLK7 5.78e-46 180 31 9 398 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9M7M1 6.27e-46 179 30 10 397 2 ETR1 Ethylene receptor Prunus persica
Q54YZ9 6.29e-46 181 36 7 319 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q54YZ9 2.25e-13 78 35 2 118 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P0C0F7 6.52e-46 179 26 17 573 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P58402 2.05e-45 179 26 22 684 3 evgS Sensor protein EvgS Escherichia coli O157:H7
O49230 2.86e-44 174 29 7 388 2 ETR1 Ethylene receptor 1 Brassica oleracea
P30855 3.64e-44 176 25 19 682 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
O81122 6.31e-44 173 29 8 396 2 ETR1 Ethylene receptor Malus domestica
Q9F8D7 8.95e-44 174 36 6 319 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q9F8D7 4.96e-16 86 30 9 253 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P48027 5.73e-43 171 35 8 333 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P48027 9.08e-14 79 30 7 230 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
O49187 7.26e-43 170 31 10 403 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
P59342 1.14e-42 170 32 10 376 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P59342 2.71e-11 71 25 10 266 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
Q8ZPP5 1.53e-42 170 29 10 427 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O82436 2.27e-42 168 30 8 396 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
P0AEC5 2.45e-42 169 32 10 376 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC5 6.39e-12 73 26 9 261 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 2.45e-42 169 32 10 376 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC6 6.39e-12 73 26 9 261 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 2.45e-42 169 32 10 376 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P0AEC7 6.39e-12 73 26 9 261 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
O48929 6.88e-42 167 28 8 400 2 ETR1 Ethylene receptor Nicotiana tabacum
Q9ZWL6 1.08e-41 166 29 10 394 2 ETR1 Ethylene receptor Passiflora edulis
Q9SSY6 2.22e-41 165 30 8 396 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q9KHI5 2.3e-40 162 34 7 351 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q41342 4.39e-40 161 27 9 400 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q54YH4 1.93e-39 161 36 4 252 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q54YH4 1.17e-10 69 38 4 126 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q5A599 4.58e-39 159 31 11 377 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A599 1.34e-12 75 32 4 165 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q54U87 9.73e-39 159 35 6 262 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q54U87 1.37e-07 59 31 4 120 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q9C5U2 7.98e-38 156 27 12 456 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q9C5U2 1.51e-09 65 29 4 145 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q869S5 1.51e-36 152 36 6 267 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q869S5 2.76e-11 71 34 1 130 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q9C5U1 8.21e-36 149 27 9 444 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q9C5U1 3.55e-09 64 29 4 148 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
P58662 1.21e-34 145 38 2 230 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P58662 1.25e-10 68 33 3 142 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23545 1.55e-34 143 32 6 273 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
P0DMC5 1.91e-34 145 37 2 230 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC5 2.01e-09 65 31 3 136 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC6 2.28e-34 145 37 2 230 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DMC6 9.56e-10 66 31 3 136 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q5AHA0 2.81e-34 145 34 2 242 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5AHA0 4.1e-10 67 38 3 126 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q56128 3.29e-34 144 37 2 230 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q56128 3.41e-11 70 34 3 142 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
A1A696 3.56e-34 144 28 4 342 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
A1A696 6.65e-09 63 29 4 144 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
A2WYI4 3.69e-34 144 28 4 342 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A2WYI4 7.06e-09 63 29 4 144 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
O14002 5.45e-34 144 35 6 253 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54RP6 1.75e-33 142 31 11 361 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q54RP6 8.83e-18 92 34 5 164 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q551X9 4.2e-33 141 29 12 399 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q551X9 9.33e-08 59 31 3 120 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q2T0V9 4.93e-33 139 30 9 384 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8DKG0 8.39e-31 132 34 6 240 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A1A698 1.88e-30 132 26 13 486 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
A1A698 9.16e-13 75 34 5 146 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q52969 5.09e-30 128 31 4 273 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q3S4A7 9.28e-30 130 30 7 302 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q3S4A7 9.64e-16 85 31 5 184 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q95PI2 1.12e-29 130 34 2 220 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
B8AY75 1.33e-29 128 33 4 241 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q0DKM0 1.82e-29 128 33 4 241 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q9P7Q7 1.24e-28 127 27 11 394 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P7Q7 2.56e-09 65 31 3 137 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A1A697 7.85e-28 124 25 10 454 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
