Homologs in group_305

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08170 FBDBKF_08170 89.6 Morganella morganii S1 ilvE branched-chain amino acid transaminase
EHELCC_13355 EHELCC_13355 90.0 Morganella morganii S2 ilvE branched-chain-amino-acid transaminase
NLDBIP_13695 NLDBIP_13695 89.6 Morganella morganii S4 ilvE branched-chain amino acid transaminase
LHKJJB_12860 LHKJJB_12860 89.6 Morganella morganii S3 ilvE branched-chain amino acid transaminase
HKOGLL_12170 HKOGLL_12170 89.6 Morganella morganii S5 ilvE branched-chain amino acid transaminase
F4V73_RS18700 F4V73_RS18700 89.6 Morganella psychrotolerans - branched-chain amino acid transaminase
PMI_RS08325 PMI_RS08325 29.8 Proteus mirabilis HI4320 - D-amino-acid transaminase

Distribution of the homologs in the orthogroup group_305

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_305

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A1A5 0.0 582 89 0 306 1 ilvE Branched-chain-amino-acid aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1A6 0.0 582 89 0 306 3 ilvE Branched-chain-amino-acid aminotransferase Salmonella typhi
P0AB80 0.0 581 89 0 306 1 ilvE Branched-chain-amino-acid aminotransferase Escherichia coli (strain K12)
P0AB81 0.0 581 89 0 306 3 ilvE Branched-chain-amino-acid aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AB82 0.0 581 89 0 306 3 ilvE Branched-chain-amino-acid aminotransferase Escherichia coli O157:H7
O27481 1.52e-125 363 58 1 296 3 ilvE Putative branched-chain-amino-acid aminotransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O86428 1.92e-100 300 49 2 302 1 ilvE Branched-chain-amino-acid aminotransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O67733 3.44e-73 230 39 5 305 3 ilvE Probable branched-chain-amino-acid aminotransferase Aquifex aeolicus (strain VF5)
O29329 3.35e-69 219 41 4 289 1 ilvE Putative branched-chain-amino-acid aminotransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q58414 9.14e-64 206 41 3 281 3 ilvE Putative branched-chain-amino-acid aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1RIJ2 1.27e-58 192 38 5 272 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia bellii (strain RML369-C)
Q4ULR3 1.68e-57 189 36 4 262 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q92I26 1.9e-56 187 36 4 262 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9AKE5 5.71e-54 180 34 4 262 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
O05970 5.32e-52 175 34 4 262 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia prowazekii (strain Madrid E)
P54691 5.86e-50 171 34 8 297 3 ilvE Probable branched-chain-amino-acid aminotransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8CQ78 2.04e-48 168 34 6 316 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRJ8 2.95e-48 167 34 6 316 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P63513 2.04e-46 163 33 6 316 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain MW2)
Q6GBT3 2.04e-46 163 33 6 316 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain MSSA476)
P99138 2.04e-46 163 33 6 316 1 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain N315)
P63512 2.04e-46 163 33 6 316 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIC1 2.04e-46 163 33 6 316 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain COL)
Q6GJB4 3.58e-46 162 34 6 316 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain MRSA252)
O86505 6.44e-37 138 33 10 321 3 ilvE Probable branched-chain-amino-acid aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9M401 7.08e-36 136 31 10 326 1 BCAT3 Branched-chain-amino-acid aminotransferase 3, chloroplastic Arabidopsis thaliana
Q9FYA6 6.19e-35 134 31 9 317 1 BCAT5 Branched-chain-amino-acid aminotransferase 5, chloroplastic Arabidopsis thaliana
O31461 1.2e-34 132 30 7 313 1 ilvE Branched-chain-amino-acid transaminase 1 Bacillus subtilis (strain 168)
