Homologs in group_784

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03095 FBDBKF_03095 100.0 Morganella morganii S1 arcB aerobic respiration two-component sensor histidine kinase ArcB
EHELCC_07440 EHELCC_07440 100.0 Morganella morganii S2 arcB aerobic respiration two-component sensor histidine kinase ArcB
NLDBIP_07765 NLDBIP_07765 100.0 Morganella morganii S4 arcB aerobic respiration two-component sensor histidine kinase ArcB
LHKJJB_07300 LHKJJB_07300 100.0 Morganella morganii S3 arcB aerobic respiration two-component sensor histidine kinase ArcB
F4V73_RS11825 F4V73_RS11825 92.5 Morganella psychrotolerans arcB aerobic respiration two-component sensor histidine kinase ArcB
PMI_RS18300 PMI_RS18300 77.0 Proteus mirabilis HI4320 arcB aerobic respiration two-component sensor histidine kinase ArcB

Distribution of the homologs in the orthogroup group_784

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_784

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AEC4 0.0 1127 72 3 778 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 0.0 1127 72 3 778 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 0.0 1125 72 3 778 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P44578 2.74e-56 199 49 2 211 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44578 8.38e-16 82 36 2 140 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HUI3 8.76e-53 201 32 15 510 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P58356 3.63e-51 196 29 12 490 3 torS Sensor protein TorS Escherichia coli O157:H7
P39453 6.58e-51 195 29 12 489 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q8D5Z6 1.08e-50 194 31 6 389 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q7MD16 3.46e-50 192 31 6 389 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
P16575 7.15e-50 193 29 14 536 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P54302 2.11e-49 190 29 8 408 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
Q9P896 4.33e-49 187 29 12 444 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P40330 8.67e-49 190 28 11 535 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q87GU5 1.14e-48 188 28 8 412 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P26762 1.95e-48 189 29 14 538 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q86CZ2 6.9e-47 184 30 11 391 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q9KLK7 7.7e-47 182 31 9 400 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0C0F6 4e-46 179 26 18 542 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9XH57 4.96e-46 179 29 10 399 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
P58402 5.78e-46 181 25 22 663 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P0C0F7 6.46e-46 179 26 18 542 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P49333 6.07e-45 176 30 8 383 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q54YZ9 6.83e-45 178 34 6 317 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q54YZ9 2.26e-14 81 37 2 118 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q9M7M1 6.99e-45 176 29 8 396 2 ETR1 Ethylene receptor Prunus persica
Q9XH58 7.38e-45 176 29 7 396 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
P30855 5.55e-44 175 25 20 660 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
P0AEC5 1.57e-43 173 31 10 391 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC5 6.78e-11 69 24 5 229 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 1.57e-43 173 31 10 391 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC6 6.78e-11 69 24 5 229 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 1.57e-43 173 31 10 391 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P0AEC7 6.78e-11 69 24 5 229 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P59342 2.88e-43 172 31 11 391 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P59342 2.98e-10 67 24 5 229 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
Q9F8D7 4.51e-43 172 34 6 319 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q9F8D7 6.93e-16 85 29 7 248 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
O48929 9.29e-43 169 28 8 400 2 ETR1 Ethylene receptor Nicotiana tabacum
Q8ZPP5 1.38e-42 170 29 11 425 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O49230 4.44e-42 167 29 8 380 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q9SSY6 4.74e-42 167 29 8 396 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q41342 5.1e-42 167 28 9 401 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
O81122 5.85e-42 167 28 8 400 2 ETR1 Ethylene receptor Malus domestica
Q9KHI5 7.63e-42 167 34 7 351 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P48027 7.91e-42 168 34 6 319 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P48027 1.05e-12 75 28 5 230 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
O82436 8.95e-42 166 29 9 396 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
O49187 1.22e-41 166 29 8 401 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
Q5A599 1.3e-40 164 29 11 446 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A599 8.97e-13 75 32 4 166 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9ZWL6 2.35e-40 162 28 8 394 2 ETR1 Ethylene receptor Passiflora edulis
Q9C5U2 8.97e-39 159 27 11 456 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q9C5U2 4.94e-10 67 29 4 145 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q54U87 1.45e-38 159 35 5 258 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q54U87 2.05e-08 62 32 4 120 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q54YH4 4.37e-38 157 35 4 252 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q54YH4 3.43e-12 74 38 4 126 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q869S5 7.73e-37 153 35 6 267 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q869S5 2.15e-12 75 34 4 156 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q5AHA0 1.28e-35 149 31 8 314 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5AHA0 9.51e-11 69 38 3 126 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9C5U1 6.01e-35 147 26 9 453 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q9C5U1 3.64e-10 67 28 5 165 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