A1A697 1.28e-07 59 27 5 151 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
Q45614 6.77e-27 120 31 10 274 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q53RH0 2.97e-26 118 32 5 252 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 2.97e-26 118 32 5 252 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
P37894 3.97e-26 118 32 9 247 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P35164 8.35e-26 116 29 11 292 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
Q03228 1.07e-25 116 27 10 381 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P74111 4.51e-25 115 31 8 278 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q54SP4 8.87e-25 115 29 6 284 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 1.41e-14 82 25 8 274 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 0.000109 49 32 4 126 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
T2KMF4 3.85e-24 112 26 9 387 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q9C5U0 1.19e-23 110 32 1 213 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q9C5U0 4.49e-08 60 33 4 129 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q9C5U0 8.13e-07 56 30 3 133 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
A9M715 1.4e-23 110 27 7 291 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q8FZ86 1.42e-23 110 27 7 291 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 1.49e-23 110 28 8 292 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
A6X5X4 1.55e-23 110 27 7 296 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q57BR6 1.79e-23 110 28 7 291 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 1.79e-23 110 28 7 291 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 1.79e-23 110 28 7 291 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q8YIM6 1.85e-23 110 28 7 291 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
E0X9C7 3.29e-23 109 25 11 436 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 1.93e-09 65 21 13 411 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
A5W4E3 3.32e-23 109 25 11 436 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 2.1e-09 65 21 13 411 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5VRX4 1.53e-22 107 27 7 291 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A1A699 2.44e-22 106 35 1 165 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
A1A699 2.33e-13 77 31 9 226 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
A1A699 4.8e-09 63 29 4 140 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
Q9SXL4 1.26e-21 104 28 4 266 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9SXL4 3.55e-06 54 30 4 143 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9ZTP3 1.76e-20 100 24 9 387 1 EIN4 Protein EIN4 Arabidopsis thaliana
Q7A5H7 2.15e-20 99 28 11 277 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 2.15e-20 99 28 11 277 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GGK7 2.45e-20 99 29 10 261 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q8KIY1 2.49e-20 100 25 11 423 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 3.71e-10 67 23 9 263 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8NWF3 2.88e-20 99 28 11 277 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 2.88e-20 99 28 11 277 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 2.88e-20 99 28 11 277 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 2.88e-20 99 28 11 277 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9L523 3.28e-20 99 29 10 261 1 srrB Sensor protein SrrB Staphylococcus aureus
A5A2P0 6.92e-20 96 26 9 266 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q0IBF4 7.47e-20 95 31 10 245 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
A2C884 9.04e-20 95 30 9 234 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q38846 1.01e-19 97 29 3 248 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
Q8DPL8 1.12e-19 96 27 7 232 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 1.12e-19 96 27 7 232 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P23621 1.9e-19 95 31 9 263 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7U871 2.15e-19 94 31 9 235 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q7V6P7 2.21e-19 94 29 9 234 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q3AYV8 2.33e-19 94 31 10 248 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
A0QR01 2.42e-19 94 28 4 242 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7BWI3 2.59e-19 94 29 9 243 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q8DMT2 4.65e-19 93 31 8 236 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
O22267 6.79e-19 95 29 9 293 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
Q06067 8.62e-19 94 25 11 351 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q9RQQ9 9.65e-19 94 27 5 253 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q6T5K2 3.41e-18 93 23 9 388 2 ETR3 Ethylene receptor 3 Oryza sativa subsp. indica
Q9RDT3 4.75e-18 90 25 7 263 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q9APE0 4.87e-18 91 29 7 255 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
P54883 4.99e-18 91 29 4 244 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
O74539 6.6e-18 92 26 6 265 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O74539 1.15e-05 53 28 4 128 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A6QD58 6.89e-18 91 26 8 263 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q7A215 7.14e-18 91 26 8 263 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 7.14e-18 91 26 8 263 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 7.14e-18 91 26 8 263 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 7.14e-18 91 26 8 263 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 7.14e-18 91 26 8 263 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 7.14e-18 91 26 8 263 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 7.14e-18 91 26 8 263 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 7.14e-18 91 26 8 263 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 7.14e-18 91 26 8 263 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 7.14e-18 91 26 8 263 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 7.14e-18 91 26 8 263 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 7.14e-18 91 26 8 263 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GKS6 8.21e-18 91 26 8 263 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