P9WQ75 1.48e-34 132 32 12 326 1 ilvE Branched-chain-amino-acid aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ74 1.48e-34 132 32 12 326 3 ilvE Branched-chain-amino-acid aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
K7QHS5 2.15e-34 132 32 10 307 1 BCAT2 Branched-chain amino acid aminotransferase 2, chloroplastic Humulus lupulus
Q9ASR4 2.56e-33 131 32 7 288 2 At5g27410 Branched-chain-amino-acid aminotransferase-like protein 2 Arabidopsis thaliana
P54694 5.56e-33 125 31 8 294 3 dat D-alanine aminotransferase Staphylococcus haemolyticus
Q8W0Z7 6.3e-33 130 31 8 292 2 At3g05190 Branched-chain-amino-acid aminotransferase-like protein 1 Arabidopsis thaliana
O32954 9.11e-32 124 31 13 333 3 ilvE Probable branched-chain-amino-acid aminotransferase Mycobacterium leprae (strain TN)
A0R066 1.05e-31 124 32 13 333 1 ilvE Branched-chain-amino-acid aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P39576 5.23e-30 119 28 7 325 1 ilvK Branched-chain-amino-acid aminotransferase 2 Bacillus subtilis (strain 168)
Q9ZJF1 6.59e-30 119 31 10 310 3 ilvE Branched-chain-amino-acid aminotransferase Helicobacter pylori (strain J99 / ATCC 700824)
P19938 8.84e-30 117 28 6 290 1 dat D-alanine aminotransferase Bacillus sp. (strain YM-1)
Q9M439 3.27e-29 118 28 10 322 1 BCAT2 Branched-chain-amino-acid aminotransferase 2, chloroplastic Arabidopsis thaliana
Q6G8H7 3.8e-29 115 29 6 286 3 dat D-alanine aminotransferase Staphylococcus aureus (strain MSSA476)
Q5HF24 3.96e-29 115 29 6 286 3 dat D-alanine aminotransferase Staphylococcus aureus (strain COL)
Q8NW24 4.12e-29 115 29 6 286 3 dat D-alanine aminotransferase Staphylococcus aureus (strain MW2)
Q6GFV1 4.12e-29 115 29 6 286 3 dat D-alanine aminotransferase Staphylococcus aureus (strain MRSA252)
P99090 5.41e-29 115 29 6 286 1 dat D-alanine aminotransferase Staphylococcus aureus (strain N315)
P63511 5.41e-29 115 29 6 286 3 dat D-alanine aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
P54692 6.73e-29 115 27 6 298 3 dat D-alanine aminotransferase Bacillus licheniformis
Q9LPM9 6.78e-29 116 28 10 317 1 BCAT6 Branched-chain-amino-acid aminotransferase 6 Arabidopsis thaliana
Q8CS41 2.94e-28 113 29 7 293 3 dat D-alanine aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNG0 2.94e-28 113 29 7 293 3 dat D-alanine aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9LPM8 6.03e-28 114 29 9 307 5 BCAT7 Putative branched-chain-amino-acid aminotransferase 7 Arabidopsis thaliana
O26004 1.3e-27 112 30 10 310 3 ilvE Branched-chain-amino-acid aminotransferase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9LE06 9.1e-27 110 27 9 305 1 BCAT4 Methionine aminotransferase BCAT4 Arabidopsis thaliana
K7QKH1 1.29e-25 108 30 10 289 1 BCAT1 Branched-chain amino acid aminotransferase 1, mitochondrial Humulus lupulus
P54693 4.83e-25 104 25 5 285 3 dat D-alanine aminotransferase Lysinibacillus sphaericus
A7SLW1 7.24e-25 106 26 9 319 3 v1g246094 Branched-chain-amino-acid aminotransferase Nematostella vectensis
O07597 8.93e-23 98 28 9 287 3 dat D-alanine aminotransferase Bacillus subtilis (strain 168)
P54689 1.88e-22 99 28 12 326 3 ilvE Branched-chain-amino-acid aminotransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q93Y32 3.17e-22 99 27 10 310 1 BCAT1 Branched-chain-amino-acid aminotransferase 1, mitochondrial Arabidopsis thaliana
Q71Z49 3.45e-22 97 27 7 290 3 dat D-alanine aminotransferase Listeria monocytogenes serotype 4b (strain F2365)
Q92B90 8e-22 96 28 9 296 3 dat D-alanine aminotransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0A179HME7 2.76e-21 96 25 10 326 2 lcsP Aminotransferase lcsP Purpureocillium lilacinum
Q5AV04 4.54e-21 95 27 12 329 2 atnJ Aminotransferase atnJ Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