A2WYI4 2.27e-34 145 27 3 336 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A2WYI4 8.8e-10 66 29 4 144 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A1A696 2.44e-34 145 27 3 336 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
A1A696 9.1e-10 66 29 4 144 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
Q551X9 8.01e-34 143 29 10 396 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q551X9 5.45e-08 60 30 2 119 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
P0DMC5 2.47e-33 141 33 3 262 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC5 1.35e-08 62 31 5 141 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC6 2.8e-33 141 33 3 262 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DMC6 1.18e-08 62 31 5 141 1 rcsC Sensor histidine kinase RcsC Escherichia coli
O14002 3.79e-33 142 34 3 248 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P58662 6.32e-33 140 33 3 262 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P58662 5.87e-10 66 33 4 143 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2T0V9 1.45e-32 137 30 11 387 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q52969 1.59e-32 136 32 6 283 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q56128 1.7e-32 139 33 3 262 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q56128 1.69e-10 68 34 4 143 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q54RP6 8.49e-32 137 34 7 248 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q54RP6 1.81e-19 97 37 5 155 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
A1A697 3.54e-31 135 25 10 451 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
A1A697 1.9e-08 62 27 4 142 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
Q3S4A7 6.85e-31 134 30 7 302 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q3S4A7 1.16e-12 75 30 2 141 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
P23545 7.85e-31 132 30 6 273 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q8DKG0 1.15e-30 132 31 7 301 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q95PI2 2e-30 132 32 4 248 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
A1A698 2.53e-29 129 26 12 473 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
A1A698 7.59e-14 79 31 7 193 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q9P7Q7 1.8e-28 127 26 10 414 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P7Q7 4.64e-09 63 31 3 137 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B8AY75 3.67e-27 120 31 3 241 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
P74111 3.76e-27 121 33 11 276 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0DKM0 4.84e-27 120 31 3 241 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q8FZ86 4.97e-27 121 30 9 295 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 5.1e-27 121 30 9 295 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
A9M715 5.52e-27 121 30 9 292 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57BR6 5.97e-27 121 29 8 294 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 5.97e-27 121 29 8 294 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 5.97e-27 121 29 8 294 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q8YIM6 6.4e-27 121 29 8 294 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P37894 1.07e-26 120 34 8 237 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P35164 1.77e-26 118 29 9 291 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
A5W4E3 2.06e-26 119 25 11 443 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 3.41e-10 67 22 12 404 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A6X5X4 2.27e-26 119 29 8 298 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
E0X9C7 2.6e-26 119 25 11 443 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 3.41e-10 67 22 12 404 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
A5VRX4 5.68e-26 118 29 8 294 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q45614 6.15e-26 117 30 11 273 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q03228 2.22e-25 115 28 11 387 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q53RH0 3.93e-25 114 30 4 252 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 3.93e-25 114 30 4 252 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
T2KMF4 3.05e-24 113 24 12 457 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
A5A2P0 9.71e-24 108 27 9 262 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q9C5U0 1.75e-23 110 32 1 189 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q9C5U0 2.93e-09 64 31 6 177 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q9C5U0 4.84e-07 57 29 3 142 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q8DPL8 2.15e-23 107 30 6 220 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 2.15e-23 107 30 6 220 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9SXL4 2.93e-23 109 28 5 279 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9SXL4 2.02e-06 55 28 5 170 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q38846 3e-23 108 29 3 248 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
Q8KIY1 3.45e-23 109 23 11 466 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 1.71e-13 78 21 12 412 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q54SP4 1.19e-22 108 29 7 285 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 8.7e-16 85 26 8 284 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 3.15e-05 51 30 5 141 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
A1A699 2.53e-22 106 35 1 165 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
A1A699 7.66e-13 76 30 10 233 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
A1A699 1.27e-10 68 28 7 194 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
Q6T5K2 3.07e-22 106 25 11 393 2 ETR3 Ethylene receptor 3 Oryza sativa subsp. indica
Q0DWC7 3.56e-22 105 25 11 393 2 ETR3 Ethylene receptor 3 Oryza sativa subsp. japonica
Q06067 4.17e-22 105 26 11 351 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q9ZTP3 9.47e-22 104 23 12 415 1 EIN4 Protein EIN4 Arabidopsis thaliana
A0QR01 3.63e-21 99 28 5 244 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B1WYT4 7e-21 99 26 5 260 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
O22267 8.29e-21 102 27 7 303 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