B1WYT4 1.11e-17 89 27 9 268 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
A3PDI2 1.38e-17 89 30 8 224 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
P20169 3.23e-17 89 30 8 260 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0DWC7 3.97e-17 89 23 10 392 2 ETR3 Ethylene receptor 3 Oryza sativa subsp. japonica
Q55168 4.46e-17 89 27 8 233 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1XD95 4.52e-17 89 30 7 236 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
A2BRQ6 7.77e-17 86 29 8 224 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
Q7XX84 7.84e-17 89 21 10 407 1 ETR2 Ethylene receptor 2 Oryza sativa subsp. japonica
Q8CU87 8.1e-17 88 26 9 269 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 8.1e-17 88 26 9 269 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O34206 9.78e-17 88 26 6 245 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
Q31AE8 1.03e-16 86 35 4 147 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
Q0WPQ2 1.04e-16 88 23 14 406 1 ETR2 Ethylene receptor 2 Arabidopsis thaliana
Q4A159 1.17e-16 87 26 8 261 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A8G5E7 1.24e-16 85 35 4 147 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
E5KK10 1.53e-16 88 28 10 241 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q8H1X1 1.87e-16 87 21 10 407 2 ETR2 Ethylene receptor 2 Oryza sativa subsp. indica
P9WGK5 1.96e-16 85 28 5 242 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 1.96e-16 85 28 5 242 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 1.96e-16 85 28 5 242 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q55E44 2.15e-16 87 33 0 147 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q55E44 3.44e-08 61 44 2 74 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q55E44 1.39e-06 55 31 4 122 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q4LAJ8 2.59e-16 86 25 7 264 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
P51392 3.52e-16 86 27 6 243 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q7V113 8.02e-16 83 34 4 147 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
P9WGK8 1.09e-15 84 28 6 221 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 1.09e-15 84 28 6 221 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGK9 1.12e-15 84 28 6 221 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P37461 1.18e-15 84 29 5 223 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5SML4 1.22e-15 85 25 8 309 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
Q5SML4 5.51e-08 60 29 3 124 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
A2YA15 1.22e-15 85 25 8 309 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
A2YA15 5.51e-08 60 29 3 124 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
P94414 1.3e-15 84 24 5 266 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
Q54W36 1.45e-15 85 32 1 161 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54W36 7.59e-11 69 50 1 69 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54W36 3.23e-07 58 31 5 129 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q9CCJ1 1.71e-15 84 27 5 221 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
P42245 1.95e-15 81 28 9 227 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q8Z332 2.03e-15 83 28 5 223 3 zraS Sensor histidine kinase ZraS Salmonella typhi
B7K3M6 3.15e-15 82 24 6 264 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q9LCC2 3.26e-15 83 28 9 233 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q08408 4.26e-15 82 25 6 230 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
O34638 7.85e-15 81 25 7 224 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q9P4U6 1.05e-14 82 26 9 312 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9P4U6 0.00063 47 35 2 74 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9R6X3 2.43e-14 80 26 6 234 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A0QTK3 3.15e-14 80 27 6 221 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P39764 3.22e-14 79 22 11 392 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
P21865 5.03e-14 79 27 8 242 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q55932 6.03e-14 78 27 3 220 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P14377 7.84e-14 78 27 4 213 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q54Q69 8.87e-14 79 30 2 154 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q54Q69 5.99e-12 73 36 2 120 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q54Q69 0.000127 49 40 2 71 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q04943 1.14e-13 78 26 9 275 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P94608 1.36e-13 78 26 8 253 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q93CB7 1.48e-13 77 27 7 222 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P0DOA0 1.94e-13 78 34 5 182 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
B7KFU0 2.34e-13 76 23 8 266 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q2YY04 2.58e-13 76 27 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A0W5 2.7e-13 76 27 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 2.7e-13 76 27 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 2.7e-13 76 27 9 238 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 2.7e-13 76 27 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 2.7e-13 76 27 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 2.7e-13 76 27 9 238 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 2.7e-13 76 27 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q6GGZ4 2.95e-13 76 27 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