G2JZ74 7.55e-21 93 27 8 305 3 dat D-alanine aminotransferase Listeria monocytogenes serotype 1/2a (strain 10403S)
P0DJL9 9.71e-21 93 27 7 293 3 dat D-alanine aminotransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P74921 1.37e-20 92 27 7 286 1 ilvE Probable branched-chain-amino-acid aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q5AV02 1.45e-19 91 26 9 292 2 atnH Branched-chain-amino-acid aminotransferase atnH Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O14370 2.21e-19 91 28 15 334 1 eca39 Branched-chain-amino-acid aminotransferase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54N47 4.59e-19 89 26 12 305 3 bcaA Branched-chain-amino-acid aminotransferase Dictyostelium discoideum
P54690 1.01e-18 89 29 13 290 1 Bcat1 Branched-chain-amino-acid aminotransferase, cytosolic Rattus norvegicus
P54687 2.02e-18 88 28 13 291 1 BCAT1 Branched-chain-amino-acid aminotransferase, cytosolic Homo sapiens
Q5REP0 2.16e-18 88 26 11 293 2 BCAT2 Branched-chain-amino-acid aminotransferase, mitochondrial Pongo abelii
Q5EA40 2.71e-18 87 27 11 284 2 BCAT2 Branched-chain-amino-acid aminotransferase, mitochondrial Bos taurus
P54688 3.82e-18 87 30 12 280 2 bcat-1 Branched-chain-amino-acid aminotransferase, cytosolic Caenorhabditis elegans
O15382 5.65e-18 87 26 11 293 1 BCAT2 Branched-chain-amino-acid aminotransferase, mitochondrial Homo sapiens
P24288 1.3e-17 85 29 13 287 1 Bcat1 Branched-chain-amino-acid aminotransferase, cytosolic Mus musculus
P28821 2.54e-17 84 26 6 280 3 pabC Aminodeoxychorismate lyase Bacillus subtilis (strain 168)
K0E3V3 3.57e-17 84 25 10 326 1 htyB Transaminase htyB Aspergillus rugulosus
Q9GKM4 6.44e-17 83 28 13 287 2 BCAT1 Branched-chain-amino-acid aminotransferase, cytosolic Ovis aries
P47176 1.04e-16 83 25 14 329 1 BAT2 Branched-chain-amino-acid aminotransferase, cytosolic Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
S7ZEI5 9.3e-16 80 24 9 320 1 poxL Aminotransferase poxL Penicillium oxalicum (strain 114-2 / CGMCC 5302)
O35855 9.3e-16 80 26 12 292 1 Bcat2 Branched-chain-amino-acid aminotransferase, mitochondrial Mus musculus
Q9KQI0 3.33e-15 77 23 7 267 3 pabC Aminodeoxychorismate lyase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A1W5T1Y5 3.51e-15 78 24 9 320 1 poxL Aminotransferase poxL Penicillium oxalicum
O35854 4.93e-15 78 25 10 290 1 Bcat2 Branched-chain-amino-acid aminotransferase, mitochondrial Rattus norvegicus
S0DS11 8.83e-15 77 24 10 310 1 apf4 Aminotransferase apf4 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
C9K7B6 2.88e-14 75 25 7 264 2 AMT5 Transaminase AMT5 Alternaria alternata
P38891 3.5e-14 75 24 12 312 1 BAT1 Branched-chain-amino-acid aminotransferase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C9K7D8 4.62e-14 75 25 7 264 3 AMT5-2 Transaminase AMT5-2 Alternaria alternata
A9UZ24 1.3e-13 73 25 12 323 3 37018 Branched-chain-amino-acid aminotransferase Monosiga brevicollis
S3DQP8 2.75e-12 70 25 8 260 1 gloG Branched-chain amino acid aminotransferase gloG Glarea lozoyensis (strain ATCC 20868 / MF5171)
Q9Y885 6.78e-10 62 22 10 329 3 TOXF Aminotransferase TOXF Cochliobolus carbonum
I1R9B6 1.91e-09 61 23 12 308 3 FGRAMPH1_01T00157 Aminotransferase FGSG_00049 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q56693 1.1e-08 58 23 9 262 3 pabC Aminodeoxychorismate lyase Vibrio harveyi
P28305 1.89e-07 55 29 0 102 1 pabC Aminodeoxychorismate lyase Escherichia coli (strain K12)
Q8L493 1.93e-05 49 21 5 264 1 DAAT D-amino-acid transaminase, chloroplastic Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16410
Feature type CDS
Gene -
Product branched-chain amino acid transaminase
Location 3617882 - 3618808 (strand: 1)
Length 927 (nucleotides) / 308 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_305
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF01063 Amino-transferase class IV