Q9APE0 1.38e-20 99 31 7 258 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q9RQQ9 1.68e-20 100 28 5 253 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P23621 1.94e-20 98 31 9 264 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DMT2 1.99e-20 97 31 10 251 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9RDT3 3.71e-20 97 26 9 255 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
A6QD58 5.28e-20 98 26 10 267 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q7A215 5.42e-20 98 26 10 267 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 5.42e-20 98 26 10 267 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 5.42e-20 98 26 10 267 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 5.42e-20 98 26 10 267 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 5.42e-20 98 26 10 267 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 5.42e-20 98 26 10 267 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 5.42e-20 98 26 10 267 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 5.42e-20 98 26 10 267 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 5.42e-20 98 26 10 267 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 5.42e-20 98 26 10 267 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 5.42e-20 98 26 10 267 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 5.42e-20 98 26 10 267 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GKS6 5.81e-20 98 26 10 267 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q4LAJ8 8.47e-20 97 26 9 271 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q7BWI3 1.53e-19 95 29 8 241 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A2C884 1.74e-19 94 31 10 236 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q4A159 2.18e-19 96 27 10 257 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7V6P7 4.36e-19 93 31 10 236 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q8CU87 4.74e-19 95 25 10 268 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 4.74e-19 95 25 10 268 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8Z332 5.73e-19 94 32 5 214 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q7XX84 5.79e-19 95 21 14 413 1 ETR2 Ethylene receptor 2 Oryza sativa subsp. japonica
A3PDI2 6.22e-19 93 31 9 241 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q0IBF4 1.33e-18 92 30 9 253 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
Q8H1X1 1.45e-18 94 21 14 413 2 ETR2 Ethylene receptor 2 Oryza sativa subsp. indica
P37461 1.64e-18 92 31 5 214 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7U871 1.64e-18 92 31 8 225 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
A2BRQ6 2.03e-18 91 30 9 241 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
A8G5E7 4.95e-18 90 30 9 241 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q1XD95 6.45e-18 92 30 6 236 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q3AYV8 7.21e-18 90 31 8 225 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
P94414 8.93e-18 90 28 7 264 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
Q9P4U6 1.31e-17 91 26 8 325 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9P4U6 0.000464 47 29 6 151 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B7K3M6 1.49e-17 89 24 6 264 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q9CCJ1 2.17e-17 90 28 5 221 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
Q31AE8 2.22e-17 88 30 8 225 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
E5KK10 2.46e-17 90 28 7 237 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q55932 3.3e-17 88 29 4 220 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WGK9 5.02e-17 89 27 5 221 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK8 5.11e-17 89 27 5 221 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 5.11e-17 89 27 5 221 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7A5H7 6.34e-17 88 25 8 274 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 6.34e-17 88 25 8 274 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P39764 7.37e-17 87 21 10 392 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q8NWF3 7.54e-17 88 25 8 274 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 7.54e-17 88 25 8 274 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 7.54e-17 88 25 8 274 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 7.54e-17 88 25 8 274 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GGK7 7.81e-17 88 26 7 258 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q9L523 9.72e-17 88 26 7 258 1 srrB Sensor protein SrrB Staphylococcus aureus
B7KFU0 1.21e-16 86 24 7 266 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
O34206 1.83e-16 87 26 6 245 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
Q54W36 2.03e-16 87 33 1 161 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54W36 1.72e-10 68 47 1 73 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54W36 1.18e-06 56 31 5 129 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
P20169 2.23e-16 87 29 10 257 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0WPQ2 2.61e-16 87 24 16 411 1 ETR2 Ethylene receptor 2 Arabidopsis thaliana
P14377 3.75e-16 85 29 4 213 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q7V113 3.87e-16 84 29 7 237 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B0JK50 4.27e-16 84 28 5 229 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
O74539 4.77e-16 87 24 6 265 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q08408 5.46e-16 85 26 6 230 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
Q5SML4 6.86e-16 85 25 10 308 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
Q5SML4 2.31e-08 61 30 4 126 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
A2YA15 6.86e-16 85 25 10 308 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
A2YA15 2.31e-08 61 30 4 126 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
A0QTK3 7e-16 85 28 7 222 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A3BE68 8.8e-16 85 26 8 300 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A3BE68 1.6e-12 75 28 3 147 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A2YFR6 9.18e-16 85 26 8 300 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A2YFR6 1.57e-12 75 28 3 147 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