O31661 3.11e-13 77 22 7 257 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q07737 3.41e-13 76 27 9 243 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8X614 6.32e-13 75 27 4 213 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
B2J946 7.16e-13 74 25 8 264 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q55630 8.62e-13 74 24 5 260 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O69729 9.12e-13 75 29 6 223 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q06904 9.19e-13 74 35 2 114 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9ZHD4 1.18e-12 74 26 7 240 3 silS Probable sensor kinase SilS Salmonella typhimurium
A0A0H3GPN8 1.21e-12 74 28 7 231 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q2JKD9 1.38e-12 73 35 3 129 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
B0JK50 1.4e-12 73 34 3 129 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
P0A4I6 1.63e-12 73 26 7 238 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 1.63e-12 73 26 7 238 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q2JWK9 2.18e-12 73 34 3 132 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q8CTI3 2.65e-12 72 27 8 267 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 2.65e-12 72 27 8 267 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A3BE68 2.67e-12 74 29 4 147 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A3BE68 1.15e-11 72 32 2 139 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A3BE68 1.55e-10 68 40 3 89 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A2YFR6 2.78e-12 74 29 4 147 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A2YFR6 1.18e-11 72 32 2 139 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A2YFR6 1.69e-10 68 40 3 89 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
Q04804 3.42e-12 73 26 9 268 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P72292 3.66e-12 73 28 8 244 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q8CSL7 3.82e-12 72 30 12 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P30733 4.38e-12 73 24 14 363 2 PHYA Phytochrome A Solanum tuberosum
Q8YR50 5.57e-12 72 25 7 266 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3M8A7 7.34e-12 71 25 7 266 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P10955 1.08e-11 71 24 17 415 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
P9WGL2 1.14e-11 72 26 11 287 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0AE82 1.15e-11 71 27 7 228 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 1.15e-11 71 27 7 228 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 1.15e-11 71 27 7 228 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q4L6C5 1.16e-11 71 29 8 231 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
P9WGL3 1.2e-11 72 26 11 287 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P08400 1.33e-11 71 26 9 275 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
Q5HPC4 1.35e-11 71 28 11 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A6X580 1.56e-11 65 33 3 123 3 divK Polar-differentiation response regulator DivK Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P71380 1.65e-11 70 23 12 286 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q40762 1.74e-11 72 25 6 244 2 None Phytochrome Picea abies
P36505 2.02e-11 71 24 11 347 2 PHY1 Phytochrome 1 Physcomitrium patens
P77485 2.16e-11 70 24 5 237 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
P06594 2.85e-11 71 28 10 240 1 PHYA4 Phytochrome A type 4 Avena sativa
Q49XM6 2.88e-11 70 26 7 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P52101 2.91e-11 70 23 4 225 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q49ZT9 3.33e-11 70 25 7 239 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5A4X5 3.74e-11 70 31 3 145 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
O34989 4.23e-11 70 24 6 236 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
P45609 4.29e-11 69 25 8 265 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q2FWH7 4.31e-11 70 25 6 253 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8GP19 4.54e-11 69 25 3 216 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q39557 5.07e-11 70 24 12 354 3 PHY2 Phytochrome 2 Ceratodon purpureus
Q01549 5.27e-11 70 25 7 252 3 PHY1 Phytochrome 1 Selaginella martensii
Q8XA47 6.17e-11 69 23 4 225 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q8FW53 6.35e-11 63 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella suis biovar 1 (strain 1330)
A9WYT1 6.35e-11 63 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VUU3 6.35e-11 63 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YC73 6.35e-11 63 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBQ2 6.35e-11 63 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q7BBW0 6.35e-11 63 31 2 121 1 divK Polar-differentiation response regulator DivK Brucella abortus biovar 1 (strain 9-941)
Q2YKN1 6.35e-11 63 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain 2308)
B2SB45 6.35e-11 63 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain S19)
P73276 7.83e-11 68 37 4 124 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P38889 8.1e-11 69 31 3 122 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
I1WSZ3 1.02e-10 68 25 5 227 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q8FK37 1.17e-10 68 24 5 237 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XBY4 1.23e-10 68 25 6 235 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q75KW7 1.24e-10 63 39 5 123 3 RR41 Two-component response regulator ORR41 Oryza sativa subsp. japonica
P0DMK6 1.58e-10 67 25 5 227 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