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0115 Amino acid transport and metabolism (E)
Coenzyme transport and metabolism (H)		 EH Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase

Kegg Ortholog Annotation(s)

Protein Sequence

MTKQADYIWFNGEMVPWAEAKVHVMSHALHYGTSVFEGVRCYDSHKGPVVFRHREHMQRLHDSAKIYRMPVAQSVDELMEACRETLRKNQLVSAYIRPLVFIGDVGMGVNPPEGYKTDIIIAAFPWGAYLGEEALDKGIDAMVSSWHRAAPNTIPTAAKAGGNYLSSLLVGSEARRHGYQEGIALDVHGYLSEGAGENLFEVKDGVIFTPPFTSSALPGITRDAIIKLAKDLGYEIREQVLSRESLYLADEVFMSGTAAEITPVRSVDGIQVGIGRCGPVTKAIQKAFFGLFTGETEDKYGWLDPVNP

Flanking regions ( +/- flanking 50bp)

AGAAAAATTACAATTCATAAGTGCACTTAGTGCCATGTAAGGATAGAAGAATGACAAAGCAAGCTGATTATATTTGGTTTAACGGTGAAATGGTTCCATGGGCTGAGGCAAAAGTACATGTCATGTCTCACGCACTACATTATGGAACGTCTGTATTTGAAGGAGTACGTTGCTACGATTCCCATAAAGGGCCTGTCGTTTTTCGCCATCGTGAGCATATGCAACGATTGCATGATTCTGCCAAAATTTATCGTATGCCTGTCGCGCAAAGTGTTGATGAGTTAATGGAAGCTTGTCGCGAAACATTGCGCAAAAACCAGTTAGTCAGCGCTTATATTCGTCCTTTAGTTTTTATTGGTGATGTCGGAATGGGGGTTAATCCACCAGAAGGTTATAAAACCGATATCATTATTGCTGCATTCCCATGGGGGGCATATTTAGGTGAAGAGGCGTTAGATAAAGGGATTGATGCGATGGTCTCTTCTTGGCATCGAGCAGCACCTAATACTATCCCGACGGCGGCCAAAGCAGGAGGTAATTATCTCTCTTCATTGTTAGTGGGCAGTGAAGCTCGTCGCCATGGTTATCAAGAAGGGATTGCATTAGATGTTCATGGTTATCTTTCTGAAGGGGCTGGTGAGAACTTATTTGAAGTAAAAGATGGCGTTATTTTTACTCCTCCATTTACCTCATCTGCGCTACCGGGGATCACTCGCGACGCAATTATTAAATTAGCGAAAGATCTCGGTTATGAAATTCGTGAACAAGTACTGTCTCGAGAATCTCTCTATCTTGCTGATGAAGTGTTTATGTCTGGTACCGCTGCAGAAATTACACCAGTTCGTAGCGTTGATGGTATTCAAGTTGGTATTGGTCGCTGTGGTCCAGTAACAAAAGCTATTCAGAAAGCTTTCTTTGGTTTGTTTACGGGTGAAACCGAAGACAAATACGGCTGGTTAGATCCTGTCAATCCATAATCATAATTAAATACATTTATTGAGCGAGTAGTTCGTTCCCTACTCGCTGT