Q9LCC2 1.15e-15 85 29 10 254 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q93CB7 1.5e-15 84 28 7 222 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q55168 1.55e-15 84 27 9 231 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P21865 1.85e-15 84 27 8 240 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
P9WGK5 2.74e-15 82 27 4 231 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 2.74e-15 82 27 4 231 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 2.74e-15 82 27 4 231 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P54883 3.03e-15 82 27 5 243 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q06904 3.07e-15 82 26 9 255 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O34638 3.35e-15 82 27 8 221 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q8X614 3.7e-15 82 29 4 213 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q8YR50 4.05e-15 81 26 7 267 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P51392 4.08e-15 83 26 5 243 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q55630 4.63e-15 81 25 7 264 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55E44 4.63e-15 83 31 3 166 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q55E44 8.39e-08 60 43 2 74 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q55E44 1.24e-06 56 31 4 122 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
P42245 4.7e-15 80 28 9 225 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
O31661 5.07e-15 82 24 7 257 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q3M8A7 5.8e-15 81 26 7 267 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q04943 8.45e-15 81 27 10 278 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O69729 1.96e-14 80 29 6 223 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL3 2.56e-14 80 27 10 287 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL2 2.67e-14 80 27 10 287 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B2J946 2.7e-14 79 25 7 265 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q9R6X3 5.5e-14 79 25 8 235 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2JKD9 7.8e-14 77 36 3 132 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
P71380 9.05e-14 77 24 12 288 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P38889 9.49e-14 78 24 7 255 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q07737 9.87e-14 78 28 10 245 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2JWK9 1.69e-13 76 34 3 132 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q7A0W5 3.08e-13 76 28 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 3.08e-13 76 28 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 3.08e-13 76 28 9 238 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 3.08e-13 76 28 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 3.08e-13 76 28 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 3.08e-13 76 28 9 238 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 3.08e-13 76 28 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q2YY04 3.25e-13 76 28 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GGZ4 3.31e-13 76 28 9 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
P0DOA0 4.93e-13 76 28 16 356 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
Q9ZHD4 5.23e-13 75 27 7 235 3 silS Probable sensor kinase SilS Salmonella typhimurium
P94608 5.24e-13 76 26 10 257 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P08400 5.25e-13 75 25 9 274 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
P36505 7.74e-13 76 24 11 347 2 PHY1 Phytochrome 1 Physcomitrium patens
O34989 9.04e-13 75 27 9 238 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q54Q69 9.82e-13 76 32 5 159 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q54Q69 3.85e-12 74 36 2 120 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q54Q69 0.000185 49 40 2 71 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
P73276 9.99e-13 74 37 3 125 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q39557 1.3e-12 75 25 14 354 3 PHY2 Phytochrome 2 Ceratodon purpureus
Q8CSL7 1.4e-12 74 29 6 236 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P45609 2.04e-12 73 25 8 264 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q8CTI3 2.04e-12 72 27 8 266 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 2.04e-12 72 27 8 266 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P72292 2.8e-12 73 27 8 244 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q4L6C5 2.97e-12 73 29 8 231 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
P77485 3.31e-12 73 23 5 235 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q40762 4.75e-12 73 25 6 244 2 None Phytochrome Picea abies
Q5HPC4 6.19e-12 72 29 6 236 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P37739 7.38e-12 72 23 15 398 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
Q04804 7.82e-12 72 28 9 231 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8XBY4 8.73e-12 72 24 5 231 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
P10955 1.04e-11 71 22 15 407 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
Q49XM6 1.11e-11 71 26 7 237 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P30847 1.23e-11 71 25 6 234 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
A6X580 1.35e-11 65 32 2 121 3 divK Polar-differentiation response regulator DivK Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P23222 1.52e-11 71 27 11 284 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q01549 1.62e-11 72 25 6 238 3 PHY1 Phytochrome 1 Selaginella martensii
Q41046 1.83e-11 71 24 9 268 2 None Phytochrome Pinus sylvestris
I1WSZ3 2.12e-11 70 25 4 225 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q8FK37 2.16e-11 70 23 5 235 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1TEL7 2.37e-11 67 32 2 144 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q8FW53 2.92e-11 64 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella suis biovar 1 (strain 1330)