Q5A872 2.41e-10 68 32 4 155 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A872 1.14e-07 59 40 2 89 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A872 9.66e-07 56 28 4 127 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P30847 2.53e-10 67 25 8 240 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
A7HD43 2.75e-10 66 26 9 226 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
A7MRY4 2.85e-10 67 25 8 290 1 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio campbellii (strain ATCC BAA-1116)
P0C5S6 3e-10 67 25 8 290 3 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio harveyi
P45608 3.03e-10 66 24 14 359 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
Q881J7 3.34e-10 67 29 9 224 1 PSPTO_2896 Blue-light-activated protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q41046 3.41e-10 67 25 10 268 2 None Phytochrome Pinus sylvestris
O34971 3.82e-10 67 25 8 231 3 kdpD Sensor protein KdpD Rathayibacter rathayi
P19862 4.8e-10 67 28 10 253 3 PHYA1 Phytochrome A Zea mays
Q47745 5.71e-10 65 25 5 201 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q48IV1 7.17e-10 65 28 9 225 3 PSPPH_2483 Blue-light-activated protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P16497 7.22e-10 66 24 7 249 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
Q5HHW5 8.15e-10 65 26 8 253 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 8.15e-10 65 26 8 253 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 8.15e-10 65 26 8 253 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q840P7 8.52e-10 64 26 8 253 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
P87323 1.29e-09 65 29 4 151 4 mcs4 Response regulator mcs4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q2YSS1 1.45e-09 63 22 10 283 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P33639 1.55e-09 65 25 8 226 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q03069 1.58e-09 64 23 6 227 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
Q47457 1.63e-09 64 24 3 214 3 pcoS Probable sensor protein PcoS Escherichia coli
Q10DU0 1.74e-09 65 25 9 256 2 PHYA Phytochrome A Oryza sativa subsp. japonica
A2XLG5 1.74e-09 65 25 9 256 3 PHYA Phytochrome A Oryza sativa subsp. indica
Q7A1J2 2.26e-09 63 26 8 253 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 2.26e-09 63 26 8 253 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q6GIT7 2.26e-09 63 26 8 253 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q7A6V4 2.26e-09 63 26 8 253 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 2.26e-09 63 26 8 253 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 2.26e-09 63 26 8 253 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4L482 2.47e-09 63 21 7 238 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
Q4L8M0 2.96e-09 63 25 6 222 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
P93526 3.27e-09 64 27 12 256 2 PHYA Phytochrome a Sorghum bicolor
P06593 3.62e-09 64 27 10 240 1 PHYA3 Phytochrome A type 3 Avena sativa
P33530 3.71e-09 64 26 10 269 3 PHYA1 Phytochrome A1 Nicotiana tabacum
Q7A6Z3 3.85e-09 62 23 11 276 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 3.85e-09 62 23 11 276 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 3.85e-09 62 23 11 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 3.85e-09 62 23 11 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 3.85e-09 62 23 11 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8DMC5 4.78e-09 62 26 6 220 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P26489 5.92e-09 63 24 16 382 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q4ZSY3 6.31e-09 63 27 9 224 3 Psyr_2700 Blue-light-activated protein Pseudomonas syringae pv. syringae (strain B728a)
A8Z182 7.01e-09 62 23 11 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 7.01e-09 62 23 11 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 7.01e-09 62 23 11 276 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 7.01e-09 62 23 11 276 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 7.01e-09 62 23 11 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q8NXR5 7.33e-09 62 23 11 276 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 7.33e-09 62 23 11 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
A0PWB4 9.03e-09 60 35 1 108 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
F4JZT3 9.15e-09 58 31 3 118 2 ARR24 Two-component response regulator 24 Arabidopsis thaliana
O49934 1.04e-08 62 24 9 268 2 PHYA Phytochrome A Populus tremuloides
A7N6S2 1.16e-08 62 24 13 327 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q54SK5 1.19e-08 62 34 4 121 3 dhkM Hybrid signal transduction histidine kinase M Dictyostelium discoideum
P23222 1.28e-08 62 24 9 287 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q86AT9 1.31e-08 62 29 2 167 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 1.44e-08 62 30 4 120 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 1.1e-06 56 32 2 93 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
O25918 1.34e-08 59 34 4 123 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
P06592 1.42e-08 62 22 15 422 2 PHYA Phytochrome A Cucurbita pepo
A1TEL7 1.5e-08 59 34 1 107 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P33529 1.56e-08 62 24 6 244 2 PHY Phytochrome Mougeotia scalaris
O34903 1.8e-08 59 34 3 124 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
P14712 2.52e-08 61 22 12 353 1 PHYA Phytochrome A Arabidopsis thaliana
Q742C1 2.8e-08 58 34 1 107 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 2.8e-08 58 34 1 107 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
A1KHB7 2.87e-08 58 34 1 108 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 2.87e-08 58 34 1 108 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P15001 2.91e-08 61 22 13 368 3 PHYA Phytochrome A Pisum sativum