A9WYT1 2.92e-11 64 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VUU3 2.92e-11 64 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YC73 2.92e-11 64 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBQ2 2.92e-11 64 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q7BBW0 2.92e-11 64 31 2 121 1 divK Polar-differentiation response regulator DivK Brucella abortus biovar 1 (strain 9-941)
Q2YKN1 2.92e-11 64 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain 2308)
B2SB45 2.92e-11 64 31 2 121 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain S19)
P45608 3.04e-11 70 23 12 355 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
A7HD43 3.19e-11 69 27 9 224 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
P0DMK6 3.62e-11 69 25 4 225 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
P06594 3.65e-11 70 27 9 237 1 PHYA4 Phytochrome A type 4 Avena sativa
P16497 3.94e-11 70 25 7 248 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
Q75KW7 4.41e-11 64 39 5 127 3 RR41 Two-component response regulator ORR41 Oryza sativa subsp. japonica
Q881J7 5.31e-11 69 23 15 480 1 PSPTO_2896 Blue-light-activated protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48IV1 5.5e-11 69 22 15 481 3 PSPPH_2483 Blue-light-activated protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P52101 8.03e-11 68 22 4 223 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
P0AE82 1.06e-10 68 26 7 228 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 1.06e-10 68 26 7 228 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 1.06e-10 68 26 7 228 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q49ZT9 1.07e-10 68 23 5 237 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8GP19 1.1e-10 68 23 3 226 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q8XA47 1.18e-10 68 23 5 224 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
A0A0H3GPN8 1.55e-10 67 25 7 231 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q5A4X5 1.89e-10 67 33 3 126 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
P66795 2.12e-10 64 36 4 142 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 2.12e-10 64 36 4 142 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
P0A4I6 2.33e-10 67 31 1 117 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 2.33e-10 67 31 1 117 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q2YSS1 2.41e-10 66 22 9 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2FWH7 2.83e-10 67 24 7 254 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q03069 3.52e-10 66 24 8 224 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
P87323 3.59e-10 67 28 4 151 4 mcs4 Response regulator mcs4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P26489 4.01e-10 66 24 14 388 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q5HHW5 4.16e-10 65 25 9 255 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 4.16e-10 65 25 9 255 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 4.16e-10 65 25 9 255 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q840P7 4.72e-10 65 25 9 255 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q06240 4.79e-10 65 22 8 245 1 vanS Sensor protein VanS Enterococcus faecium
Q10DU0 5.78e-10 67 26 8 251 2 PHYA Phytochrome A Oryza sativa subsp. japonica
A2XLG5 5.78e-10 67 26 8 251 3 PHYA Phytochrome A Oryza sativa subsp. indica
Q4ZSY3 6.03e-10 66 22 15 480 3 Psyr_2700 Blue-light-activated protein Pseudomonas syringae pv. syringae (strain B728a)
Q7A6Z3 7.47e-10 65 22 10 269 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 7.47e-10 65 22 10 269 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 7.47e-10 65 22 10 269 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 7.47e-10 65 22 10 269 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 7.47e-10 65 22 10 269 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8XBS3 7.57e-10 63 35 4 137 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
P52076 9.49e-10 62 35 4 137 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q47457 9.6e-10 65 24 4 215 3 pcoS Probable sensor protein PcoS Escherichia coli
Q7A1J2 9.66e-10 64 26 9 254 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 9.66e-10 64 26 9 254 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 9.66e-10 64 26 9 254 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 9.66e-10 64 26 9 254 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 9.66e-10 64 26 9 254 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
O25918 1e-09 62 35 4 123 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
Q6GIT7 1.03e-09 64 26 9 254 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
O34971 1.14e-09 65 26 9 234 3 kdpD Sensor protein KdpD Rathayibacter rathayi
A0PWB4 1.19e-09 62 34 2 118 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
A8Z182 1.25e-09 64 22 10 269 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 1.25e-09 64 22 10 269 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 1.25e-09 64 22 10 269 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 1.25e-09 64 22 10 269 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 1.25e-09 64 22 10 269 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q8NXR5 1.26e-09 64 22 10 269 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 1.26e-09 64 22 10 269 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
P39663 1.32e-09 63 36 4 154 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q742C1 1.57e-09 62 32 2 134 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 1.57e-09 62 32 2 134 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
Q44007 1.72e-09 64 22 4 250 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
F4JZT3 1.95e-09 60 31 3 118 2 ARR24 Two-component response regulator 24 Arabidopsis thaliana
Q86AT9 2.09e-09 65 31 4 121 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 6.26e-09 63 35 2 99 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 2.61e-08 61 28 2 167 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