P45337 2.94e-08 58 32 2 117 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WGM9 3.94e-08 58 34 1 108 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 3.94e-08 58 34 1 108 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 3.94e-08 58 34 1 108 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q9HV31 4.06e-08 60 26 6 204 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7D9K0 4.07e-08 58 30 5 139 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 4.07e-08 58 30 5 139 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P39663 4.94e-08 58 34 4 154 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A0R3I8 6.58e-08 57 34 1 108 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P76339 6.94e-08 59 25 7 210 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
P93673 7.19e-08 60 22 13 359 3 PHYA Phytochrome type A Lathyrus sativus
P15939 7.86e-08 59 20 8 286 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9CD68 8.55e-08 57 34 1 107 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
O31671 1.13e-07 58 22 4 230 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
P42422 1.4e-07 57 28 3 114 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
Q1B3X8 1.42e-07 56 34 1 107 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 1.42e-07 56 34 1 107 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 1.42e-07 56 34 1 107 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
P39928 1.54e-07 58 32 5 142 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39928 1.57e-05 52 30 6 138 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39928 0.000514 47 35 2 82 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P18769 1.64e-07 58 31 1 119 1 frzE Gliding motility regulatory protein Myxococcus xanthus
Q9I4F9 1.72e-07 56 36 1 105 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8XBS3 1.82e-07 56 35 3 118 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
Q8CQK0 1.88e-07 56 31 4 137 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 1.88e-07 56 31 4 137 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6T5K3 1.93e-07 58 22 13 374 2 ETR4 Ethylene receptor 4 Oryza sativa subsp. indica
Q7A216 2.03e-07 56 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 2.03e-07 56 33 2 112 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 2.03e-07 56 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 2.03e-07 56 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 2.03e-07 56 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 2.03e-07 56 33 2 112 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 2.03e-07 56 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 2.03e-07 56 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 2.03e-07 56 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 2.03e-07 56 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 2.03e-07 56 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 2.03e-07 56 33 2 112 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 2.03e-07 56 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 2.03e-07 56 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 2.03e-07 56 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P52076 2.32e-07 55 35 3 118 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q4A160 2.94e-07 55 33 2 112 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P39664 2.99e-07 57 25 7 253 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O25153 3.32e-07 57 33 4 124 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
Q44006 3.86e-07 55 27 4 163 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9HWA7 3.93e-07 57 25 13 298 1 pprA Two-component sensor PprA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P19906 4.11e-07 56 21 9 280 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
Q9ZHD3 4.27e-07 55 36 3 111 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
Q44007 4.98e-07 56 22 4 240 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q4LAJ9 5.37e-07 55 30 4 137 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
O87939 7.06e-07 56 25 4 156 3 tdiS Sensor protein TdiS Thauera aromatica
P66795 7.11e-07 54 35 3 118 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 7.11e-07 54 35 3 118 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q49VK4 7.11e-07 55 20 9 244 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9KM66 7.55e-07 56 25 6 235 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0A4I0 7.86e-07 54 36 2 111 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 7.86e-07 54 36 2 111 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
P43501 8.08e-07 52 31 0 103 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P76340 1.13e-06 53 31 2 111 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q9HV32 1.24e-06 53 40 3 106 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0ACZ8 1.27e-06 53 32 1 110 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 1.27e-06 53 32 1 110 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 1.27e-06 53 32 1 110 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q6GJ10 1.29e-06 55 21 6 227 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
Q9M8Y4 1.34e-06 52 25 2 120 2 ARR22 Two-component response regulator ARR22 Arabidopsis thaliana
P10578 1.35e-06 55 25 12 261 3 ntrB Sensory histidine kinase/phosphatase NtrB Bradyrhizobium sp. (strain RP501 Parasponia)
P08401 1.39e-06 55 23 4 204 1 creC Sensor protein CreC Escherichia coli (strain K12)
P37478 1.53e-06 53 31 1 108 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q9K620 1.53e-06 54 33 6 139 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P37739 1.66e-06 55 21 15 400 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
P29130 1.77e-06 55 23 7 228 2 PHYB Phytochrome B Nicotiana tabacum
P25852 1.79e-06 55 28 5 166 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O14283 1.84e-06 55 35 3 104 1 prr1 Transcription factor prr1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P09431 1.86e-06 54 24 16 351 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P34094 1.89e-06 55 24 6 228 3 PHYB Phytochrome B Solanum tuberosum