P45337 3.14e-09 61 33 1 108 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7A216 3.54e-09 61 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 3.54e-09 61 30 4 140 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 3.54e-09 61 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 3.54e-09 61 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 3.54e-09 61 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 3.54e-09 61 30 4 140 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 3.54e-09 61 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 3.54e-09 61 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 3.54e-09 61 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 3.54e-09 61 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 3.54e-09 61 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 3.54e-09 61 30 4 140 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 3.54e-09 61 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 3.54e-09 61 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 3.54e-09 61 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
A1KHB7 3.97e-09 61 33 2 118 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 3.97e-09 61 33 2 118 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P39664 4.18e-09 63 24 6 253 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P76339 4.61e-09 63 25 6 209 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
O34903 5.3e-09 60 36 2 114 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q7D9K0 5.69e-09 61 36 5 114 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 5.69e-09 61 36 5 114 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM9 5.72e-09 60 33 2 118 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 5.72e-09 60 33 2 118 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 5.72e-09 60 33 2 118 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P06593 6.03e-09 63 26 9 237 1 PHYA3 Phytochrome A type 3 Avena sativa
P30733 6.39e-09 63 24 9 269 2 PHYA Phytochrome A Solanum tuberosum
P33639 6.54e-09 62 24 9 228 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4L8M0 7.14e-09 62 24 9 263 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q02482 7.72e-09 62 24 9 272 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
P0C5S6 7.81e-09 63 24 7 287 3 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio harveyi
A7MRY4 8.09e-09 63 24 7 287 1 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio campbellii (strain ATCC BAA-1116)
Q9HV31 8.49e-09 62 25 5 203 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5A872 8.69e-09 63 31 3 149 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A872 1.4e-07 59 41 2 85 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A872 1.77e-06 55 27 4 127 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q47745 8.98e-09 62 24 5 201 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q44006 9.33e-09 60 28 3 153 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q4A160 9.33e-09 60 31 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CQK0 9.6e-09 60 31 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 9.6e-09 60 31 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9I4F9 9.69e-09 60 32 5 187 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P33529 1.13e-08 62 24 7 255 2 PHY Phytochrome Mougeotia scalaris
Q9CD68 1.21e-08 59 35 1 114 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
A0R3I8 1.23e-08 59 33 2 118 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q1B3X8 1.25e-08 59 32 2 134 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 1.25e-08 59 32 2 134 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 1.25e-08 59 32 2 134 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q4L482 1.48e-08 60 21 8 237 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
P19862 1.78e-08 62 26 8 250 3 PHYA1 Phytochrome A Zea mays
P33530 2.89e-08 61 23 9 269 3 PHYA1 Phytochrome A1 Nicotiana tabacum
Q9HU20 3.42e-08 60 26 8 242 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P14712 3.76e-08 60 23 5 235 1 PHYA Phytochrome A Arabidopsis thaliana
O31671 4.37e-08 60 22 4 231 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
P37478 4.84e-08 58 27 7 224 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q54SK5 4.97e-08 60 33 4 121 3 dhkM Hybrid signal transduction histidine kinase M Dictyostelium discoideum
Q54SK5 0.000632 47 29 6 133 3 dhkM Hybrid signal transduction histidine kinase M Dictyostelium discoideum
P76340 5.26e-08 57 33 2 111 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
P32040 5.3e-08 58 37 3 121 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q9ZHD3 5.68e-08 57 36 3 111 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P39928 6.24e-08 60 32 3 135 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39928 4.44e-05 50 27 5 147 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39928 0.000237 48 35 2 82 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P29130 6.39e-08 60 21 7 242 2 PHYB Phytochrome B Nicotiana tabacum
Q8DMC5 6.75e-08 59 24 5 220 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9HWA7 8.31e-08 59 25 15 296 1 pprA Two-component sensor PprA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4LAJ9 1.13e-07 57 30 4 140 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
P18540 1.19e-07 59 25 10 275 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
P93526 1.19e-07 59 26 12 256 2 PHYA Phytochrome a Sorghum bicolor
P18769 1.32e-07 58 31 1 119 1 frzE Gliding motility regulatory protein Myxococcus xanthus
P25852 1.42e-07 58 28 1 157 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z333 1.42e-07 58 28 1 157 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P15939 1.61e-07 58 20 7 279 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P19906 1.65e-07 57 23 12 280 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
Q6GJ10 1.81e-07 57 21 6 222 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
L7N689 1.87e-07 56 32 3 120 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P08401 1.89e-07 58 26 7 215 1 creC Sensor protein CreC Escherichia coli (strain K12)
P0A4I0 2e-07 56 35 2 115 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 2e-07 56 35 2 115 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
Q9HV32 2.07e-07 55 39 1 105 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P43501 2.34e-07 53 32 0 103 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0ACZ8 2.88e-07 55 35 2 111 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 2.88e-07 55 35 2 111 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 2.88e-07 55 35 2 111 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
A7N6S2 3.14e-07 57 23 13 327 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
P34094 3.45e-07 57 22 7 242 3 PHYB Phytochrome B Solanum tuberosum
B8GZM2 3.71e-07 57 33 0 103 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 3.71e-07 57 33 0 103 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9TLQ4 3.94e-07 55 35 5 106 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
O69730 5.58e-07 55 31 1 107 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9K620 5.62e-07 55 25 8 233 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A2XM23 5.76e-07 57 24 8 268 3 PHYC Phytochrome C Oryza sativa subsp. indica
Q8DPL7 5.79e-07 55 30 2 130 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 5.79e-07 55 30 2 130 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 5.79e-07 55 30 2 130 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q47744 6.03e-07 54 32 3 118 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
Q10CQ8 6.06e-07 57 24 8 268 2 PHYC Phytochrome C Oryza sativa subsp. japonica
A0R3I7 6.36e-07 56 22 10 244 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9ZS62 6.37e-07 57 22 6 233 2 PHYB1 Phytochrome B1 Solanum lycopersicum
Q49XM7 6.38e-07 54 36 5 112 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8NV46 6.45e-07 56 20 5 250 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 6.45e-07 56 20 5 250 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
O33071 7.5e-07 56 25 9 255 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
P21866 7.74e-07 54 36 2 110 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
P06592 7.8e-07 56 23 6 241 2 PHYA Phytochrome A Cucurbita pepo
O35044 7.81e-07 55 25 9 239 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
O14283 8.09e-07 56 34 2 104 1 prr1 Transcription factor prr1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q07084 8.23e-07 56 28 5 151 1 SSK1 Osmolarity two-component system protein SSK1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P42422 8.75e-07 55 27 3 113 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
Q70FH0 9.58e-07 53 32 6 156 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
P15001 1.08e-06 56 25 8 243 3 PHYA Phytochrome A Pisum sativum
P9WGN1 1.12e-06 53 28 9 222 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 1.12e-06 53 28 9 222 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q87MX7 1.32e-06 55 34 2 102 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9AE24 1.4e-06 53 32 2 112 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
P93673 1.42e-06 55 25 8 243 3 PHYA Phytochrome type A Lathyrus sativus
P0C5S5 1.46e-06 55 34 2 102 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 1.46e-06 55 34 2 102 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q47456 1.66e-06 53 33 3 115 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
P09431 1.94e-06 54 24 18 355 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q6GE72 1.98e-06 54 20 5 250 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
O25153 1.98e-06 55 30 4 126 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
Q9M8Y4 2.05e-06 51 24 2 120 2 ARR22 Two-component response regulator ARR22 Arabidopsis thaliana
Q5AKU6 2.08e-06 55 29 5 154 1 SSK1 Oxidative stress response two-component system protein SSK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P13792 2.25e-06 53 30 2 129 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q01473 2.32e-06 55 34 1 105 3 rcaC Protein RcaC Microchaete diplosiphon
P93527 2.39e-06 55 21 7 258 1 PHYB Phytochrome B Sorghum bicolor
O87939 2.6e-06 54 25 4 156 3 tdiS Sensor protein TdiS Thauera aromatica
P0A2D9 3.61e-06 53 24 9 245 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 3.61e-06 53 24 9 245 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
Q9HZ47 3.8e-06 53 24 8 226 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7A3X0 4.17e-06 53 20 5 250 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 4.17e-06 53 20 5 250 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 4.17e-06 53 20 5 250 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 4.17e-06 53 20 5 250 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 4.17e-06 53 20 5 250 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
P06218 4.91e-06 53 24 9 245 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
P0C001 5.01e-06 52 34 2 86 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 5.01e-06 52 34 2 86 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 5.01e-06 52 34 2 86 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 5.01e-06 52 34 2 86 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 5.01e-06 52 34 2 86 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 5.01e-06 52 34 2 86 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 5.01e-06 52 34 2 86 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 5.01e-06 52 34 2 86 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
Q9F868 5.12e-06 52 35 2 114 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q52990 5.2e-06 52 31 1 118 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
Q4L6C6 5.25e-06 51 35 5 113 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
Q9I0I1 5.35e-06 52 35 3 108 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q99U73 5.67e-06 51 34 2 86 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
P0A4I8 6.15e-06 53 24 8 239 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 6.15e-06 53 24 8 239 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9KT84 6.41e-06 53 34 3 102 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0AFB7 6.75e-06 52 24 8 244 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 6.75e-06 52 24 8 244 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 6.75e-06 52 24 8 244 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
Q7MM78 6.79e-06 53 34 2 102 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 6.79e-06 53 34 2 102 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P9WGK7 6.82e-06 53 24 9 255 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 6.82e-06 53 24 9 255 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 6.82e-06 53 24 9 255 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q6BGW4 7.19e-06 51 27 1 106 3 SRR1 Stress response regulator protein 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P0CL17 7.76e-06 51 33 3 106 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 7.76e-06 51 33 3 106 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