O69730 1.91e-06 53 30 1 107 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
L7N689 1.95e-06 53 31 3 120 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B8GZM2 2.02e-06 54 32 0 103 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 2.02e-06 54 32 0 103 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8Z333 2.14e-06 54 28 5 166 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
A0A4P7TSF2 2.44e-06 54 25 10 233 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 2.44e-06 54 25 10 233 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 2.44e-06 54 25 10 233 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
A0R3I7 2.52e-06 54 24 11 241 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P32040 2.61e-06 53 36 2 115 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q8DPL7 3.06e-06 52 28 2 138 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 3.06e-06 52 28 2 138 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 3.06e-06 52 28 2 138 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9TLQ4 3.11e-06 52 34 5 106 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
Q06240 3.39e-06 53 22 7 220 1 vanS Sensor protein VanS Enterococcus faecium
Q47744 3.6e-06 52 34 4 114 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
Q9HZ47 4.14e-06 53 22 5 219 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AFB7 4.38e-06 53 25 9 240 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 4.38e-06 53 25 9 240 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 4.38e-06 53 25 9 240 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
Q02482 4.43e-06 53 28 4 136 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
Q02540 4.7e-06 52 31 2 111 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
P55141 4.71e-06 54 21 15 379 2 PHYA Phytochrome A Petroselinum crispum
P06218 4.91e-06 53 25 10 241 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
P0A2D9 5.61e-06 53 25 10 241 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 5.61e-06 53 25 10 241 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
Q9ZS62 6.13e-06 53 23 7 228 2 PHYB1 Phytochrome B1 Solanum lycopersicum
A3Q5L8 7.72e-06 53 26 11 234 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q9K997 7.88e-06 53 30 11 226 3 dctS Probable C4-dicarboxylate sensor kinase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P21866 8.22e-06 51 34 1 109 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q6GE72 8.87e-06 52 21 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
Q1B3X9 9.02e-06 52 26 11 234 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 9.02e-06 52 26 11 234 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
Q8NV46 9.26e-06 52 21 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 9.26e-06 52 21 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
P42500 1.07e-05 53 22 14 360 2 PHYA Phytochrome A Glycine max
Q52977 1.23e-05 52 24 10 277 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium meliloti (strain 1021)
Q6BGW4 1.26e-05 50 27 1 106 3 SRR1 Stress response regulator protein 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
O06979 1.31e-05 52 21 7 242 3 yvcQ Sensor histidine kinase YvcQ Bacillus subtilis (strain 168)
O35044 1.35e-05 51 24 9 236 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
Q9RZA4 1.36e-05 52 34 5 123 1 bphP Bacteriophytochrome Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q07084 1.44e-05 52 26 4 150 1 SSK1 Osmolarity two-component system protein SSK1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08430 1.55e-05 52 24 10 238 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
P42707 1.61e-05 52 24 9 220 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
Q49XM7 1.71e-05 50 34 5 112 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7A3X0 1.82e-05 51 21 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 1.82e-05 51 21 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 1.82e-05 51 21 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 1.82e-05 51 21 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 1.82e-05 51 21 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9AE24 2.06e-05 50 30 2 112 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
P13792 2.2e-05 50 29 2 129 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
C5M3F1 2.44e-05 50 29 2 115 3 SRR1 Stress response regulator protein 1 Candida tropicalis (strain ATCC MYA-3404 / T1)
P0C5S5 2.53e-05 51 32 3 102 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 2.53e-05 51 32 3 102 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q01473 2.56e-05 51 33 1 105 3 rcaC Protein RcaC Microchaete diplosiphon
Q4WUG7 2.59e-05 51 36 0 71 3 sska Response regulator sskA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P94413 2.64e-05 49 21 8 228 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
P42496 2.67e-05 51 23 7 246 2 PHY1 Phytochrome 1 Adiantum capillus-veneris
Q7A1J1 2.67e-05 49 30 4 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 2.67e-05 49 30 4 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 2.67e-05 49 30 4 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 2.67e-05 49 30 4 106 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 2.67e-05 49 30 4 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 2.67e-05 49 30 4 106 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 2.67e-05 49 30 4 106 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 2.67e-05 49 30 4 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 2.67e-05 49 30 4 106 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 2.67e-05 49 30 4 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q87MX7 2.81e-05 51 32 3 102 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P0A4I8 3e-05 50 24 7 239 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 3e-05 50 24 7 239 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P0CL17 4.13e-05 49 32 3 106 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 4.13e-05 49 32 3 106 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q2YZ23 4.14e-05 50 21 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4L6C6 4.46e-05 48 34 5 113 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
P35163 4.66e-05 49 29 2 105 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
B8H358 4.91e-05 48 28 1 105 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 4.91e-05 48 28 1 105 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q55890 4.96e-05 49 31 0 88 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5AKU6 5.07e-05 50 29 5 154 1 SSK1 Oxidative stress response two-component system protein SSK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P9WGL9 5.62e-05 48 31 4 139 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 5.62e-05 48 31 4 139 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 5.62e-05 48 31 4 139 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P42244 6.04e-05 48 26 2 143 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
P0AEV3 6.12e-05 49 33 1 103 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 6.12e-05 49 33 1 103 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 6.12e-05 49 33 1 103 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q9F868 6.22e-05 48 34 2 106 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A8Z553 6.85e-05 50 20 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 6.85e-05 50 20 6 251 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 6.85e-05 50 20 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 6.85e-05 50 20 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 6.85e-05 50 20 6 251 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11825
Feature type CDS
Gene arcB
Product aerobic respiration two-component sensor histidine kinase ArcB
Location 519430 - 521763 (strand: 1)
Length 2334 (nucleotides) / 777 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_784
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00512 His Kinase A (phospho-acceptor) domain
PF01627 Hpt domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
PF08448 PAS fold
PF18415 Histidine kinase receptor ArcB trans-membrane domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07648 two-component system, OmpR family, aerobic respiration control sensor histidine kinase ArcB [EC:2.7.13.3] Two-component system
Biofilm formation - Escherichia coli
-

Protein Sequence

MKLLRGLAQYYVDLLMKLGLVRFSLLLASGLVVLAMVVQIAVTILLQGEVQSIDLVRSIFFGLLITPWAVYFMSVVVEQLEESRQRLSRLVSKLEVMRKRDLELNEQLKENISQLNLVITEREKVEGEQVVLMDKLKKEMSRREQTQLEFEQQSVLLRSFLDASPDLVYYRNEKNEFSGCNRAMELLTGRSEKLLRGLTPRDIYETEIADKVMETDEKVFRHNVSLTYEQWLVYPDGRKACFELRKVPFYDSVGKRHGLMGFGRDITERKHYQEAIENASREKTTFISTISHELRTPLNGIVGLSRILLDTELDAEQENYLKTIHVSAVTLGNIFNDVIDMDKLERRNVRLDIQPVNSAEFISDLENLSGLLVHPKGLQFTLDLVPPVPQVLLTDGTRLRQILWNLIGNGVKFTRKGGISVKVWREENDMLYFEVRDSGIGIPQEELEKIFVMYYQVTDSAGGRPATGTGIGLAVSRRLAQAMGGDITVTSEPGKGSCFTLSICAPAQEESAEDEDDGLLLPALNILLVEDIELNVVVARSVLEKLGNTVDVAMNGHDALAMFSPEEYDLVLLDIQLPDMSGLDIARELHRRYQPDDLPPLVALTANVLKDKKEYLDAGMDEVLSKPLAVGALTQVIAKFWGDGTEGLPASEPVQEAAEDVYAQSLDLEMLNQYIELVGPKLIHDSLDVFEKMMPGYLAILNSNMVAKDQKGVAEEGHKIKGAAGSVGLVHLRQVAQQIQSPDLPAWADNVQEWVDELNHDWESQVGILRKWLADRR

Flanking regions ( +/- flanking 50bp)

CGCACATTTTACGATATGATACTAACCCTTATTCAGCGGGTGGAGCAGGTATGAAGTTGCTACGCGGTTTAGCGCAATATTATGTTGATTTACTGATGAAGCTCGGGCTTGTCAGGTTCTCGTTATTACTGGCTTCCGGGCTGGTGGTGCTGGCGATGGTGGTGCAGATTGCCGTCACGATACTGTTGCAGGGAGAAGTGCAGAGTATCGATCTTGTCCGGTCGATTTTCTTCGGGCTGCTTATCACGCCGTGGGCTGTTTATTTTATGTCTGTGGTGGTGGAGCAACTGGAGGAATCCCGCCAGCGTCTGTCGCGTCTGGTGAGCAAACTGGAAGTGATGCGCAAACGGGATCTGGAGCTTAATGAGCAGTTGAAGGAAAACATCAGTCAACTGAATCTGGTTATCACTGAGCGCGAAAAAGTGGAAGGCGAACAGGTTGTCCTGATGGATAAACTGAAAAAAGAGATGAGCCGCCGCGAGCAGACCCAGCTGGAGTTTGAGCAGCAATCTGTTCTGCTGCGCTCTTTTCTGGATGCCTCTCCTGATCTGGTTTACTACCGCAACGAAAAAAATGAATTCTCCGGCTGTAACCGCGCGATGGAACTGCTGACCGGGCGCAGTGAAAAACTGCTGCGCGGGCTGACTCCGCGTGATATCTATGAGACTGAAATTGCTGATAAAGTGATGGAAACGGATGAAAAAGTCTTCCGCCATAATGTCTCTCTCACTTATGAGCAGTGGCTGGTGTATCCGGACGGGCGGAAAGCCTGCTTTGAGCTGCGCAAAGTGCCGTTCTATGACAGTGTCGGCAAGCGCCATGGTCTGATGGGGTTCGGGCGTGATATCACTGAGCGCAAGCATTATCAGGAGGCGATTGAAAACGCCAGCCGTGAAAAAACCACGTTTATCTCCACCATCAGTCACGAATTGCGCACGCCGCTGAACGGCATTGTCGGGCTGAGCCGCATTTTGCTGGATACGGAACTGGACGCGGAGCAGGAAAATTACCTGAAAACCATCCACGTCAGTGCCGTGACACTCGGCAATATCTTCAATGATGTGATTGATATGGATAAACTGGAGCGGCGCAATGTCCGCCTGGATATCCAACCGGTGAATTCAGCTGAGTTTATTTCAGATCTGGAAAATCTCTCCGGGCTGCTGGTTCATCCGAAAGGATTGCAGTTCACGCTTGATCTGGTTCCGCCTGTTCCGCAGGTGCTTCTCACTGACGGCACCCGTCTGCGCCAGATCCTGTGGAATCTGATTGGTAATGGTGTGAAATTTACCCGTAAGGGCGGAATTTCGGTAAAAGTGTGGCGTGAAGAAAATGACATGCTCTATTTTGAGGTCCGCGATTCCGGGATAGGTATCCCGCAGGAAGAGCTGGAAAAAATCTTTGTGATGTATTACCAGGTCACGGACAGTGCAGGCGGGCGTCCGGCAACCGGTACAGGAATTGGTCTGGCGGTTTCCCGCCGTCTGGCACAGGCAATGGGCGGGGACATCACCGTGACCAGTGAGCCGGGCAAAGGCTCCTGTTTTACACTCTCCATTTGCGCACCCGCGCAGGAAGAGTCGGCTGAGGATGAAGATGATGGCCTGCTGCTGCCGGCACTGAATATTCTGCTGGTGGAAGATATTGAGCTGAATGTGGTGGTGGCGCGCTCTGTCCTGGAAAAACTGGGCAATACCGTGGATGTCGCCATGAATGGTCATGACGCACTGGCGATGTTCTCTCCTGAAGAATATGACCTGGTCCTGCTGGATATTCAGTTACCGGATATGAGCGGGCTGGATATTGCCCGTGAACTGCACCGGCGTTATCAGCCGGATGATTTGCCGCCGCTGGTGGCACTGACGGCAAATGTGCTCAAAGATAAAAAAGAGTATCTGGACGCCGGGATGGATGAGGTACTGAGTAAACCGCTTGCTGTCGGCGCTCTGACGCAGGTCATAGCGAAATTCTGGGGAGATGGTACAGAAGGTCTGCCTGCATCTGAACCTGTACAGGAAGCCGCAGAGGACGTTTATGCGCAGTCACTGGATTTGGAGATGCTGAACCAGTACATCGAGCTGGTCGGACCCAAGCTTATCCATGACAGCCTGGATGTGTTTGAAAAAATGATGCCGGGTTATCTGGCAATTCTCAATTCCAATATGGTGGCGAAAGACCAGAAAGGGGTTGCGGAAGAAGGGCACAAAATTAAAGGTGCGGCAGGCTCTGTCGGATTGGTTCACCTGAGACAGGTTGCTCAGCAGATTCAGTCTCCGGATTTACCGGCATGGGCTGATAATGTGCAGGAATGGGTTGATGAACTGAATCATGATTGGGAAAGTCAGGTGGGTATTTTAAGAAAGTGGCTGGCTGATCGCAGATAAAAAATAACCCCAACCGAAGTTGGGGTGCGCGAATACTGCGCCAACACCAG