A8Z553 7.78e-06 52 21 3 234 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 7.78e-06 52 21 3 234 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 7.78e-06 52 21 3 234 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 7.78e-06 52 21 3 234 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 7.78e-06 52 21 3 234 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
P9WGL9 8.1e-06 51 35 2 114 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 8.1e-06 51 35 2 114 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 8.1e-06 51 35 2 114 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7A1J1 8.12e-06 51 30 4 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 8.12e-06 51 30 4 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 8.12e-06 51 30 4 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 8.12e-06 51 30 4 106 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 8.12e-06 51 30 4 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 8.12e-06 51 30 4 106 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 8.12e-06 51 30 4 106 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 8.12e-06 51 30 4 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 8.12e-06 51 30 4 106 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 8.12e-06 51 30 4 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
P0AEV3 8.17e-06 52 34 1 103 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 8.17e-06 52 34 1 103 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 8.17e-06 52 34 1 103 3 rssB Regulator of RpoS Escherichia coli O157:H7
P35163 8.55e-06 51 30 2 105 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
Q2YZ23 8.64e-06 52 20 5 250 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9RZA4 8.79e-06 53 36 3 116 1 bphP Bacteriophytochrome Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_03630
Feature type CDS
Gene arcB
Product aerobic respiration two-component sensor histidine kinase ArcB
Location 40051 - 42384 (strand: -1)
Length 2334 (nucleotides) / 777 (amino acids)
In genomic island -

Contig

Accession ZDB_681
Length 269562 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_784
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00512 His Kinase A (phospho-acceptor) domain
PF01627 Hpt domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
PF08448 PAS fold
PF18415 Histidine kinase receptor ArcB trans-membrane domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07648 two-component system, OmpR family, aerobic respiration control sensor histidine kinase ArcB [EC:2.7.13.3] Two-component system
Biofilm formation - Escherichia coli
-

Protein Sequence

MKLLRGLAQYYVDLLMKLGLVRFSLLLASGLVVLAMVVQIAVTMLLQGEVQSIDLVRSVFFGLLITPWAVYFMSVVVEQLEESRQRLSRLVSKLEVMRKRDLELNEQLKENITQLNQEITEREKVEDEQVVLLDKLKKEISRREQTQLEFEQQSVLLRSFLDASPDLVYYRNEKNEFSGCNRAMELLTGRSEKLLRGLTPRDIYEPEIADKVMETDEKVFRHNVSLTYEQWLVYPDGRKACFELRKVPFYDSVGKRHGLMGFGRDITERKRYQEAIENASREKTTFISTISHELRTPLNGIVGLSRILLDTDLNPEQENYLKTIHVSAVTLGNIFNDVIEMDKLERRNVRLDTQPVNFTEFISDLENLSGLLVQPKGLQFTLDLIQPVPSVIMADGTRLRQILWNLIGNGVKFTREGGITVKVWREANDMLCFEVRDSGIGIPKDELEKIFAMYYQVTDSAGGRPATGTGIGLAVSRRLAQAMGGDITVTSEPGKGSCFTLSVCAPAQEAPEEEDDDGLLLPALNILLVEDIELNVVVARSVLEKLGNTVDVAMNGRDALAMFSPEEYDLVLLDIQLPDMSGLDIARELHQRYQADDLPPLVALTANVLKDKKEYLDAGMDDVLSKPLAVGALTQMIAKFWGDGSEALPAEESGSAASEDVYAQSLDLEMLNQYIELVGPKLIEDSLDVFEKMMPGYLAILNSNMVAKDRKGIAEEGHKIKGAAGSVGLIHLRQVAQQIQSPELPAWDDNVQEWVDELNHDWESQVGILRNWLANRR

Flanking regions ( +/- flanking 50bp)

CGCCAATTTTACGTTATGATACTAACCCTCATTCAGCGGGTGGAGCAGGTATGAAATTGCTACGCGGTTTAGCACAATATTATGTTGATTTACTGATGAAACTGGGCCTGGTCCGGTTTTCGTTATTGCTGGCATCGGGACTGGTGGTGCTGGCGATGGTGGTGCAGATTGCTGTCACCATGCTGCTTCAGGGGGAAGTACAGAGCATTGACCTGGTGCGCTCTGTCTTCTTCGGCCTGCTGATCACGCCGTGGGCGGTCTATTTTATGTCTGTGGTGGTTGAACAGCTGGAGGAATCCCGCCAGCGCCTGTCCAGACTGGTCAGTAAACTGGAAGTGATGCGCAAGCGGGATCTCGAACTCAATGAACAGCTGAAAGAGAACATTACCCAACTGAATCAGGAGATTACCGAGCGCGAAAAAGTTGAGGATGAACAGGTTGTTCTGCTGGATAAACTGAAGAAAGAGATCAGCCGCCGCGAACAGACCCAGCTCGAATTTGAACAGCAATCTGTCCTGCTGCGCTCCTTCCTTGATGCTTCGCCGGACCTGGTGTATTACCGCAATGAGAAAAATGAGTTTTCCGGCTGTAACCGCGCGATGGAACTGCTTACCGGCCGCAGTGAAAAACTGCTGCGCGGCCTGACCCCGCGCGATATTTATGAACCGGAAATCGCTGATAAGGTGATGGAAACGGATGAAAAAGTGTTCCGTCATAATGTTTCGCTCACCTATGAGCAGTGGCTGGTCTACCCGGACGGACGCAAAGCCTGCTTTGAGCTGCGCAAAGTACCGTTCTATGACAGTGTCGGCAAACGCCACGGCCTGATGGGCTTTGGTCGTGATATCACTGAGCGCAAGCGTTATCAGGAAGCGATTGAAAACGCCAGCCGTGAGAAAACCACCTTTATCTCCACCATCAGTCACGAACTGCGTACGCCACTGAACGGGATTGTCGGGCTGAGCCGCATTCTGCTGGATACGGATCTCAATCCGGAACAGGAAAACTACCTGAAAACCATTCATGTCAGCGCCGTCACCCTCGGCAATATCTTCAATGACGTGATTGAGATGGACAAACTGGAGCGGCGCAATGTCCGCCTCGATACCCAGCCGGTCAATTTCACCGAATTTATTTCTGATCTGGAAAACCTGTCCGGGCTGCTGGTGCAGCCGAAAGGGCTGCAGTTCACTCTCGACCTGATCCAGCCGGTACCGTCTGTGATCATGGCGGATGGCACCCGTCTGCGCCAGATCCTGTGGAATCTTATCGGCAACGGCGTGAAGTTCACCCGCGAAGGCGGTATCACGGTGAAAGTGTGGCGTGAAGCCAATGATATGCTCTGCTTTGAGGTGCGGGATTCCGGTATCGGCATTCCGAAGGATGAGCTGGAAAAAATCTTCGCCATGTATTACCAGGTAACGGACAGCGCGGGCGGACGCCCTGCCACCGGTACCGGTATCGGCCTGGCGGTCTCCCGCCGTCTGGCACAGGCAATGGGCGGTGATATCACCGTGACCAGTGAGCCGGGCAAAGGCTCCTGCTTCACGCTGTCGGTCTGCGCACCGGCCCAGGAGGCTCCGGAGGAGGAGGACGATGACGGTCTGCTGCTGCCGGCCCTGAATATCCTGCTGGTGGAAGATATCGAGCTGAATGTGGTGGTGGCGCGCTCTGTCCTGGAAAAACTGGGTAATACGGTGGATGTCGCGATGAACGGCCGTGACGCGCTGGCGATGTTCTCGCCGGAGGAGTACGACCTTGTGCTGCTGGATATTCAGCTGCCGGATATGAGCGGACTGGATATCGCCCGTGAGCTGCATCAGCGTTATCAGGCGGATGATTTACCGCCGCTGGTGGCACTGACCGCCAATGTGCTGAAGGATAAAAAAGAGTATCTGGACGCCGGTATGGATGACGTGCTGAGCAAACCTCTCGCTGTGGGCGCTCTGACGCAGATGATAGCGAAATTCTGGGGAGACGGTAGTGAGGCACTGCCTGCGGAGGAAAGCGGCTCAGCGGCGTCTGAGGACGTGTATGCGCAGTCACTGGATCTGGAGATGCTGAATCAGTACATCGAACTGGTGGGACCGAAACTGATTGAAGACAGCCTGGATGTGTTTGAAAAAATGATGCCGGGCTATCTGGCGATCCTCAATTCCAACATGGTGGCGAAAGACCGCAAAGGCATTGCGGAAGAGGGACATAAAATCAAAGGCGCCGCCGGGTCAGTCGGGCTTATCCATCTGCGGCAGGTTGCACAGCAGATTCAGTCACCGGAATTACCGGCATGGGACGATAACGTGCAGGAGTGGGTCGATGAACTGAATCACGATTGGGAAAGTCAGGTGGGAATTTTAAGAAACTGGCTGGCAAATCGCAGGTAAAAAATAACCCCAACCGAGGTTGGGGTGCGCGAATACTGCGCCAACACCAG